CN101921807A - Construction method for oriented gene transfer vector in compound type liver - Google Patents

Abstract

The invention discloses a construction method for an oriented gene transfer vector in a compound type liver. The method is characterized by comprising the following steps: A1, constructing an HGF vector and an asTGF beta1 vector for adenoviruses; A2, constructing a chitose-coated pAdV.CMV-HGF-asTGF beta1 nanosphere virus vector compound; and A3, coating asialoglycoprotein AsOR on the nanoshphere, i.e. the pAdV.CMV-HGF-asTGF beta1 compound. In the invention, a novel oriented gene transfer vector in the compound type liver is constructed so as to reduce the immunogenicity of viral gene vectors, improve the gene transfer efficiency and directionality of non-viral gene vectors.

Description

A kind of construction method for oriented gene transfer vector in compound type liver

Technical field

The present invention relates to hepatopathy gene medical field, relate in particular to a kind of construction method for oriented gene transfer vector in compound type liver.

Background technology

Worldwide, liver cirrhosis has become the major disease that is only second to cardiovascular and cerebrovascular disease and malignant tumour, and is very harmful to the mankind.The annual patient with liver cirrhosis of China exceedes 1,000,000, and result of treatment is not good, and in a single day patient enters and lose the compensatory phase, and survival rate was extremely low in 5 years.There is hepatic fibrosis in the caused chronic hepatopathy overwhelming majority of the various causes of disease, wherein 25%-40% finally develops into liver cirrhosis and to liver cancer, and, hepatic fibrosis is the only stage which must be passed by that various chronic hepatopathys are developed to liver cirrhosis, pathology can be ended at hepatic fibrosis stage even reverse to normal, be the key of treatment hepatopathy.But in real work, treating liver fibrosis is still lacked effective way, actively seek the novel method for the treatment of liver fibrosis, have important practical significance and social effect.

Present studies confirm that in the pathogenesis of hepatic fibrosis, have the factor of two aspects to play a major role, the one, and hepatocellular damage, the 2nd, the overactivity of hepatic stellate cell (HSC).

At hepatocellular injury in the hepatic fibrosis pathogenic process and these two kinds of main diseases of HSC overactivity because of, and pHGF (HGF) and the vital role of these two kinds of cytokines of transforminggrowthfactor-(TGF-β 1) in hepatic fibrosis, many scholars utilize HGF and TGF-β 1 these two kinds of genes, carry out the experimental study for the treatment of liver fibrosis with gene therapy methods.

But these methods of treatment all have certain shortcoming, at first all be to select single therapeutic gene for use, its result of treatment is difficult to satisfactory, result of study prompting at present: it is an important factor of bringing out hepatic fibrosis that interior HGF of liver and TGF-β 1 balance wreck, as above-mentioned, TGF-β 1 can regard the most strong cytokine relevant with hepatic fibrosis as, and it can make the fibrous tissue accumulation and suppress its decomposing system.In cirrhotic tissue, can confirm that TGF-β 1 has superfluous the expression, and HGF expresses on the contrary lowly.At the hepatic injury that takes place repeatedly, as important liver injury reparative factor should high expression level HGF, but former thereby low because of certain, thus cause the liver accumulation of fibers.Once had report TGF-β 1 can suppress HGF mRNA and express, this may be that HGF expresses low reason.According to another the research of Ueki etc., confirmed that again HGF then can suppress TGF-β 1 and express.Under physiological status, HGF and TGF-β 1 may assist mutually coordinate common regulate with inflammation-inhibiting with adjust regeneration, and when causing this balance to destroy, can cause fibrous tissue to be tending towards accumulation and form hepatic fibrosis because of mechanism such as inflammation continue.At this situation, our combined utilization antisense TGF β 1 and just HGF gene carry out gene transfection, recover HGF and TGF-β 1 equilibrium relationship in the damaged liver,, wish to receive the ideal curative effect in the hope of when repairing hepatocellular injury, suppressing the overactivity of hepatic stellate cell again.

The transfection carrier liver specificity of using always in the hepatic gene treatment at present is poor in addition, and transfection efficiency is low, has influenced curative effect.Transgenic method mainly contains in liver cell at present commonly used and the liver: 1, adopt the virus vector method as adenovirus, adeno-associated virus (AAV) and retrovirus, 2, the non-virus carrier method is as liposome, asialoglycoprotein one polylysine (ASoR-PL) complex body etc.3, simple directly transduction method of cDNA plasmid etc.The three compares, viral vector gene transfection efficient height, stable strong, but application should cause the antiviral immunity rejection of acceptor complement-mediated in the body, thus influence application in its iterative, reach expression efficiency and expression time.Its directional property is poor in addition, and security also receives publicity always; Non-virus carrier is used but have in the safe iterative, and easily and other antibodies, the direction-sense advantage that increases, but its gene transfering efficiency is low than virus vector; Plasmid and cDNA direct injection are the simplest, easy to use, but the shortest than its gene transfering efficiency of the former two minimum expression time.

Therefore there is defective in prior art, needs to improve.

Summary of the invention

Technical problem to be solved by this invention is at the deficiencies in the prior art, and a kind of new oriented gene transfer vector in compound type liver is provided.

