CN103173555B - Proteusbacillus vulgaris multi-serotype strain specific primer and multiple polymerase chain reaction (PCR) detection method - Google Patents
Proteusbacillus vulgaris multi-serotype strain specific primer and multiple polymerase chain reaction (PCR) detection method Download PDFInfo
- Publication number
- CN103173555B CN103173555B CN201310115652.5A CN201310115652A CN103173555B CN 103173555 B CN103173555 B CN 103173555B CN 201310115652 A CN201310115652 A CN 201310115652A CN 103173555 B CN103173555 B CN 103173555B
- Authority
- CN
- China
- Prior art keywords
- types
- bacillus proteus
- proteus
- serotype
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a specific polymerase chain reaction (PCR) primer for detecting proteusbacillus vulgaris multi-serotype pathogenic bacteria, a multiple PCR rapid detection method and application of the method. The multiple PCR detection system comprises a 10*PCR reaction solution, MgCl2, dNTP, a primer and DNA polymerase, wherein the sequence of the primer comprises the following multiple sequences: (1) wzy specific nucleotide sequences of 1-4 type to type 60 of proteusbacillus vulgaris serotype; and (2) a complementary DNA sequence of the DNA sequence selected from (1). According to the wzy specific nucleotide for common proteusbacillus vulgaris serotype and the multiple PCR detection method comprising the nucleotide, a multiple PCR system is easy and convenient in preparation method, short in detection period and high in speed, accuracy and operability, and the detection cost is reduced.
Description
Technical field
The present invention relates to a kind of method and application thereof of multiplex PCR rapid detection, relate in particular to a kind of can be simultaneously for detection of Bacillus proteus serotype 1-4 type etc. until the round pcr of 48 kinds of bacterial strains of 60 types and the sequence of PCR primer used thereof.
Background technology
Bacillus proteus (
proteus) belong to gram negative bacterium, extensively be present in water, the organism of soil corruption and the enteron aisle of humans and animals, decomposing organic matter and animal proteinum are played an important role, in the anaerobic environment of aerobic or special permission condition, all there is the activity of proteolytic ferment.Bacillus proteus is conditioned pathogen, mostly is secondary infection, as chronic otitis media, wound infection etc., also can cause urocystitis, infantile diarrhea, food poisoning etc.
At present up-to-date classification be decided to be proteus vulgaris belong to comprise proteus vulgaris (
p. vulgaris), proteus mirabilis (
p. mirabilis), P.penneri (
p. penneri), produce mucus Bacillus proteus (
p. myxofaciens) and
p. hauserifive kinds and 3 unnamed Bacillus proteus genomospecies 4,5 and 6.In Bacillus proteus, proteus vulgaris, Proteus mirabilis and P.penneri have necessarily pathogenicly, seldom find that there is pathogenic bacterium in other kinds.
Proteus vulgaris and Proteus mirabilis are difference divided into altogether 49 serotypes at first according to O antigen, have found again afterwards 11 kinds of new serotypes, therefore, at present proteus vulgaris and Proteus mirabilis are defined as altogether to 60 kinds of serotypes.In addition, P.penneri has 15 kinds of O antigen serotypes.
The method that conventional art detects pathogenic micro-organism is in biochemical and serology level, to identify after bacterium is cultivated, need to be through the microbial culture of at least 48 hours and the analysis of single bacterium colony, and need to use multiple antiserum(antisera) to carry out agglutination reaction to a large amount of single bacterium colony of each sample, length consuming time, and have undetected possibility.Meanwhile, serological method also has a defect, is subject to exactly sero-fast restriction, and neither one company or unit can produce the antiserum(antisera) of whole bacteriums in the world.
Round pcr be generally acknowledge at present in the pathogenic microorganism examination field the soonest, one of the most effective technology.The advantage of round pcr is rapid sensitive, has become the important development trend of microorganism detection technology.Screening is the core content of the round pcr of development pathogenic micro-organism for the specific DNA molecular sign of pathogenic micro-organism.At present, a lot of enterprises and R&D institution have all dropped into a large amount of manpower and materials for screening the special molecular probe of pathogenic micro-organism in this field in the world.
In the evaluation of pathogenic microorganism, sometimes only need to be identified to species or genus, utilize 16S rRNA, 23S rRNA and 16S-23S rRNA to achieve the goal; And most pathogenic micro-organisms need to identify in classification than the more accurate serotype level of kind.How to utilize Protocols in Molecular Biology that pathogenic microorganism (as bacterium) is identified to one of focus that serotype level is current international microorganism detection area research and difficult point.
