CN101906467B

CN101906467B - Fluorescent quantitative PCR method for detecting prorocentrum minimum

Info

Publication number: CN101906467B
Application number: CN2009101982586A
Authority: CN
Inventors: 张凤英; 马凌波; 石彦红; 蒋科技; 马春艳; 马洪雨
Original assignee: East China Sea Fishery Research Institute Chinese Academy of Fishery Sciences
Current assignee: East China Sea Fishery Research Institute Chinese Academy of Fishery Sciences
Priority date: 2009-11-03
Filing date: 2009-11-03
Publication date: 2012-07-18
Anticipated expiration: 2029-11-03
Also published as: CN101906467A

Abstract

The invention relates to a fluorescent quantitative PCR method for detecting prorocentrum minimum, which comprises the following steps of: (1) pretreating alga liquid, namely extracting sample alga liquid, centrifuging to collect cells, washing with buffer solution and resuspending to obtain alga liquid to be treated; (2) optimizing a fluorescent quantitative PCR primer and concentration, wherein a primer sequence PM-liF is CCCCCATGCAGAGACTCAA, a primer sequence PM-liR is CAGCAAGGACAGGCACAGAA, and the final concentration of the primer is 200nmol/L; and (3) detecting the cells of the prorocentrum minimum, namely performing fluorescent quantitative PCR amplification after treating the alga liquid to be treated, and calculating the number of the cells and the DNA content of the prorocentrum minimum according to a regression equation. The method has the advantages of simple operation, environmental friendliness, accurate detection result, high sensitivity and good repeatability of the established standard curve, high linearity among points of the standard curve, good application prospect in the field of alga authentication, and the like.

Description

A kind of method of fluorescence quantitative PCR detection prorocentrum minimum

Technical field

The field is identified in the detection that the invention belongs to prorocentrum minimum, particularly relates to a kind of method of fluorescence quantitative PCR detection prorocentrum minimum

Background technology

Red tide is predicted that matter of utmost importance is that the red tide algae is detected, and traditional algae is identified and divides through morphologic observation, from pigment; Chromatoplast, the difference of reserve substance etc. is distinguished alga cells not of the same race, this is a thing that wastes time and energy; And different kind difference is very trickle; The non-professional who is engaged in this work for a long time is difficult to competent this work, and environment has very big influence to the algae form, identifies the difficult more of kind of existence.

At present, the method for utilizing molecular biology method to detect little algae is day by day ripe, and these methods have solved some algae classification and evaluation problem that is difficult to distinguish from form from molecular level.(Polymerase ChainReaction, PCR) since the technological invention, this technology just is applied to numerous areas since the polymerase chain reaction.Many scholars come algae is identified through some gene fragment amplification of little algae; For example pass through rrna rDNA sequential analysis; The pcr amplification and the order-checking of rrna transcribed spacer (ITS) thereby accomplish the kind of microalgae is identified, yet this method sensitivity are not high; And can't be quantitative, promptly be not sure of frustule quantity in the water body.Fluorescence in situ hybridization also is the detection means that little in recent years algae is identified, some scholar utilizes large ribosomal subunit (LSU) and ITS to distinguish sub-probe some red tide microalgae is identified, and is high but this technology requires probe, and quantitative weak effect.Real-time fluorescence quantitative PCR detects and to become little in recent years algae and detect a focus direction, and this method is very sensitive, though required laboratory apparatus (quantitative real time PCR Instrument) costs an arm and a leg, still has many laboratories multiple little algae that utilized this technical evaluation.

Prorocentrum minimum (Prorocentrum minimum) is the multiple red tide algae in Chinese marine site, causes a lot of red tides in recent years, therefore, this algae is carried out effective sensitive detect to avoid the generation of red tide, becomes the topic that paid close attention to by people at present.

Summary of the invention

Technical problem to be solved by this invention provides a kind of method of fluorescence quantitative PCR detection prorocentrum minimum; Advantages such as this method has simple to operate, and is environmentally friendly, and detected result is accurate; The highly sensitive good reproducibility of setting up of typical curve; Become highly linear between the typical curve each point, and in 30 circulations, just can detect 0.5 cell and 10pg genomic dna, have a good application prospect in algae evaluation field.

