CN101914457A - Fungus for promoting germination of bletilla striata seeds - Google Patents
Fungus for promoting germination of bletilla striata seeds Download PDFInfo
- Publication number
- CN101914457A CN101914457A CN2010102627512A CN201010262751A CN101914457A CN 101914457 A CN101914457 A CN 101914457A CN 2010102627512 A CN2010102627512 A CN 2010102627512A CN 201010262751 A CN201010262751 A CN 201010262751A CN 101914457 A CN101914457 A CN 101914457A
- Authority
- CN
- China
- Prior art keywords
- seed
- fungi
- bletilla striata
- germination
- bsg14
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a fungus for promoting the germination of bletilla striata seeds. The fungus is named as Bsg11 and classified as Rhizoctonia sp. and has the preservation number of No.2450 in the CGMCC (China General Microbiological Culture Collection Center). The strain has an important significance on solving the problem of germination of the bletilla striata seeds, can be sown together with the bletilla striata seeds, is used for culturing seedlings by seedling-culturing pans or flowerpots or seedbeds and cultivating field crops on land and has the application value of replacing tissue culture to obtain plant seeds.
Description
Technical field
The present invention relates to technical field of bioengineering, relate to the three fungus strains that promotes germination of arethusa seeds specifically, can broadcast, be used for growing seedlings or the cultivation in land for growing field crops of seedling pan or flowerpot or seedbed with orchid seed companion.
Background technology
A lot of traditional rare Chinese medicines are arranged in the orchid, such as the stem of noble dendrobium, the bletilla striata etc.According to " record that Chinese pharmacopoeia is 2005 editions, the stem of noble dendrobium have reinforcing stomach reg fluid, nourishing Yin and clearing heat effect, can also make eye bright by relieve sore throat mediator's body immunity function.The bletilla striata is used as medicine with stem tuber, has effects such as astringing to arrest bleeding, detumescence and promoting granulation, cures mainly hemoptysis and spits blood, traumatic hemorrhage, sore swollen toxin, chapped skin, pulmonary tuberculosis hemoptysis, ulcer haemorrhage, disease such as can also treat hematuria simultaneously, have blood in stool.
The record of the medicinal dendrobium beginning sees Shennong's Herbal, is listed in top gradely, is first of " nine immortal grass ".Can do medicinal the orchid family Dendrobium plant kind more than 30 is arranged; present domestic Herba Dendrobii, dendrobium stem, Dendrobium chrysanthum; some famous and precious medicinal dendrobium resources such as Dens-valve Dendrobium, Dendrobium chrysotoxum are in great shortage; wherein the natural resources of Herba Dendrobii (Dendrobium candidum Wall.ex Lindl) has been on the verge of exhaustion; this plant has been put into state guarantee plant register, and its expensive price has more been aggravated the catastrophic explosion to its resource.The natural propagation rate of Dendrobium plant is low, poor growth, and this also is an important factor that causes its resource in imminent danger.
The bletilla striata relies on basically at present and gathers natural crude drugs hyoscine after processing.Because the increase of demand causes the medicinal herb grower that wild resource is excavated in a large number, wild resource is in continuous minimizing, and output is in continuous decline, and price has been in Critical Condition at present but always in continuous growth.
In order to realize dual purpose to the protection and the application of endangered species, when rescue and protecting rare and endangered species, also to study the whole ecological system at species place, be beneficial to Sustainable utilization of resources.Sprout in the field of orchidaceae medicinal plant seed is a difficult problem always, and especially still unmanned research is sprouted in the field of stem of noble dendrobium seed both at home and abroad.Sprouting and fungi role in the seed germination process of research Dendrobium seed are important contents of Dendrobium conservation of plant resources.
About the more existing at present reports of Dendrobium cultivation of plants technical study, utilize the method for tissue culture can obtain to cultivate the seedling of usefulness, and small-scale cultivation is arranged on Yunnan Province and Zhejiang Province and other places.But in actual applications, when the aseptic seedling of using tissue culture fast-propagation to obtain is cultivated, practice seedling and transplant two links not only technically, also limited applying of this method from production cost.Before technology did not obtain to break through in this respect, the Dendrobium plant also was difficult to realize large-area cultivation and production.