Summary of the invention
The object of the present invention is to provide a kind of multiplex PCR Fast Detection Technique to common serotype in Bacillus proteus, for rapid detection and evaluation common pathogen provide effective means.Relate to a kind of can be simultaneously for detection of Bacillus proteus serotype 1 type (
proteusserotype 1), Bacillus proteus serotype 2 types (
proteusserotype 2), Bacillus proteus serotype 3 types (
proteusserotype 3), Bacillus proteus serotype 4 types (
proteusserotype 4), Bacillus proteus serotype 7 types (
proteusserotype 7), Bacillus proteus Serotype8 type (
proteusserotype 8), Bacillus proteus serotype 9 types (
proteusserotype 9), Bacillus proteus serotype 10 types (
proteusserotype 10), Bacillus proteus serotype 11 types (
proteusserotype 11), Bacillus proteus serotype 12 types (
proteusserotype 12), Bacillus proteus serum 13 types (
proteusserotype 13), Bacillus proteus serotype 14 types (
proteusserotype 14), Bacillus proteus serotype 17 types (
proteusserotype 17), Bacillus proteus serotype 18 types (
proteusserotype 18), Bacillus proteus serotype 19 types (
proteusserotype 19), Bacillus proteus serotype 21 types (
proteusserotype 21), Bacillus proteus serotype 23 types (
proteusserotype 23), Bacillus proteus serotype 24 types (
proteusserotype 24), Bacillus proteus serotype 25 types (
proteusserotype 25), Bacillus proteus serotype 26 types (
proteusserotype 26), Bacillus proteus serotype 27 types (
proteusserotype 27), Bacillus proteus serotype 28 types (
proteusserotype 28), Bacillus proteus serotype 29 types (
proteusserotype 29), Bacillus proteus serotype 30 types (
proteusserotype 30), Bacillus proteus serotype 31 types (
proteusserotype 31), Bacillus proteus serotype 32 types (
proteusserotype 32), Bacillus proteus serotype 33 types (
proteusserotype 33), Bacillus proteus serotype 34 types (
proteusserotype 34), Bacillus proteus serotype 36 types (
proteusserotype 36), Bacillus proteus serotype 37 types (
proteusserotype 37), Bacillus proteus serotype 38 types (
proteusserotype 38), Bacillus proteus serotype 39 types (
proteusserotype 39), Bacillus proteus serotype 40 types (
proteusserotype 40), Bacillus proteus serotype 41 types (
proteusserotype 41), Bacillus proteus serotype 44 types (
proteusserotype 44), Bacillus proteus serotype 45 types (
proteusserotype 45), Bacillus proteus serotype 47 types (
proteusserotype 47), Bacillus proteus serotype 48 types (
proteusserotype 48), Bacillus proteus serotype 50 types (
proteusserotype 50), Bacillus proteus serotype 52 types (
proteusserotype 52), Bacillus proteus serotype 53 types (
proteusserotype 53), Bacillus proteus serotype 54 types (
proteusserotype 54), Bacillus proteus serotype 55 types (
proteusserotype 55), Bacillus proteus serotype 56 types (
proteusserotype 56), Bacillus proteus serotype 57 types (
proteusserotype 57), Bacillus proteus serotype 58 types (
proteusserotype 58), Bacillus proteus serotype 59 types (
proteusserotype 59), Bacillus proteus serotype 60 types (
proteusserotype 60), the sequence of the round pcr of 48 kinds of bacterial strains and PCR primer used thereof.The sequence of the primer comprises one or more that choose in following sequence:
(1) Bacillus proteus serotype 1 type, 2 types, 3 types, 4 types, 7 types, 8 types, 9 types, 10 types, 11 types, 12 types, 13 types, 14 types, 17 types, 18 types, 19 types, 21 types, 23 types, 24 types, 25 types, 26 types, 27 types, 28 types, 29 types, 30 types, 31 types, 32 types, 33 types, 34 types, 36 types, 37 types, 38 types, 39 types, 40 types, 41 types, 44 types, 45 types, 47 types, 48 types, 50 types, 52 types, 53 types, 54 types, 55 types, 56 types, 57 types, 58 types, 59 types, and 60 types
wzyspecial nucleotide sequence;
(2) complementary dna sequence of the nucleotide sequence of choosing in above-mentioned (1).