The method of a kind of fluorescence quantitative PCR detection prorocentrum minimum of the present invention comprises:

(1) pre-treatment of algae liquid

Draw samples algae liquid, centrifugal collecting cell is used after the PBS damping fluid washed twice of pH 7.0 resuspendedly then, and processing density is 2.5 * 10 ⁸The pending algae liquid of cell/L;

(2) fluorescence quantification PCR primer design and specificity checking

Compare from GenBank acquisition prorocentrum minimum ITS sequence and with the corresponding sequence of other little algaes; Select in the ITS zone and other little algae ITS1 district that there were significant differences; Design the fluorescent quantitation primer that is suitable for SYBRGreen I method with Primer Express 3.0, primer sequence is:

PM-1iF：CCCCCATGCAGAGACTCAA，

PM-1iR：CAGCAAGGACAGGCACAGAA；

To design among primer and the GenBank sequence and carry out the Blast comparison; The specificity of checking primer; Optimize the primer final concentration to 200nmol/L; Respectively the broken algae liquid of algae of the same race is not carried out fluorescent quantitative PCR then, amplification shows that the sample that contains prorocentrum minimum DNA has amplification, and other contrast little algae sample does not have amplification;

(3) number of cells of prorocentrum minimum and genomic dna detect

Get the pending algae liquid that obtains in the step (1) in centrifuge tube, in ice bath, carry out ultrasonication, microscopic examination all is broken until all cells; Algae liquid is pressed 1: 10 times of dilution; 5 extent of dilution, each extent of dilution repeats 3 times, carries out fluorescent quantitative PCR then.The extension increasing sequence of prorocentrum minimum DNA is following:

Cccccatgcagagactcaagggcagcaagccaggctcagaccgtcttctgtgcctg tccttgctg, length 65bp.

The regression coefficient that fluorescent quantitative PCR result obtains is 0.989, and the highly sensitive good reproducibility of setting up with this method of typical curve is described, becomes highly linear between the typical curve each point, then according to regression equation:

y＝-3.277x+43.708

Wherein: x is a cell count, and y is C _TBe worth, calculate the number of cells of prorocentrum minimum;

Extract the prorocentrum minimum genomic dna with the CTAB method, detect the original DNA initial concentration, then genomic dna is carried out 1: 10 times of dilution with Biophometre (German Eppendof company), 7 extent of dilution, each extent of dilution repetition 3 times finally detects dna content.

Ultrasonication in the said step (3) is ultrasonic power 200W, ultrasonic time 3 seconds, 3 seconds pitch times;

The condition of the fluorescent quantitative PCR in the said step (3) is: 94 ℃ of 10min, 94 ℃ of 15s, 60 ℃ of 1min, 40 circulations; 94 ℃ of 15s of solubility curve, 60 ℃ of 1min, 94 ℃ of 15s; Amplification system is 20 μ L systems, 2 μ L genomic dnas, 10 μ L, 2 * Power SYBR Green Mater mix; Primer PM-1iF and PM-1iR (initial concentration is 10 μ M) 0.4 μ L (the primer final concentration is 200nmol/L), 7.2 μ L ddH ₂O.

Beneficial effect

Fluorescence quantitative detecting method of the present invention has simple to operate; Environmentally friendly; Advantages such as detected result is accurate, the highly sensitive good reproducibility of the typical curve of foundation becomes highly linear between the typical curve each point; And in 30 circulations, just can detect 0.5 cell and 10pg genomic dna, have a good application prospect in algae evaluation field.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.Should be understood that in addition those skilled in the art can do various changes or modification to the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Embodiment 1

The drafting of typical curve

(1) pre-treatment of algae liquid

The prorocentrum minimum algae liquid that grows into logarithmic phase and other are contrasted little algae (chain Alexander algae, the different cap algae of ring-type, the triumphant human relations algae of Michaelis; Short triumphant human relations algae; Chaetoceros) algae liquid, centrifugal collecting cell carries out microscopic counting; And then with resuspended after PBS (PH7.0) the damping fluid washed twice, processing density is 2.5 * 10 ⁸The pending algae liquid of cell/L;

(2) fluorescence quantification PCR primer design and specificity checking

PM-1iF：CCCCCATGCAGAGACTCAA，

PM-1iR：CAGCAAGGACAGGCACAGAA；

To design among primer and the GenBank sequence and carry out the Blast comparison; The design primer is optimized primer concentration, selects the primer final concentration of 200nmol/L then; With the specificity of other contrast algaes as contrast checking primer; Respectively the broken algae liquid of algae of the same race is not carried out fluorescent quantitative PCR, amplification shows that the sample that contains prorocentrum minimum DNA has amplification, and other contrast little algae sample does not have amplification;