Cultivation technique about the bletilla striata only has the report that sporadically appears at present, but all lacks systematic research, and does not have the commerial growing base to occur, and the vegetative method of the wild plant of traditional dependence is cultivated also has a lot of problems to need to solve at present.One section long domestication process of wild change man's kind needs still yet there are no report in this respect.Breeding and germplasm preservation problem that the using-system cultured method solves threatened plant are valid approach, at present, there have been some units to carry out seed, stem apex and lateral bud, the tissue culture of pseudobulb and breeding research fast can obtain aseptic seedling in for some time, but practicing seedling and transplanting is a difficult problem that limits its application, also effectively do not practice the transplantation of seedlings method at present, this respect technology just may obtain actual application after obtaining to break through.In addition, the bletilla striata is as a kind of Chinese medicine commonly used, the effect basis acting in conjunction of composite chemical composition often of curative effect takes place in it, and aseptic seedling in breeding because hormone or other factor effects, may cause internal component to morph, this variation often is difficult for identification in cultivation, therefore aseptic seedling is cultivated the plant that obtains, can its component content has no change, replace medicinal material to use, and also is the problem that requires study.
The seed of orchid is called as " dust seed ", and have following characteristics: seed is tiny, and grain weight is huge, has several ten thousand in each capsule to hundreds of thousands of grain seed, is difficult to sprout at nature, and only reliable suitable fungi can sprout for it provides nutrition.Finding the fungi that can promote the orchidaceae medicinal plant seed germination, and utilize and as technology seed can be sprouted under field conditions (factors) mutually, is the effective ways of realizing the orchidaceae medicinal plant field cultivation.
At present, the research report of relevant both at home and abroad promotion orchidaceae medicinal plant seed germination fungi is seldom also found to promote the good fungi of seed germination.In recent years, we used new fungi isolation technique, be separated to the fungi that the orchidaceae medicinal plant seed germination is had promoter action.Compare with tissue culture with the axenic germination of seed, the symbiotic germination of seed and fungi can solve the field of orchidaceae medicinal plant seed and use a difficult problem, thereby reduces production link, reduces production costs, and has huge using value.
Summary of the invention
The purpose of this invention is to provide the three fungus strains that can promote germination of arethusa seeds.For the present situation in imminent danger that solves some kind of orchid provides a new approach.
3 fungal strains that the present invention adopts are respectively through evaluation: Rhizoctonia fungi Bsg11 (Rhizoctonia sp.), deposit number CGMCC No.2450, glued membrane Pseudomonas fungi Bsg14 (Tulasnella sp.), deposit number CGMCC No.2451, this 2 fungal strain on April 14th, 2008 in China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation, fungus Mycenae sp. MF24 (Mycena sp.), deposit number CGMCC No.1350, this bacterial strain on April 20th, 2005 in China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation, depositary institution address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica.The preservation of 3 fungal strains and survival proof are seen Appendix.
The cultural characters of three fungal strains is respectively:
Bsg11: on the PDA substratum, the bacterium colony circle, initial stage bacteria colony white, later stage front and back all are light yellow, and aerial hyphae is undeveloped, and the colony diameter in 25 ℃ of one weeks of growth is 8.8 centimetres, does not produce spore on the conventional substratum.
Bsg14: on the PDA substratum, the bacterium colony in initial stage and later stage all is a white, the bacterium colony circle, and aerial hyphae is undeveloped, and the colony diameter in 25 ℃ of one weeks of growth is 6.8 centimetres, does not produce spore on the conventional substratum.
MF24: on the PDA substratum, the bacterium colony in initial stage and later stage all is a white, the bacterium colony circle, and aerial hyphae is flourishing, and the colony diameter in 25 ℃ of one weeks of growth is 5.5 centimetres, does not produce spore on the conventional substratum.
The sequence of the internal transcribed spacer district rDNA of three fungal strains of the present invention is shown in sequence table.