Technical scheme of the present invention is as follows:

A kind of construction process of oriented gene transfer vector in compound type liver may further comprise the steps A1, adenovirus HGF, asTGF β 1 vector construction; A2, chitose parcel pAdV.CMV-HGF-asTGF β 1 nano-microcapsule virus vector complex body makes up; A3, nano-microcapsule-pAdV.CMV-HGF-asTGF β 1 complex body exoperidium asialoglycoprotein glycoprotein A sOR.

Described construction process, operation below described steps A 1 concrete execution the: adopt adenoviral plasmid, pAd.CMV and target gene plasmid PCL-HGF, PCBL-asTGF β 1, cut connection through enzyme, recombination to construct pAd.CMV-HGF-asTGF β 1 adenovirus LacZ, Luciferase gene transfection carrier; Through transfection Escherichia coli, amplification is extracted; Gained part pAd.CMV-HGF-asTGF β 1 plasmid, the defective type pJM17 reorganization with containing albumin promoter and enhanser produces complete virus genom DNA, rotaring redyeing 293 cell, carry out AdV virus packing after, extraction pAdV.CMV-HGF-asTGF β 1.

Described construction process, operation below described steps A 2 concrete execution the: 0.02% chitose, NaAcHoAc liquid+pAdV.CMV-HGF-asTGF β 1,1ug/ml PSS solution adds NHS-PEG-MAL behind the mixing, MW2000, SSA-PEGMW 5000 and PBS solution carry out derivative reaction, add the propylhomoserin termination reaction, add the sulfhydrylation Transferrins,iron complexes again, form nano-microcapsule pAdV.CMV-HGF-asTGF β 1 suspension under the room temperature, carry out ultracentrifugation and extract freeze-drying purifying nano micro-capsule virus vector complex body; Gained nano-microcapsule pAdV.CMV-HGF-asTGF β 1 complex body dilutes through PBS liquid; The Pincocreen method is measured its DNA bag carrying capacity; After its diameter of laser scattering method, the size, stand-by.

Described construction process, operation below described steps A 3 concrete execution the: from porcine blood serum, extract AsOR, AsOR mixes with Poly-L-lysine again, utilize the contained Transferrins,iron complexes of composite Nano micro-capsule wall, it is crosslinked that AsOR-PL and Transferrins,iron complexes are pressed the WangnerShi method, purified acquisition AsOR-PL-Nanosphere-pAdV.CMV-HGF-asTGF β 1 complex body.

The present invention combines the advantage of viral genetic vector and non-viral gene vector, utilize nano-microcapsule (Nanosphare) and asialoglycoprotein glycoprotein-poly-lysine (AsOR-PL) carrier technique, by nano-microcapsule parcel viral genetic vector, and at its exoperidium asialoglycoprotein glycoprotein-poly-lysine (AsOR-PL), very abundant asialoglycoprotein receptor (ASG) is arranged on the normal liver cell film, and each liver cell has 500,000 approximately for binding site.ASG is subjected to the asialoglycoprotein glycoprotein in the specific identification blood of physical efficiency.The present invention also is recombined into adenovirus carrier with albumin promoter in addition, gives the characteristic of adenovirus carrier with the liver cell specifically expressing, thereby sets up a kind of new oriented gene transfer vector in compound type liver.In the hope of lowering the immunogenicity of viral genetic vector, improve non-viral gene vector transgene efficiency and directional property.

Description of drawings

Fig. 1 is the technological line figure of construction process of the present invention;

Fig. 2 is the animal liver tissue fluorescent microscope photo of injection nano-microcapsule plasmid in the body;

Fig. 3 is compound gene transfer vector anti-hepatic fibrosis test optical microscope photograph for nano-microcapsule wraps up.

Embodiment

Below in conjunction with the drawings and specific embodiments, the present invention is described in detail.

Embodiment 1

The preparation method of nano-microcapsule complex body

One) goal gene obtains

1.HGF obtaining of gene

1.1 extracting and the RT-PCR of total RNA

From-80 ℃ of refrigerators, take out the coating whole person tire liver 1g that keeps in advance, go out total RNA by RNA extraction agent box specification sheets method-step extracting, and it is standby to put into-20 ℃ of refrigerators.Use the Primer analysis software HGF sequence is analyzed, design 1 pair of PCR primer: primers F: 5`CCGGCTTGCAACATTCTT3`; Primer R:5`TGCTTCAAATACACTGGCCTCTTCTA3`.Application of sample in the following order: 10mmoL/L buffer 1 μ L, 25mmoL/L magnesium chloride 2 μ L, 10mmoL/L dNTP1 μ L, Rnase 0.2 μ L, Rtase0.2 μ L, Tag0.2 μ L, primers F 0.4 μ L, primer R 0.4 μ L, total RNA 3.6 μ L, DEPC ddH201.0 μ L.Add up to cumulative volume 10 μ L.Reaction conditions: 94 ℃ 50 seconds, 54 ℃ 60 seconds, 72 ℃ 90 seconds.Amplification 35 is taken turns.RNA is a control group with the extracting hepatic tissue, is that experimental group is carried out electrophoretic analysis with the amplified production, and the capable glue of gained amplified production is reclaimed, and glue reclaims and undertaken by the test kit specification sheets.