Above-mentioned primer sequence can be used for preparation and detects PCR test kit, gene chip or microarray for Bacillus proteus various serotype.Described mycetozoan serotype samples genome or the lysate extracting in the pure growth of mycetozoan.
The present invention also provides a kind of multiplex PCR detection system, comprises 10 * PCR enzyme spcificity reaction buffer, MgCl
2, dNTP, PCR primer, archaeal dna polymerase, described PCR primer comprises above-mentioned nucleotide sequence; Wherein said PCR primer is preferably the nucleotide sequence as shown in SEQ ID NO:1-SEQ ID NO:96.
The upstream primer of SEQ NO:1 ATTCCTCCTGAAGAGTTTG specific amplified Bacillus proteus 1 type;
The downstream primer of SEQ NO:2 TACTCCCCAAGCACCATT specific amplified Bacillus proteus 1 type;
The upstream primer of SEQ NO:3 TGCCTTTATCCAACAACC specific amplified Bacillus proteus 2 types;
The downstream primer of SEQ NO:4 ATTAGGCGGGAAATCAAG specific amplified Bacillus proteus 2 types;
The upstream primer of SEQ NO:5 ATAGCATTTGAACAGCCTTT specific amplified Bacillus proteus 3 types;
The downstream primer of SEQ NO:6 AACTACATATTCTCCAAAATCC specific amplified Bacillus proteus 3 types;
The upstream primer of SEQ NO:7 ATATTGGCTCGTGGAAAT specific amplified Bacillus proteus 4 types;
The downstream primer of SEQ NO:8 AATTCAATGATGATACGGAG specific amplified Bacillus proteus 4 types;
The upstream primer of SEQ NO:9 ACAGTAATTGGGAATGAGG specific amplified Bacillus proteus 7 types;
The downstream primer of SEQ NO:10 AATTGTACGGCTTTGAGTT specific amplified Bacillus proteus 7 types.
The upstream primer of SEQ NO:11 GCCTTAGCATCACCCTTT specific amplified Bacillus proteus 8 types;
The downstream primer of SEQ NO:12 CACCTTTCATTACACCACG specific amplified Bacillus proteus 8 types;
The upstream primer of SEQ NO:13 ATAACACACCCTTAATAGCC specific amplified Bacillus proteus 9 types;
The downstream primer of SEQ NO:14 AATCGTTTTTCAGAAGCAC specific amplified Bacillus proteus 9 types;
The upstream primer of SEQ NO:15 AGCAATGGGAATAAGCG specific amplified Bacillus proteus 10 types;
The downstream primer of SEQ NO:16 TCCTCCAGCCAAAGGTAT specific amplified Bacillus proteus 10 types;
The upstream primer of SEQ NO:17 TTGCAGGTAGTAGAGCGG specific amplified Bacillus proteus 11 types;
The downstream primer of SEQ NO:18 TAGTGATGATAGGATACCGC specific amplified Bacillus proteus 11 types;
The upstream primer of SEQ NO:19 TTAGGCGTTGACTGGCTC specific amplified Bacillus proteus 12 types;
The downstream primer of SEQ NO:20 ATTAGAGCGGAGACGTGG specific amplified Bacillus proteus 12 types.
The upstream primer of SEQ NO:21 TAAATATGGGCGTTGGCT specific amplified Bacillus proteus 13 types;
The downstream primer of SEQ NO:22 TTATAGGGAATCCAGCAAC specific amplified Bacillus proteus 13 types;
The upstream primer of SEQ NO:23 AAGACAATCCCTAGCGACT specific amplified Bacillus proteus 14 types;
The downstream primer of SEQ NO:24 AGACCACTTCCACTATTTCC specific amplified Bacillus proteus 14 types;
The upstream primer of SEQ NO:25 TGCCGGGATTACAGATCC specific amplified Bacillus proteus 17 types;
The downstream primer of SEQ NO:26 TGACTTACAGGGCCTCCT specific amplified Bacillus proteus 17 types;
The upstream primer of SEQ NO:27 GTTTCGTATTGTGGATCTTG specific amplified Bacillus proteus 18 types;
The downstream primer of SEQ NO:28 TATCGGTGGAATCCTATTG specific amplified Bacillus proteus 18 types;
The upstream primer of SEQ NO:29 TAAACTATCTTATTATTTCCCGA specific amplified Bacillus proteus 19 types;
The downstream primer of SEQ NO:30 TATAGGATACCCACGCGC specific amplified Bacillus proteus 19 types.