Three fungal strains of the present invention have the effect that makes the seed symbiotic germination with the orchid seed mutually, and the orchid kind can be Herba Dendrobii, Dendrobium aphyllum (Roxb.) C. E. Fisch, Dendrobium williamsonii Day et Reichb. F., Dendrobium chrysanthum, Dens-valve Dendrobium, the bletilla striata.
Three fungal strains of the present invention can be used for the research of orchid seed symbiotic germination, also can broadcast with orchid seed companion, are used for growing seedlings or the cultivation in land for growing field crops of seedling pan or flowerpot or seedbed.
The invention has the beneficial effects as follows:
Fungal bacterial strain of the present invention has the physiologically active that makes its symbiotic germination with mutual work of part orchid seed; help to solve the problem that the orchid seed is difficult to sprout in the field; can provide a strong instrument for the protection of orchid resource and sustainable use and breeding and cultivation, have huge using value.
Embodiment
Embodiment 1
Sprout the separation of fungi
In the suitable growth environment of the bletilla striata and the stem of noble dendrobium, sow seed, obtain seed, protocorm and seedling, through obtaining sprouting fungi sprouting material surface sterilization back separation screening.
Embodiment 2
Bsg14 is to the sprouting effect of Herba Dendrobii seed
The Herba Dendrobii planting seed on the wheat bran that covers with the Bsg14 hypha,hyphae, leaf and sawdust, wheat bran, leaf and sawdust upper seeding wheel seed with sterilization are contrast, in culturing room, cultivate, culture temperature is 23-27 ℃, illumination every day 12 hours, intensity of illumination is: 1200Lx, investigation seed germination situation in the time of two months, the result is: the Herba Dendrobii seed germination rate that inoculation Bsg14 fungi is handled is: 67.3%, and the Herba Dendrobii seed germination rate that does not connect the fungi processing is 0.0%.
Embodiment 3
Bsg14 is to the sprouting effect of Herba Dendrobii seed
The Herba Dendrobii planting seed on the wheat bran that covers with the Bsg14 hypha,hyphae, leaf and sawdust, wheat bran, leaf and sawdust upper seeding wheel seed with sterilization are contrast, in the greenhouse, cultivate, culture temperature is 15-26 ℃, natural lighting, every sight is 8-10 hour according to the time, investigation seed germination situation in the time of two months, the result is: the Herba Dendrobii seed germination rate that inoculation Bsg14 fungi is handled is: 65.1%, and the Herba Dendrobii seed germination rate that does not connect the fungi processing is 0.0%.
Embodiment 4
Bsg14 is to the sprouting effect of Herba Dendrobii seed
Hypha,hyphae is inoculated on wheat bran, bark and the sawdust, after waiting to cover with mycelia, more than connect the bacterium material and spread the land for growing field crops, at these bacterium material upper seeding wheel seeds, cover one deck dry branches and fallen leaves then, keep humidity; With inoculated fungi not, other conditions are identical is treated to contrast, investigation seed germination situation in the time of three months, the result is: the Herba Dendrobii seed germination rate that inoculation Bsg14 fungi is handled is: 56.9%, the Herba Dendrobii seed germination rate that does not connect the fungi processing is 0.0%.
Embodiment 5
Bsg14 is to the sprouting effect of bletilla striata seed
Bletilla striata planting seed on the wheat bran that covers with the Bsg14 hypha,hyphae, soil and sawdust, wheat bran, soil and sawdust upper seeding wheel with sterilization are contrast, in the greenhouse, cultivate, culture temperature is 15-26 ℃, natural lighting, every day, light application time was 8-10 hour, investigation germination rate in the time of three months, the result is: the bletilla striata seed germination rate that inoculation Bsg14 fungi is handled is: 61.2%, and the bletilla striata seed germination rate that does not connect the fungi processing is 0.0%.
Embodiment 6
Bsg11 is to the sprouting effect of bletilla striata seed
Bletilla striata planting seed on the wheat bran that covers with the Bsg11 hypha,hyphae, soil and sawdust, wheat bran, soil and sawdust upper seeding wheel with sterilization are contrast, in the greenhouse, cultivate, culture temperature is 15-26 ℃, natural lighting, every day, light application time was 8-10 hour, investigation germination rate in the time of three months, the result is: the bletilla striata seed germination rate that inoculation Bsg14 fungi is handled is: 45.2%, and the bletilla striata seed germination rate that does not connect the fungi processing is 0.0%.