1.2 transformed into escherichia coli

Get the ready prepd competence plasmid of 30 μ L, add 3 μ L PCR products, rotate 30min gently in frozen water, 42 ℃ of thermal shocks are 45 seconds then, and ice bath 3min adds 250 μ L NZY, in 37 ℃ of 225～250r/min shaking table recovery 1h.Draw 150 μ L conversion products, the LB flat board that the shop has been got ready is cultivated 24～48h in 37 ℃ of incubators.Select well-grown bacterium colony, add in the 500mL LB substratum and shake bacterium 24h.Take out the LB nutrient solution of pUC18 plasmid, the centrifugal 2min of 8000r/min, extracting plasmid, reclaim the dna fragmentation that obtains 2.2kb with Xba I, with Nru I and PvuII double digestion pcDNA3, reclaim the dna fragmentation of about 1.0kb, with these 2 fragments connect plasmid pUD (about 3.3kb).With Ava II and Ssp I double digestion pUD, reclaim the dna fragmentation of about 2.7kb, cut pEGFP-N1 with AVR II enzyme in addition, reclaim the dna fragmentation of about 1.1kb, this fragment contains complete kanamycin gene, connects 2 recovery dna fragmentations and gets plasmid pUDK (about 3.8kb).Then goal gene is cloned into the multiple clone site of pUDK carrier, obtains to carry the recombinant plasmid vector of goal gene.

2. positive antisense TGF β 1 gene obtains

2.1TGF the segmental acquisition of β 1 gene purpose

Two pairs of primers of cDNA sequences Design according to TGF β 1, the restriction enzyme site that EcoR I and HindIII are arranged respectively, two pairs of primer sequences are identical, but restriction enzyme site that they two ends hang is opposite, first couple of primer TGF β 1-F1 wherein, the restriction enzyme site of R1 is identical with the polyclone restriction enzyme site order of pcDNA3.1 (), and another is to primer TGF β 1-F2, and R2 is opposite with its direction.With tire brain cDNA is template, pcr amplification TGF β 1 purpose fragment, and the PCR reaction conditions: 96 ℃ of pre-sex change 4min, 95 ℃ of sex change 20s, 66 ℃ of annealing 30s, 72 ℃ are extended 90s, 32 circulations, 72 ℃ are extended 10min again.Reclaim two PCR products of purifying with electroelution method.Difference called after TGF β 1-1 and TGF β 1-2, two PCR product clip size unanimities EcoR I and III restriction enzyme site are all arranged, but direction are opposite.

2.2 the structure of recombinant chou T-TGF β 1-1 of intermediary and TGF β 1-2

After the PCR product end of two purifying added " A ", they are connected to the T carrier, transform JM109, extract and identify with EcoR I and Hind III double digestion behind the plasmid and order-checking confirmation purpose fragment does not have sudden change, obtain two intermediary's recombinant chous with the T4 ligase enzyme.Difference called after T-TGF β 1-1 and T-TGF β 1-2.

2.3 the structure of expression recombinant pcDNA3.1 (-)-TGF β 1 and pcDNA3.1 (-)-anti TGF β 1

Again downcut TGF β 1cDNA in T-TGF β 1-1 and the T-TGF β 1-2 plasmid with EcoR I and Hind III, orientation is connected in to be used among EcoR I and the linearizing pcDNA3.1 of Hind III double digestion (-), transform JM109 then, extract plasmid, obtain two expression recombinants with bacterium liquid PCR and EcoR I and the evaluation of Hind III double digestion.Because the restriction enzyme site direction of TGF β 1-2 is opposite with two restriction enzyme site directions of carrier, so connecting the gained person is antisense TGF β 1 plasmid, be pcDNA3.1 (-)-anti TGF β 1, and the restriction enzyme site direction of TGF β 1-1 being identical with carrier, is just TGF β 1 plasmid so connect gained.

Two) preparation of adenovirus carrier

1. the structure of adenovirus shuttle plasmid

Take out the LB nutrient solution of pUC18 plasmid, the centrifugal 2min of 8000r/min, extracting plasmid, reclaim the dna fragmentation that obtains 2.2kb with Xba I, with Nru I and Pvu II double digestion pcDNA3, reclaim the dna fragmentation of about 1.0kb, with these 2 fragments connect plasmid pUD (about 3.3kb).With AvaII and Ssp I double digestion pUD, reclaim the dna fragmentation of about 2.7kb, cut pEGFP-N1 with the AVRII enzyme in addition, reclaim the dna fragmentation of about 1.1kb, this fragment contains complete kanamycin gene, connects 2 recovery dna fragmentations and gets plasmid pUDK (about 3.8kb).Then goal gene is cloned into the multiple clone site of pUDK carrier, obtains to carry the recombinant plasmid vector of goal gene.Behind BamH I and HindIII double digestion pcDNA3LacZ.Reclaim the dna fragmentation of the about 3.0kb of size, be inserted into BamHI and HindIII site, obtain to contain goal gene Shuttle-CMV plasmid to the pUDK carrier.