(3) sensitivity detects

Get the pending prorocentrum minimum algae of the 10mL that obtains in (1) liquid in the 50mL centrifuge tube, in ice bath, carry out ultrasonication (power 200W, ultrasonic time 3 seconds, 3 seconds pitch times), microscopic examination all is broken until all cells; Algae liquid is pressed 1: 10 times of dilution (from 5000 cell to 0.5 cells), 5 extent of dilution, 3 repetitions of each extent of dilution; Carry out fluorescent quantitative PCR then, 94 ℃ of 10min of amplification condition, 94 ℃ of 15s, 60 ℃ of 1min, 40 circulations.

Get standard regression equation: y=-3.277x+43.708 according to the result, wherein x is a cell count, and y is C _TValue;

Extract the prorocentrum minimum genomic dna with the CTAB method; Surveying the original DNA initial concentration with Biophometre (German Eppendof company) is 50ng/ μ L, genomic dna according to 1: 10 times of dilution (from 100ng to 10fg), 7 extent of dilution; 3 repetitions of each extent of dilution finally detect 10pg DNA.

Embodiment 2

Adopt the method for embodiment 1 that prorocentrum minimum algae liquid to be measured is divided into 6 different concns groups, get 3mL prorocentrum minimum algae liquid respectively, at first count with microscope; Get 10mL algae liquid again; Centrifugal collecting cell, and resuspended with the 10mL aseptic deionized water, and UW carries out fragmentation to sample.Carry out fluorescent quantitative PCR then, according to the C of each sample gained _TValue calculates cell quantity according to standard equation.Each sample detection is set 3 parallel sample, and the result is as shown in table 1, can find out from table 1, and quantitative fluorescent PCR quantitative result and microscopic counting be basically identical as a result.

Table 1 microscopic counting and Real-time round pcr count results are relatively

Claims

1. the method for a fluorescence quantitative PCR detection prorocentrum minimum comprises:

(1) pre-treatment of algae liquid

Extract the sample algae liquid in the marine site, centrifugal collecting cell is used after the PBS damping fluid washed twice of pH 7.0 resuspendedly then, and processing density is 2.5 * 10 ⁸The pending algae liquid of cell/L;

(2) fluorescence quantification PCR primer and concentration optimization

The fluorescent quantitation primer sequence of SYBR method is:

PM-1iF：CCCCCATGCAGAGACTCAA，

PM-1iR：CAGCAAGGACAGGCACAGAA；

The primer final concentration is: 200nmol/L;

(3) number of cells of prorocentrum minimum and genomic dna detect

Get the pending algae liquid that obtains in the step (1) in centrifuge tube; In ice bath, carry out ultrasonication, microscopic examination all is broken until all cells, and algae liquid is pressed 1: 10 times of dilution; 5 extent of dilution; Each extent of dilution repeats 3 times, carries out fluorescent quantitative PCR then, and the extension increasing sequence of prorocentrum minimum DNA is following:

According to regression equation, calculate the number of cells of prorocentrum minimum then;

Extract the prorocentrum minimum genomic dna with the CTAB method, adopt Biophometre to detect the original DNA initial concentration, then genomic dna is carried out 1: 10 times of dilution; Do 7 extent of dilution; As the fluorescent quantitation template, each extent of dilution repeats 3 times, finally detects dna content.

2. the method for a kind of fluorescence quantitative PCR detection prorocentrum minimum according to claim 1 is characterized in that: the ultrasonication in the said step (3) is ultrasonic power 200W, ultrasonic time 3 seconds, 3 seconds pitch times.

3. the method for a kind of fluorescence quantitative PCR detection prorocentrum minimum according to claim 1 is characterized in that: the fluorescent quantitative PCR program in the said step (3) is: 94 ℃ of 10min, 94 ℃ of 15s, 60 ℃ of 1min, 40 circulations; 94 ℃ of 15s of solubility curve, 60 ℃ of 1min, 94 ℃ of 15s, amplification system are 20 μ L systems, 2 μ L genomic dnas, 10 μ L2 * Power SYBR Green Mater mix, primer PM-1iF and PM-1iR 0.4 μ L, 7.2 μ L ddH ₂O; Wherein the initial concentration of primer PM-1iF and PM-1iR is 10 μ M, and final concentration is 200nmol/L.