The upstream primer of SEQ NO:31 ATGAGTGGCTTGCTATCTTTAT specific amplified Bacillus proteus 21 types;
The downstream primer of SEQ NO:32 TCATAATGTTTTTGATAACCTT specific amplified Bacillus proteus 21 types;
The upstream primer of SEQ NO:33 TGTGGTGAAGTATTAGGTGGAT specific amplified Bacillus proteus 23 types;
The downstream primer of SEQ NO:34 TTGAAATAGCAGCGATAGG specific amplified Bacillus proteus 23 types;
The upstream primer of SEQ NO:35 CCATAACATCTTTTAACCCAT specific amplified Bacillus proteus 24 types;
The downstream primer of SEQ NO:36 AAAATGTATGAATGCCTCCT specific amplified Bacillus proteus 24 types;
The upstream primer of SEQ NO:37 TTTGTCCTTACCCGTCAG specific amplified Bacillus proteus 25 types;
The downstream primer of SEQ NO:38 ATCAGCCAAGCCAATCAT specific amplified Bacillus proteus 25 types;
The upstream primer of SEQ NO:39 CTGGCAAATCACAGTGCT specific amplified Bacillus proteus 26 types;
The downstream primer of SEQ NO:40 CGTATAAACCGGAACCTG specific amplified Bacillus proteus 26 types.
The upstream primer of SEQ NO:41 GCCCTTATCAGCATCCAT specific amplified Bacillus proteus 27 types;
The downstream primer of SEQ NO:42 CCGAATCTATCAGAATAAGGT specific amplified Bacillus proteus 27 types;
The upstream primer of SEQ NO:43 TTCTAGGATTACCATCGCAT specific amplified Bacillus proteus 28 types;
The downstream primer of SEQ NO:44 TAAAAGTTCTGGCAATGATT specific amplified Bacillus proteus 28 types;
The upstream primer of SEQ NO:45 ATTATATCCGCACTAAATCC specific amplified Bacillus proteus 29 types;
The downstream primer of SEQ NO:46 TCAAGAAGAAGTTCAATAAATGT specific amplified Bacillus proteus 29 types;
The upstream primer of SEQ NO:47 TTTCTTTTCCTTATTTGCAC specific amplified Bacillus proteus 30 types;
The downstream primer of SEQ NO:48 TCAATGGGAAGATATTCTTC specific amplified Bacillus proteus 30 types;
The upstream primer of SEQ NO:49 GGAATATGGCGAAGTAACTC specific amplified Bacillus proteus 31 types;
The downstream primer of SEQ NO:50 CTACTTGCTCCGAATGGG specific amplified Bacillus proteus 31 types.
The upstream primer of SEQ NO:51 TATCACTATTCTTAGCAACAGC specific amplified Bacillus proteus 32 types;
The downstream primer of SEQ NO:52 TGATTAAAAGGTGAAATACCAT specific amplified Bacillus proteus 32 types;
The upstream primer of SEQ NO:53 TTTCTGACAGGCTATTTGG specific amplified Bacillus proteus 33 types;
The downstream primer of SEQ NO:54 TTGGGAAGAGTAAAGGAGT specific amplified Bacillus proteus 33 types;
The upstream primer of SEQ NO:55 ATTTACATTCCACCACTTGG specific amplified Bacillus proteus 34 types;
The downstream primer of SEQ NO:56 GTTTGTATAATGCTTCCCAC specific amplified Bacillus proteus 34 types;
The upstream primer of SEQ NO:57 AGGGTTACAGACTCCTTCAC specific amplified Bacillus proteus 36 types;
The downstream primer of SEQ NO:58 ATTTAGATTAGCCCTCAGATT specific amplified Bacillus proteus 36 types;
The upstream primer of SEQ NO:59 TCAACTTTATAGAGTCGCTTTG specific amplified Bacillus proteus 37 types;
The downstream primer of SEQ NO:60 ATAATTCGCGGAATCCTGT specific amplified Bacillus proteus 37 types.