2. preparation contains the pAdEasy-1 plasmid vector of goal gene

Get 4 aseptic 1.5mL centrifuge tube (be labeled as a respectively, b, c, d) and the electricity of 0.2cm transform cup, in precooling on ice; Get an amount of BJ5183 competent cell, in melting on ice; In each centrifuge tube, add the BJ5183 competent cell about 40 μ L.In a pipe, add linearizing dephosphorylized goal gene Shuttle-CMV plasmid and the supercoiled pAdEasy1 plasmid vector of 1 μ L (100 μ g/L) of containing of 1 μ L (1mg/L), mixing is placed on ice and places gently; In the b pipe, add the supercoiled pAdEasy-1 plasmid vector of linearizing dephosphorylized ShuttLe-CMV-LacZ of 1 μ L (1g/L) and 1 μ L (100 μ g/L), mixing is placed on ice and places gently; In the C pipe, add linearizing dephosphorylized barren shuttle carrier of 1 μ L (1g/L) and the supercoiled pAdEasy-1 plasmid vector of 1 μ L (100 μ g/L), mixing is placed on ice and places (the negative contrast of this glass: the background contrast as shuttle vectors is used) gently; In the d pipe, add the pUC18 control plasmid of 1 μ L (0.01 μ g/L).Regulate electric conversion instrument, shock parameters: 200 Ω, 5kV, 25 μ F; Centrifuge tube is suitable centrifugal slightly, bacterium liquid in the pipe and DNA are gone in the corresponding electricity conversion cup; Electric shock; After electric shock finishes, take out electricity rapidly and transform cup, add the aseptic LB substratum of 1mL immediately, with pipetman pressure-vaccum mixing.Bacterium liquid is gone in 15mL FaLcon 2095 pipes; In 37 ℃ of 225～250r/min shaking table recovery 1h; The bacterium liquid of recombining reaction and control reaction (a, b, C 3 pipes) is got certain extent of dilution (as: 50,100,250,600 μ L etc.), and separate application is in 2～5 LB-Kan flat boards; PUC18 plasmid conversion group only as the contrast of competence efficiency test, is got 10～100 μ L and is coated in the LB-Amp flat board; Get some competent cells and coat the LB-Kan flat board, as the thalline blank; 37 ℃ of overnight incubation.

3. transfection HEK-293 cell

On reorganization (pShuttLe-CMV adds goal gene) experiment flat board and reorganization contrast (pShuttLe-CMV-LacZ) flat board, select 10 or more very little clone respectively, add in 3～5mL LB-kanamycin substratum 37 ℃, 225～250r/min constant temperature shaking table overnight incubation.The substratum of getting 2mL or more overnight incubation extracts DNA in a small amount, and the volume of the DNA that finally obtains is 50 μ L, and DNA is resuspended with the dH2O of Tebuffer or sterilization.Cut the DNA that 10 μ L extract in a small amount with Pac I enzyme, after the complete digestion on 0.8% TAE sepharose electrophoresis, confirm to have obtained the dna fragmentation of goal gene; The above-mentioned DNA that in 1 EP pipe, adds 50 μ L, what other added 450 μ L does not contain serum DMEM substratum, mixing gently; What add 450mL in other 1 EP pipe does not contain serum DMEM substratum, adds 7 μ L lipid amine again, mixing; Then, with 2 EP pipe liquid mixings, temperature is bathed 20min in 37 ℃ of water.At last aforesaid liquid is added with in the HEK-293 Tissue Culture Flask that does not contain serum DMEM substratum rinse 1 time, and put 37 ℃ of people, 225～250r/min shaking table.

4. collect viral original seed and amplification

In above-mentioned HEK-293 cell, add behind the 6h and contain 12% foetal calf serum DMEM substratum.Can see that at fluorescent microscope cell has green fluorescence behind the 1d, 4～5d carefully changes 1 subculture, avoids the HEK-293 cell suspension as far as possible; Continue then to cultivate 4～5d at incubator.When waiting to have observed a large amount of cells and taking place to suspend, the up and down piping and druming soft with suction pipe suspends fully up to cell.The low-speed centrifugal isolated cell is worn in the centrifuge tube of screw cap in the cell suspension immigration.Remove and the reservation supernatant, with the sterilization PBS re-suspended cell of 0.5mL, and transfer to the cell of having sterilized and preserve in the pipe, the low-speed centrifugal isolated cell is used fresh 0.2mL PBS re-suspended cell behind the removal supernatant again.Cell is preserved the seal of tube put in people's liquid nitrogen container behind the 5min, take out and put into 37 ℃ of water and evenly shake 3min, make that liquid melts fully in the pipe.Repeat said process totally 4 times, will keep substratum supernatant and cell pyrolysis liquid mixing at last, obtain virus stock solution used.24h before infection changes HEK 293 cell culture mediums, treats that the cell fraction of coverage is in the culturing bottle at 50～70% o'clock, and resulting virus stock solution used 1mL adds in the culturing bottle of 50mL with said process, puts into 37 ℃, 225～250r/min shaking table 2h again; Add again and contain 12% foetal calf serum DMEM substratum.Can see that at fluorescent microscope cell has green fluorescence behind the 2d, but collecting cell behind 4～5d, and the up and down piping and druming soft with suction pipe suspends fully up to cell.Cell suspension is moved in the centrifuge tube that the people wears screw cap the low-speed centrifugal isolated cell.Remove and also to keep supernatant,, and transfer to the cell of having sterilized and preserve in the pipe, cell is preserved the seal of tube put in people's liquid nitrogen container behind the 5min, in 37 ℃ of water, evenly shake 3min then, make that liquid melts fully in the pipe with the reservation supernatant liquor re-suspended cell of 1mL.Repeat said process totally 4 times, will keep substratum supernatant and cell pyrolysis liquid mixing at last.This process can obtain 1 * 10 after repeating 4～5 times ¹⁰～1 * 10 ¹²/ mL contains the adenovirus carrier of goal gene.This carrier can be preserved 1 year under-80 ℃ condition.