Embodiment 7
MF24 is to the sprouting effect of bletilla striata seed
Bletilla striata planting seed on the wheat bran that covers with the MF24 hypha,hyphae, soil and sawdust, wheat bran, soil and sawdust upper seeding wheel with sterilization are contrast, in the greenhouse, cultivate, culture temperature is 15-26 ℃, natural lighting, every day, light application time was 8-10 hour, investigation germination rate in the time of three months, the result is: the bletilla striata seed germination rate that inoculation Mf24 fungi is handled is: 36.9%, and the bletilla striata seed germination rate that does not connect the fungi processing is 0.0%.
Embodiment 8
Bsg14 is to the sprouting effect of Dendrobium chrysanthum seed
The Dendrobium chrysanthum planting seed on the wheat bran that covers with the Bsg14 hypha,hyphae, leaf or sawdust, wheat bran, leaf or sawdust upper seeding wheel with sterilization are contrast, in the greenhouse, cultivate, culture temperature is 15-26 ℃, natural lighting, every day, light application time was 8-10 hour, investigation seed germination situation in the time of two months, the result is: the Dendrobium chrysanthum seed germination rate that inoculation Bsg14 fungi is handled is: 73.2%, and the Dendrobium chrysanthum seed germination rate that does not connect the fungi processing is 0.0%.
Embodiment 9
Bsg14 is to the sprouting effect of dendrobium devonianum seeds
Dendrobium devonianum seeds is seeded on wheat bran, leaf or the sawdust that covers with the Bsg14 hypha,hyphae, wheat bran, leaf or sawdust upper seeding wheel with sterilization are contrast, in the greenhouse, cultivate, culture temperature is 15-26 ℃, natural lighting, every day, light application time was 8-10 hour, investigation seed germination situation in the time of two months, the result is: the dendrobium devonianum seeds germination rate that inoculation Bsg14 fungi is handled is: 65.1%, and the dendrobium devonianum seeds germination rate that does not connect the fungi processing is 0.0%.
Embodiment 10
Bsg14 is to the sprouting effect of Dendrobium aphyllum (Roxb.) C. E. Fisch seed
The Dendrobium aphyllum (Roxb.) C. E. Fisch planting seed on the wheat bran that covers with the Bsg14 hypha,hyphae, leaf or sawdust, wheat bran, leaf or sawdust upper seeding wheel with sterilization are contrast, in the greenhouse, cultivate, culture temperature is 15-26 ℃, natural lighting, every day, light application time was 8-10 hour, investigation seed germination situation in the time of two months, the result is: the Dendrobium aphyllum (Roxb.) C. E. Fisch seed germination rate that inoculation Bsg14 fungi is handled is: 16.4%, and the Dendrobium aphyllum (Roxb.) C. E. Fisch seed germination rate that does not connect the fungi processing is 0.0%.
Embodiment 11
Bsg14 is to the sprouting effect of Dendrobium williamsonii Day et Reichb. F. seed
The Dendrobium williamsonii Day et Reichb. F. planting seed on the wheat bran that covers with the Bsg14 hypha,hyphae, leaf or sawdust, wheat bran, leaf or sawdust upper seeding wheel with sterilization are contrast, in the greenhouse, cultivate, culture temperature is 15-26 ℃, natural lighting, every day, light application time was 8-10 hour, investigation seed germination situation in the time of two months, the result is: the Dendrobium williamsonii Day et Reichb. F. seed germination rate that inoculation Bsg14 fungi is handled is: 85.4%, and the Dendrobium williamsonii Day et Reichb. F. seed germination rate that does not connect the fungi processing is 0.0%.