The upstream primer of SEQ NO:61 TGTTGCTGGACATCCTGG specific amplified Bacillus proteus 38 types;
The downstream primer of SEQ NO:62 TTATGTAAGCCGCAGTCC specific amplified Bacillus proteus 38 types;
The upstream primer of SEQ NO:63 GAGACTACCTTCATCGCAAT specific amplified Bacillus proteus 39 types;
The downstream primer of SEQ NO:64 CAATAACGGAGGAAGCAG specific amplified Bacillus proteus 39 types;
The upstream primer of SEQ NO:65 TCATTCTCTGGATTTAGGTATG specific amplified Bacillus proteus 40 types;
The downstream primer of SEQ NO:66 AATAAACACCAAGCCCAG specific amplified Bacillus proteus 40 types;
The upstream primer of SEQ NO:67 TGCCCAGTTAGTAGTTTTG specific amplified Bacillus proteus 41 types;
The downstream primer of SEQ NO:68 GATGATTTGATAGCCGTGA specific amplified Bacillus proteus 41 types;
The upstream primer of SEQ NO:69 AGAAGCAATGCGTTTAGG specific amplified Bacillus proteus 44 types;
The downstream primer of SEQ NO:70 CTCTAGTTTGAGTGATTGGTTG specific amplified Bacillus proteus 44 types.
The upstream primer of SEQ NO:71 TTTATTGTAACTACGGGTTCT specific amplified Bacillus proteus 45 types;
The downstream primer of SEQ NO:72 CTGAAAAATGGAACATGCT specific amplified Bacillus proteus 45 types;
The upstream primer of SEQ NO:73 TTTGTTAGGAAGTGGTATGC specific amplified Bacillus proteus 47 types;
The downstream primer of SEQ NO:74 TGATAGCCGACCTTGAAC specific amplified Bacillus proteus 47 types;
The upstream primer of SEQ NO:75 GCGGTTTACAGTGGACAT specific amplified Bacillus proteus 48 types;
The downstream primer of SEQ NO:76 GCTAGTATCTGCACCTTGTG specific amplified Bacillus proteus 48 types;
The upstream primer of SEQ NO:77 TATGTTTTATCACTCCCAAACT specific amplified Bacillus proteus 50 types;
The downstream primer of SEQ NO:78 TCTTATTCCAAACCCAGG specific amplified Bacillus proteus 50 types;
The upstream primer of SEQ NO:79 TATGCTGTCTATAATGCGATG specific amplified Bacillus proteus 52 types;
The downstream primer of SEQ NO:80 TCAGAACCGTCAATGCTT specific amplified Bacillus proteus 52 types.
The upstream primer of SEQ NO:81 AGATGCCGATGTTCAATGG specific amplified Bacillus proteus 53 types;
The downstream primer of SEQ NO:82 CATAAGGTGATATTCGGGA specific amplified Bacillus proteus 53 types;
The upstream primer of SEQ NO:83 TATCACCAAACCCGACTC specific amplified Bacillus proteus 54 types;
The downstream primer of SEQ NO:84 AAGATACTTGGAATAAGATTCG specific amplified Bacillus proteus 54 types;
The upstream primer of SEQ NO:85 AACATATACTTCTCTGATTACTCTT specific amplified Bacillus proteus 55 types;
The downstream primer of SEQ NO:86 ACGACCTTCCCATTCATC specific amplified Bacillus proteus 55 types;
The upstream primer of SEQ NO:87 TCTTTATCAAAGCTGCTATTG specific amplified Bacillus proteus 56 types;
The downstream primer of SEQ NO:88 GAAAATGCCTAACCACCC specific amplified Bacillus proteus 56 types;
The upstream primer of SEQ NO:89 GCAAATAATGGAGTTCTCTG specific amplified Bacillus proteus 57 types;
The downstream primer of SEQ NO:90 ATACCGTTCCTCGTGATG specific amplified Bacillus proteus 57 types.
The upstream primer of SEQ NO:91 TTATGTATCGACACTTCCAATT specific amplified Bacillus proteus 58 types;
The downstream primer of SEQ NO:92 AATTGCTCACTAAAGGATCTAC specific amplified Bacillus proteus 58 types;
The upstream primer of SEQ NO:93 GCCTAATTTTTGGTTCTCC specific amplified Bacillus proteus 59 types;
The downstream primer of SEQ NO:94 TTCTCATATAGCCTGGATCTG specific amplified Bacillus proteus 59 types;
The upstream primer of SEQ NO:95 CCTTTTGTTACAGCCTTCT specific amplified Bacillus proteus 60 types;
The downstream primer of SEQ NO:96 ATTAAACTTGTCCTTGAGTAAGT specific amplified Bacillus proteus 60 types;
Above-mentioned each reaction of multiplex PCR detection system comprises following reagent: 10uM primer is according to indication interpolation, the MgCl of table 3
2the testing sample template of 3 μ l, 10 * buffer, 3 μ l, 10mM dNTP 2.4 μ l, 5 U/ μ l Taq polysaccharase 0.3 μ l and 2 μ l, in the thin-walled PCR pipe of 0.2ml, is finally used ddH
2o complements to 30 μ l.