Three) preparation of nano-microcapsule complex body

The competent preparation of 1 intestinal bacteria (DH5a)

1.1 inoculate a single bacterium colony in 30mL LB nutrient solution, in 37 ℃ of shaking table overnight incubation (250rpm/min).

1.2 in the flask of a 300mL, add 100mL LB nutrient solution, add 1mL incubated overnight liquid again, being cultured to A590 in 37 ℃ of shaking tables is 0.375.

1.3 the nutrient solution branch is installed in the aseptic polypropylene tube of 2 50mL precoolings ice bath 10-15min immediately, 4 ℃ then, the centrifugal 10min of 4000g.

1.4 discard nutrient solution, centrifuge tube is inverted on the filter paper, debris is flow to end.Cell precipitation is resuspended with the ice-cold 0.IMCaCL solution of I0mL, places 30min on ice, in 4 ℃ of centrifugal 10min of 4000g.

1.5 discard nutrient solution, centrifuge tube is inverted in 1min on the filter paper, it is resuspended to add ice-cold 0.1MCaCL solution 4mL, the glycerine that adds 30% volume then divide shape in cold aseptic polypropylene tube, frozen immediately in-70 ℃.

2.VR 1255-Luc i ferase, EGFP plasmid transformation escherichia coli (TOP 10) competence.

2.1 with 10 μ L VR1255-Luciferase, in the aseptic round bottom test tube of EGFP plasmid adding-individual 15mL, and be positioned on ice, the pipe that will fill competence intestinal bacteria (TOP10) then is held in the hand bacterium liquid is melted, immediately 200mL competence intestinal bacteria are added in the pipe, mixing is placed on 30min on ice.

2.2 being put into 42 ℃ of water-bath 1-2min, pipe carries out heat-shocked, add then in 800uL LB nutrient solution (antibiotic-free) test tube, put drum-type shaking table (250g) in 37 ℃ and cultivate 45min, the centrifugal 5min of 4000g then, supernatant discarded, stay 100uL-200uL to be applied to and contain on the flat board of penbritin, cultivate 12-16h in 37 ℃.

3.pCMVLuc a small amount of preparation (plasmid extraction kit) of VR1255 plasmid, green fluorescence protein gene (EGFP)

3.1 add 250uI P1 liquid in bacterial precipitation, concussion is to thoroughly suspending.

3.2 add 250uL p2 liquid, gentleness is put upside down 5-10 mixing of centrifuge tube immediately, static 4 minutes of room temperature.

3.3 add 250u1P3 liquid, gentleness is put upside down 5-10 mixing of centrifuge tube immediately.

3.4 the floating centrifugal 10mjn of 120009-130009 carefully moves into adsorption column with supernatant liquor, and centrifugal 15 seconds, outwell the liquid in the collection tube, adsorption column is put into together-individual collection tube.

3.5 in adsorption column, add 500uI B1 liquid, centrifugal 15 seconds, outwell the liquid in the collection tube, adsorption column is put into together-individual collection tube.

3.6 in adsorption column, add 500uL W1 liquid, centrifugal 15 seconds, outwell the liquid in the collection tube, adsorption column is put into together-individual collection tube.

3.7 add 500uIW1 liquid in the adsorption column, static 1 minute, centrifugal 15 seconds, outwell the liquid in the collection tube, adsorption column is put into together-individual collection tube.

3.8 centrifugal 1 minute.

3.9 adsorption column is put into-individual clean 1.5mL centrifuge tube, add 50uL T1 liquid in adsorption film central authorities, after room temperature leaves standstill 1 minute, centrifugal 1 minute, with 1.5mL centrifuge tube (dna solution)-20 ℃ preservation.

P1:50mM Tris/HCL+RNase A 10mg/mL P2:1%SDS, 0.2M NaOH P3:4M Guanidinium hydrochloride, 0.75MKAc pH4.6B1: neutralizer B2: washings W1: washings (time spent adds the 96mL dehydrated alcohol, fully mixing) T1:Tris damping fluid

4. digestion with restriction enzyme reaction

BamH I 0.5uL, HindIII 0.5uL, BufferK 1uL, BSA 1uL, pCMVLuc VR1255 plasmid 7uL, 37 ℃ were reacted 2 hours.The fast purifying dna fragmentation.

20uL volumetric reaction system is as follows:

DNA 0.2-1ug

The 10X enzyme is cut buffer 2.0uL

Restriction enzyme 1-2u (unit)

Add ddH2O to 20uL

Restriction enzyme adds at last, and mixing is centrifugal a little gently, is positioned over the optimum temperuture water-bath and by required time incubation, is generally 37 ℃ of water-bath digestion 1hr.

1). when being used to reclaim endonuclease bamhi, the reaction cumulative volume can reach 50-200uL, and each reactive component needs corresponding increase.

2). if buffer conditions is identical, can add simultaneously during plurality of enzymes digestion; Otherwise, do the enzymic digestion of low temperature or less salt earlier, do the enzymic digestion of high temperature or high salt again.