Comparative example 1
Illumination is to the influence of fungi Bsg14 and Herba Dendrobii seed symbiotic germination
Adopt bacterium leaf method to experimentize, fungi is inoculated on the chestnut leaves of sterilization, treat that the leaf surface covers with behind the mycelia the Herba Dendrobii planting seed to the leaf surface common cultivation in 25 ± 2 ℃ environment.Illumination condition is established following 2 kinds of processing: (1) illumination cultivation: intensity of illumination is 1200Lx, and the photoperiod is 12 hours.With this understanding, make L with the treatment group note of fungi Bsg14 symbiosis culture, the control group note that does not connect fungi is made LCK.(2) dark culturing: with this understanding, make D with the treatment group note of fungi Bsg14 symbiosis culture, the control group note that does not connect fungi is made DCK.More than each group all establish 4 repetitions.From the 1st week of cultivating, the germination rate of seed is respectively organized in investigation weekly.The results are shown in Table 1.
Table 1. illumination is to the influence of fungi Bsg14 and Herba Dendrobii seed symbiotic germination rate
Illumination can promote the symbiotic germination of fungi and Herba Dendrobii seed, and the germination rate that shows as in seed germination initial stage L treatment group is higher than the D treatment group, and when cultivating for the 7th week, the germination rate utmost point of L treatment group is significantly higher than D treatment group (P<0.01); The dark sprouting that more helps the Herba Dendrobii seed, the final germination rate that shows as the D treatment group is higher than the L treatment group, and when cultivating for the 10th week, the germination rate of D treatment group is higher than the germination rate of L treatment group significantly.Continue to cultivate to observe and find, the seed that dark condition is sprouted down can not form seedling, and the seed of the sprouting under the illumination condition just can form seedling at 2-3 month.
The Herba Dendrobii seed can not be sprouted on aseptic leaf, shows that fungi Bsg14 is unique factor of inducing the Herba Dendrobii seed germination in the bacterium leaf method, illustrates that fungi Bsg14 has the physiological function that promotes the Herba Dendrobii seed germination.
Comparative example 2
Illumination is to the influence of fungi Bsg14 and bletilla striata seed symbiotic germination
Adopt bacterium leaf method to experimentize, the chestnut leaves of sterilization is placed the fungus culture primary surface, inoculated fungi, the leaf surface covers with behind the mycelia bletilla striata planting seed on the leaf surface, common cultivation in 25 ± 2 ℃ environment.Illumination condition is established following 2 kinds of processing: (1) illumination cultivation: intensity of illumination is 1200Lx, and the photoperiod is 12 hours.With this understanding, make L with the treatment group note of fungi Bsg14 symbiosis culture, the control group note that does not connect fungi is made LCK.(2) dark culturing: with this understanding, make D with the treatment group note of fungi Bsg14 symbiosis culture, the control group note that does not connect fungi is made DCK.More than each group all establish 4 repetitions.From the 1st week of cultivating, the germination rate of seed is respectively organized in investigation weekly.The results are shown in Table 2.
Table 2. illumination is to the influence of fungi Bsg14 and bletilla striata seed symbiotic germination rate
Illumination can promote the symbiotic germination of fungi and bletilla striata seed, and the germination rate that shows as in seed germination initial stage L treatment group is higher than the D treatment group, and when cultivating for the 6th week, the germination rate of L treatment group is significantly higher than D treatment group (P<0.05); Final germination rate remains the L treatment group and is higher than the D treatment group, and when cultivating for the 8th week, the germination rate of L treatment group is higher than the germination rate of D treatment group.
Bletilla striata seed can not be sprouted on aseptic leaf, shows that fungi Bsg14 is unique factor of inducing bletilla striata seed germination in the bacterium leaf method, illustrates that fungi Bsg14 has the physiological function that promotes bletilla striata seed germination.
Comparative example 3
3 fungal strains are to the influence of bletilla striata seed germination.
This experiment and the test period of comparative example 2 and used seed are different.Experimental technique is: to the leaf that covers with hypha,hyphae, fungi is selected three kinds for use, is respectively bletilla striata planting seed: Bsg14, Bsg11, MF24.With aseptic leaf upper seeding wheel is contrast, cultivates under greenhouse experiment, and culture temperature is 20-27 ℃, and from the 1st week of cultivating, the sprouting situation of seed is respectively organized in investigation weekly, the results are shown in Table 3.More than every kind handle to repeat 4 times.