3). enzyme is cut when finishing, and adds 0.5M EDTA (pH8.0) and makes final concentration reach 10mM, with termination reaction.Or reaction tubes placed 10min with deactivation restriction enzyme enzymic activity 65 ℃ of water-baths.

4). excessive as the digestion reaction volume, well is not contained during electrophoresis, can be concentrated: after the termination reaction, add 5M ammonium acetate (or 1/10 volume 3M NaAc) and 2 times of volume dehydrated alcohols of 0.6 volume, place 5min on ice, then in 4 ℃ of centrifugal 12000gx5min.Incline and contain most of proteinic supernatant liquor.Dry in room temperature.The DNA post precipitation is dissolved in (pH7.6) among an amount of TE.

5). as want the postdigestive DNA of purifying, available equal-volume phenol/chloroform (1: 1) and each extracting of chloroform-inferior, use ethanol sedimentation again.

6). electrophoresis detection

It is an amount of to get the plasmid enzyme restriction product, adds sample on the suitable Loading buffer mixing, with the plasmid cut without enzyme or/and the empty carrier that enzyme is cut (if any) compare; adopt the voltage of 1-5V/cm; dna molecular is moved to positive pole from negative pole, take out to put under the ultraviolet lamp to correct position and detect, take the photograph sheet.

(L) single bacterium colony of growing on the picking LB solid medium is inoculated in 2.0mL LB (the containing corresponding microbiotic) liquid nutrient medium, 37 ℃, 250g shaking culture spend the night (about 12-14hr).

(2). get the 1.5mL culture and go in the micro-centrifuge tube, the centrifugal 8000gx1min of room temperature abandons supernatant, and centrifuge tube is inverted, and liquid is flow to end as far as possible.

(3). bacterial precipitation is resuspended in the solution I of 100uL precooling, thermal agitation makes thalline disperse mixing.

(4). add the freshly prepared solution II of 200uL, put upside down mixing (not thermal agitation) for several times, and centrifuge tube is positioned over 2-3min on ice, make cytolemma cracking (solution II is a lysate, so bacterium liquid becomes clearly gradually in the centrifuge tube).

(5). add the solution III of 150uL precooling, will manage gentleness and put upside down mixing for several times, see white flocks, can place 3-5min on ice.Solution III is a neutralization solution, this moment the plasmid DNA renaturation, karyomit(e) and protein irreversible denaturation form soluble mixture, simultaneously K ⁺Make SDS-albumen composition precipitation.

(6). add phenol/chloroform/primary isoamyl alcohol of 450uL, vibration mixing, 4 ℃ of centrifugal 12000gX10min.

(7). carefully shift out supernatant in-Xin Eppendorf tube, add the dehydrated alcohol of 2.5 times of volume precoolings, mixing, room temperature is placed 2-5min, 4 ℃ of centrifugal 12000gx15min.

(8) 70% washing with alcohol of .1mL precooling precipitation is 1-2 time, and 4 ℃ of centrifugal 8000gx7min abandon supernatant, will precipitate at room temperature and dry.

(9). precipitation is dissolved in 20uL TE (containing RNase A 20ug/mL), and 37 ℃ of water-bath 30min are with the degradation of rna molecule, and-20 ℃ of preservations are standby.

5. the plasmid pCMVLuc VR1255 that contains luciferase gene includes human cytomegalic inclusion disease virus immediate early promoter (CMV) and green fluorescence protein gene (EGFP), in DH5a, increase, separate with alkaline lysis, with the gorgeous gradient centrifugation purifying of chlorination, a large amount of preparation plasmid DNA are extracted purification kit with reference to QIAGEN Giga plasmid, adjustment concentration is 1mg/mL, and-20 ℃ of preservations are standby.

6.Branched the preparation 1.154g PEI (25000) of PEI (B-PEI or PEI) dissolves with 15.18mL 0.12mol PL phosphate buffered saline buffer (pH7.12).In this solution, add 1.154g lactose, 0.1527g sodium cyanoborohydride.Reaction solution is in 37 ℃ of insulations.Get the 2mL reaction solution at interval in different time, separate, press eluant solution, collect required elution fraction, frost drying with the 0.1LmoLPL hydrogen-carbonate with gel filtration chromatography.

7.PEI-DNA, Chitosan-DNA, the preparation of mixture is got isopyknic PEI and is dripped in dna solution, limit edged vibration mixes, and is made into the concentration of 20ugDNA, sterile filtration.Chitosan 0.02%Chitosan SoLution: general-quantitative Chitosan spends the night with acetate dissolution, add NaAc to final concentration be 25mM, transfer PH to 5.7 with NaOH, adding aseptic deionized water to the final concentration of Chitosan is 0.02%, use the sterile millipore filter filtration sterilization of 0.22 μ m again, room temperature preservation.Prepare the dna solution of different concns with the Na2SO4 solution of 50mM, time spent is got this solution that contains suitable DNA amount, with behind 0.02% the Chitosan solution-at first be heated to 55 ℃ respectively, after rapidly isopyknic two kinds of solution being mixed, put (2500rpm) suspendible 30Sec on the vortex oscillation device immediately, product is put room temperature 30min to advance-to go on foot to promote that particulate forms.Complex solution put 4 ℃ standby.

8. detect size of particles and the zeta current potential (mv) of chitosan-DNA, PEI-DNA, use size of particles and zeta current potential that the Zetasizer3000 detector is measured the nano-microcapsule mixture.

9.Chitosan-DNA, the stability of PEI-DNA and plasmid DNA, with the fresh rat serum or the bile of Chitosan-DNA, PEI-DNA complex body and plasmid DNA and different volumes, and physiological saline in contrast mixes, 37 ℃ of insulations.Different time takes out-quantified sample at interval, dissociates free DNA with heparin, in the presence of ethidium bromide with the degraded situation of 1% agarose gel electrophoresis assay DNA.

Embodiment 2

Experiment in the body that nano-microcapsule liver directed gene shifts

Nano-microcapsule is a kind of novel non-virus carrier, has advantages such as nontoxicity, non-immunogenicity and relative target, has in conjunction with, concentration of DNA and with the efficient ability that imports various cells of DNA.External demonstration does not have obvious cytotoxicity.Chitosan can be combined into nano-microcapsule effectively with plasmid DNA, and makes its degraded of avoiding DNase, and plasmid DNA is had to a certain degree provide protection.The semi-lactosi chitosan modified can be used as hepatocellular target gene release vehicle, select galactosylation chitosan (GC) for use, promptly on the chitosan molecule structure, modify with the semi-lactosi part, combine with specific asialoglycoprotein receptor (ASGP-R) on the liver cell by the semi-lactosi part and play the transferance of liver directed gene.

1 material and method

1.1 material

Plasmid pEGFP-N1 purchases the company in Clonetech.The agar essence is purchased in Shanghai life worker company.DNA Marker is a MBI company product.Restriction enzyme is purchased the company in TaKaRa.Plasmid extracts test kit in a large number, and (Qiagen Endo-Free Giga Kits is a Qiagen company product.The galactosylation chitosan makes up preservation by Xijing liver and gall surgical department of hospital of The Fourth Military Medical University laboratory.Cell culture medium RPMI1640, Lipofectamine TM2000 liposome is purchased in Gibco.Sodium acetate and sodium sulfate are analytical pure.

1.2 method

1.2.1 the preparation of chitosan-DNA mixture (nano-microcapsule): the 1) preparation of 0.02% chitosan: certain amount of chitosan is spent the night with the acetate dissolving, add sodium acetate to final concentration 25mM, transfer PH to 5.7 with NaOH, adding aseptic deionized water to the final concentration of chitosan is 0.02%, use the sterile millipore filter filtration sterilization of 0.22 μ m again, room temperature preservation.2) 500 μ L plasmid DNA solutions (2mg/mL) are dissolved in the sodium sulfate of 4.5mL 50mM, after the chitosan solution of equal-volume (5mL) 0.02% mixes, put (2500rpm) suspendible 30s on the vortex oscillation device immediately, product is put room temperature 30min, further promotes particulate to form.Complex solution is put 4 ℃ of preservations.3) nano-microcapsule agarose gel electrophoresis.Respectively nano-microcapsule, plasmid DNA are mixed with sample-loading buffer; Application of sample in containing 1% agar gel of EB, the about 40min of electrophoresis under the 80V voltage; Ultraviolet lamp is observed down, and gel imaging system is taken a picture.

1.2.2 experimentation on animals: 1) 8 dogs of laboratory animal are divided into 2 groups at random, experimental group injection plasmid nano-microcapsule, control group is only injected the gymnoplasm grain.2) 1d injects Gadolinium trichloride (14mg/kg) through small saphenous vein before the operation, removes the Kupffer cell.3) iodophor disinfection art district successively opens abdomen, dissects hepatic artery and injects nano-microcapsule (or gymnoplasm grain), and the plasmid content that each laboratory animal is accepted injection is 1mg.4) put to death animal behind the 36h, get hepatic tissue, make frozen section.Place under the fluorescent microscope, observe the expression of green fluorescent protein.

The result:

The animal liver tissue of injection nano-microcapsule plasmid is observed under fluorescent microscope in the body, and referring to Fig. 2, visible hepatic tissue has stronger yellow-green fluorescence among the figure, illustrates that hepatic tissue has more egfp expression.And gymnoplasm grain injection group hepatic tissue redgreen fluorescent protein expression.

Embodiment 3

Nano-microcapsule wraps up the experimental study of compound gene transfer vector anti-hepatic fibrosis

1. the foundation of hepatic fibrosis in mice model:

Adopt N-nitrosodimethylamine (dimethylnitrosamine, DMN) inducing mouse Liver Fibrosis Model, with reference to Alakkod (Biochen J, 1987,244:75-79) method is diluted to 0.05% (v/v) concentration with 0.9% (w/v) NaCl with DMN, get the dosage abdominal injection of 2ml with 0.05%DMN/kg rat body weight (10 μ L DMN/kg rat body weight), every day 1 time, weekly for three days on end, totally 4 weeks.Get tissue and carry out light microscopic and the capable histopathology evaluation of electron microscopic observation.

2. gene transfection:

AsOR-PL-Nanosphere-pAdV.CMV-HGF and pAdV.CMV-asTGF β 1 and pAdV.CMV-HGF-asTGF β 1 liver interior orientation transfer research.