Table 3.3 fungal strain is to the influence of bletilla striata seed germination rate
3 kinds of fungal bacterial strains all have good sprouting effect to bletilla striata seed.The control group seed germination rate that does not add fungi is always 0%, and add the later test treatment group of fungi very high germination rate is arranged all, and the speed of sprouting is also very fast, has reached maximum germination rate in the 8th week.Different fungal bacterial strains and bletilla striata seed make some difference of effect of bletilla striata seed symbiotic germination mutually, and in 3 fungal strains, Bsg14 promotes that the effect of bletilla striata seed germination is best, and the final germination rate of seed is the highest, and the speed of sprouting is very fast.
Claims (2)
1. promote a fungal strain of bletilla striata seed germination, it is that deposit number is Rhizoctonia (Rhizoctonia sp.) the fungi Bsg11 of CGMCC No.2450, it can be used for the seed symbiotic germination research of the medicinal plant bletilla striata, or broadcast with the seed of bletilla striata companion, be used for growing seedlings or the cultivation in land for growing field crops of seedling pan or flowerpot or seedbed.
2. fungi Bsg11 as claimed in claim 1 is characterized in that the sequence of its internal transcribed spacer district rDNA being called the ITS sequence again, and is as follows:
GTTGTCGCTGGCCCTTTCGGGGGCATGTGCACGCCTTCTCTTTCATCCACACACACCTGT 60
GCACTTGTGAGACGGAGGACCTTAATTTGGTCTTCCGTCTACTTAATCACACAAACTCAT 120
TTTAATTAAACTGAATGTAATTGATGTAACGCATCATTAGAACTAAGTTTCAACAACGGA 180
TCTCTTGGCTCTCGCATCGATGAAAAACGCACCGAAATGCGATAAGTAATGTGAATTGCA 240
AAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCTTGAAGC 300
ATGCCTGTTTGAGTATCATGAAATTCTCAAAGTAAATCTTTTTGTTAATTCAACTGGTTT 360
ACTTTGGACTTGGAGGTCTTTGCAAATTTCACGTCTGCTCCTCTTAAATGCATTAGCTGG 420
ATCTCAGTATATGCTTGGTTCCACTCGGCGTGATAAGTATCACTCGCTAAGGACACTGTT 480
AAAAAGGTGGCCAGGAAATACAGATGAACCGCTTCTAATAGTCTATTAAGTTAAACAATT 540
AAATTTTAAAATCTGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAA。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010102627512A CN101914457B (en) | 2008-04-24 | 2008-04-24 | Fungus for promoting germination of bletilla striata seeds |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010102627512A CN101914457B (en) | 2008-04-24 | 2008-04-24 | Fungus for promoting germination of bletilla striata seeds |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA2008100939531A Division CN101565676A (en) | 2008-04-24 | 2008-04-24 | Three fungus strains for promoting germination of arethusa seeds |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101914457A true CN101914457A (en) | 2010-12-15 |
CN101914457B CN101914457B (en) | 2012-07-25 |
Family
ID=43322106
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010102627512A Expired - Fee Related CN101914457B (en) | 2008-04-24 | 2008-04-24 | Fungus for promoting germination of bletilla striata seeds |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101914457B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105145029A (en) * | 2015-07-03 | 2015-12-16 | 普洱力品生物科技开发有限公司 | Bletilla rhizome floating direct seeding seedling method |
CN105519350A (en) * | 2015-12-14 | 2016-04-27 | 广西壮族自治区药用植物园 | Method for rapidly producing Bletilla striata germchit |
CN106818175A (en) * | 2017-01-25 | 2017-06-13 | 施秉县富民高新农业发展有限公司 | A kind of bletilla floating plate method for culturing seedlings |
CN113207590A (en) * | 2021-04-29 | 2021-08-06 | 南京工业大学大丰海洋产业研究院 | Bletilla direct seeding and seedling raising method utilizing symbiotic bacteria |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1952106B (en) * | 2006-11-08 | 2010-05-26 | 山东省科学院生物研究所 | Avirulent binucleate rhizoctonia BNR-1 agricultural agent and its uses |
-
2008