Select inbred lines rat and mouse for use, random packet adopts anesthesia, operation method mode, respectively through portal vein, hepatic artery, biliary tract injects AsOR-PL-Nanosphere-pAdV.CMV-HGF and pAdV.CMV-asTGF β 1 and pAdV.CMV-HGF-asTGF β 1 complex body.In the assorted receptor that regularly lives in postoperative 1 hour, 24 hours, 3 days, 1 week, 3 weeks, 5 weeks, get other organs and tissues of liver, spleen or the like intraperitoneal and peripheral blood.Through β-gal dyeing, the detection of Luciferase optical density(OD), fluorescence microscope, immunohistochemical methods, methods such as PCR, Nerthern-Blot detect LacZ, GFP and Luciferase marker gene and express with target protein synthetic.More different absorption approach are to the influence of transgenosis in the liver.Method such as CDC, ELASA is checked the reaction of acceptor antiviral immunity.

3. the evaluation of anti-fibrosis effect:

Mouse is respectively organized in raising under the equal conditions, regularly carries out histology, in situ hybridization and survival time of mice and identifies the anti-fibrosis effect.

Expression conditions detects: detect HGF, TGF-β 1mRNA expression in the hepatic tissue with RT-PCR, Western trace method detects HGF, TGF-β 1 expression, HGF, TGF-β 1 immunohistochemical methods method detect HGF, TGF-β 1 protein expression and location in the hepatic tissue, and the ELISA method is measured HGF in the serum, TGF-β 1 level changes.

The hepatic tissue morphological observation: to the tissue slice observation of dyeing, liver cirrhosis pathology credit level with reference to Chinese Medical Association's viral hepatitis prevent and treat scheme (Chinese transmissible disease magazine, 1995,13:241-247) standard is divided into level Four.With the trickle pathological change of observation by light microscope hepatic tissue, referring to accompanying drawing 3, wherein: A, B, C, D wrap up the control group hepatic tissue section of compound gene transfer vector for the untransfected nano-microcapsule, and visible hepatic fibrosis changes.Figure E, F, G, H wrap up the experimental group hepatic tissue section of compound gene transfer vector for the transfection nano-microcapsule, be respectively the transfection nano-microcapsule and wrap up later hepatic tissue section of compound 3,6,9,12 week of gene transfer vector, wherein scheme the visible hepatic fibrosis of G, H and obviously improve.

Serological index: ALB detects and uses automatic biochemistry analyzer; ALT, AST detect and adopt reitman-frankel method; Hyaluronic acid (HA), Laminin ELISA (LN) and III, type detect the method for exempting from of putting that adopts.

Should be understood that, for those of ordinary skills, can be improved according to the above description or conversion, and all these improvement and conversion all should belong to the protection domain of claims of the present invention.

Claims (4)

1. the construction process of an oriented gene transfer vector in compound type liver is characterized in that, may further comprise the steps Al, adenovirus HGF, asTGF β 1 vector construction; A2, chitose parcel pAdV.CMV-HGF-asTGF β 1 nano-microcapsule virus vector complex body makes up; A3, nano-microcapsule-pAdV.CMV-HGF-asTGF β 1 complex body exoperidium asialoglycoprotein glycoprotein A sOR.

2. construction process according to claim 1, it is characterized in that, operation below described steps A 1 concrete execution the: adopt adenoviral plasmid, pAd.CMV and target gene plasmid PCL-HGF, PCBL-asTGF β 1, cut connection through enzyme, recombination to construct pAd.CMV-HGF-asTGF β 1 adenovirus LacZ, Luciferase gene transfection carrier; Through transfection Escherichia coli, amplification is extracted; Gained part pAd.CMV-HGF-asTGF β 1 plasmid, the defective type pJM17 reorganization with containing albumin promoter and enhanser produces complete virus genom DNA, rotaring redyeing 293 cell, carry out AdV virus packing after, extraction pAdV.CMV-HGF-asTGF β 1.

3. construction process according to claim 1, it is characterized in that, operation below described steps A 2 concrete execution the: 0.02% chitose, NaAcHoAc liquid+pAdV.CMV-HGF-asTGF β 1,1ug/ml PSS solution, add NHS-PEG-MAL behind the mixing, MW2000, SSA-PEG MW5000 and PBS solution carry out derivative reaction, add the propylhomoserin termination reaction, add the sulfhydrylation Transferrins,iron complexes again, form nano-microcapsule pAdV.CMV-HGF-asTGF β 1 suspension under the room temperature, carry out ultracentrifugation extraction, freeze-drying purifying nano micro-capsule virus vector complex body; Gained nano-microcapsule pAdV.CMV-HGF-asTGF β 1 complex body dilutes through PBS liquid; The Pincocreen method is measured its DNA bag carrying capacity; After its diameter of laser scattering method, the size, stand-by.

4. construction process according to claim 1, it is characterized in that, operation below described steps A 3 concrete execution the: from porcine blood serum, extract AsOR, AsOR mixes with Poly-L-lysine again, utilize the contained Transferrins,iron complexes of composite Nano micro-capsule wall, it is crosslinked that AsOR-PL and Transferrins,iron complexes are pressed the WangnerShi method, purified acquisition AsOR-PL-Nanosphere-pAdV.CMV-HGF-asTGF β 1 complex body.

Images