- 2008-04-24 CN CN2010102627512A patent/CN101914457B/en not_active Expired - Fee Related
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105145029A (en) * | 2015-07-03 | 2015-12-16 | 普洱力品生物科技开发有限公司 | Bletilla rhizome floating direct seeding seedling method |
CN105519350A (en) * | 2015-12-14 | 2016-04-27 | 广西壮族自治区药用植物园 | Method for rapidly producing Bletilla striata germchit |
CN105519350B (en) * | 2015-12-14 | 2018-07-03 | 广西壮族自治区药用植物园 | The method of quick production bletilla seedling |
CN106818175A (en) * | 2017-01-25 | 2017-06-13 | 施秉县富民高新农业发展有限公司 | A kind of bletilla floating plate method for culturing seedlings |
CN113207590A (en) * | 2021-04-29 | 2021-08-06 | 南京工业大学大丰海洋产业研究院 | Bletilla direct seeding and seedling raising method utilizing symbiotic bacteria |
Also Published As
Publication number | Publication date |
---|---|
CN101914457B (en) | 2012-07-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101565676A (en) | Three fungus strains for promoting germination of arethusa seeds | |
Yadav et al. | Arbuscular mycorrhizal fungi (AMF) induced acclimatization, growth enhancement and colchicine content of micropropagated Gloriosa superba L. plantlets | |
CN101914456A (en) | Fungus for promoting orchid seeds to germinate | |
CN101933456B (en) | Method for quickly breeding seedlings of dendrobium officinale capsule | |
CN102127510B (en) | Two fungi for promoting seeds of Dendrobium to sprout | |
US11078456B2 (en) | Fusarium solani and use of same in prevention and treatment of southern blight of Dendrobium officinale Kimura et Migo | |
CN102174436B (en) | Bradyrhizobium japonicum capable of effectively fixing nitrogen and culture method and application thereof | |
CN102835318A (en) | Technology for rapid sugar-free micropropagation of dendrobium officinale kimura et migo under non-aseptic condition | |
CN104195056B (en) | A kind of two type umbrellas are mould and application in Herba Dendrobii growth-promoting, drought resisting | |
CN102757917A (en) | Biocontrol agent for preventing and curing bacterial wilt and club roots of plant as well as preparation method and application thereof | |
CN108401794A (en) | A kind of armillaria mellea accreting with Rhizoma Gastrodiae liquid spawn production method and cultigen special culture media | |
CN105132293B (en) | A kind of Alternaria tenuissima and its application in dendrobium candidum growth-promoting, drought resisting | |
Swangmaneecharern et al. | Promoting effect of orchid mycorrhizal fungi Epulorhiza isolates on seed germination of Dendrobium orchids | |
CN105754864B (en) | Bletilla mycorrhizal fungi and its application | |
CN102154157A (en) | Bio-control strain 4AT8 capable of preventing and curing various bacterial diseases | |
CN102146350B (en) | Biocontrol strain 3YW8 for controlling bacterial wilt of ginger | |
CN101914457B (en) | Fungus for promoting germination of bletilla striata seeds | |
CN115537346A (en) | Mucillus mucilaginosus for promoting growth and differentiation of sansevieria trifasciata and application thereof | |
CN105961010B (en) | Utilize the method for orchid root bacteria cultivation hectolitre pine | |
CN107629967A (en) | Fluid nutrient medium and rhizoma Gastrodiae implantation methods for the Germination Strain of rhizoma Gastrodiae plantation | |
CN104195054B (en) | Mould and the application in dendrobium candidum growth-promoting and drought resisting of a kind of two type umbrellas | |
CN106635921B (en) | Bacillus amyloliquefaciens Y15 and its application | |
CN103087947A (en) | Pseudoxanthomonas sp. ZKB4-4 and application thereof | |
CN105519582B (en) | A kind of prevention Tobacco Tomato root-knot nematode preparation and application | |
CN104371952A (en) | Burkholderia arboris and its use in prevention and treatment of soil borne diseases of pseudo-ginseng |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120725 |