In the present invention, nucleotide sequence used also can be used for the development of chip, comprises solid phase carrier and is fixed on the oligonucleotide probe on solid phase carrier, and wherein said oligonucleotide probe comprises above-mentioned Nucleotide.
As seen from the above technical solutions, a kind of multi-PRC reaction system that the present invention sets up can detect 48 kinds of serotype legionella pneumophilias simultaneously, and this detection system has the following advantages:
(1) method is easy, and the cycle is short, speed is fast, workable, testing cost is low: the PCR system compound method that the present invention prepares is easy, and sense cycle is short, speed is fast, workable, and testing cost is relatively low, and market application foreground is wide.Providing for DNA is the two cover systems that template and pure growth lysate are masterplate, is applicable to the detection of the 48 kinds of serotypes of Bacillus proteus under different situations.Compare routine biochemistry detection method, present method has been saved manpower and materials.Can be applied to the fields such as environmental monitoring, Food Hygiene Surveillance, commodity inspection quarantine, and provide technology mode for other different pathogenic microbes detects combine.
(2) accuracy is high: the present invention is according to 48 kinds of serotypes of Bacillus proteus
wztthe special district of gene designs primer.Then utilize primer sets to synthesize multiplex PCR detection system, can directly these 48 kinds of Bacillus proteuss and the Bacillus proteus of other serotypes or the nearly source bacterial classification of Bacillus proteus be separated.
(3) detection sensitivity is high: multiple PCR detection kit provided by the invention and detection method susceptibility thereof are higher, the DNA profiling of 25pg/ μ l can be detected.To common serotype, can carry out comprehensively, system, detect and identify accurately.
Accompanying drawing explanation
Fig. 1 is multiplex PCR system detected result one of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 17 type G2619; 2 is Bacillus proteus 25 type G2818; 3 is Bacillus proteus 13 type G2628; 4 is Bacillus proteus 29 type G2630; 5 is Bacillus proteus 33 type G3925;
Fig. 2 is multiplex PCR system detected result two of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 4 type G2608; 2 is Bacillus proteus 41 type G2640; 3 is Bacillus proteus 54 type G2649; 4 is Bacillus proteus 12 type G2615; 5 is Bacillus proteus 9 type G2613;
Fig. 3 is multiplex PCR system detected result three of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 58 type G2654; 2 is Bacillus proteus 3 type G2292; 3 is Bacillus proteus 10 type G2294; 4 is Bacillus proteus 52 type G4071; 5 is Bacillus proteus 31 type G2632;
Fig. 4 is multiplex PCR system detected result four of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 59 type G2655; 2 is Bacillus proteus 38 type G2637; 3 is Bacillus proteus 19 type G2622; 4 is Bacillus proteus 45 type G2642; 5 is Bacillus proteus 30 type G2631;
Fig. 5 is multiplex PCR system detected result five of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 34 type G2635; 2 is Bacillus proteus 53 type G2648; 3 is Bacillus proteus 36 type G3926; 4 is Bacillus proteus 24 type G2627; 5 is Bacillus proteus 47 type G2643;
Fig. 6 is multiplex PCR system detected result six of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 55 type G2651; 2 is Bacillus proteus 40 type G2639; 3 is Bacillus proteus 27 type G2298; 4 is Bacillus proteus 7 type G2611;
Fig. 7 is multiplex PCR system detected result seven of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 57 type G2653; 2 is Bacillus proteus 44 type G2641; 3 is Bacillus proteus 11 type G2614; 4 is Bacillus proteus 48 type G2644;
Fig. 8 is multiplex PCR system detected result eight of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 50 type G2647; 2 is Bacillus proteus 2 type G2291; 3 is Bacillus proteus 1 type G2290; 4 is Bacillus proteus 8 type G2612; 5 is Bacillus proteus 23 type G2297;
Fig. 9 is multiplex PCR system detected result nine of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 32 type G2634; 2 is Bacillus proteus 26 type G2629; 3 is Bacillus proteus 56 type G2652; 4 is Bacillus proteus 21 type G2625; 5 is Bacillus proteus 37 type G2636;
Figure 10 is multiplex PCR system detected result ten of the present invention, wherein: M is 100 bp DNA Ladder; 1 is Bacillus proteus 39 type G2638; 2 is Bacillus proteus 28 type G2299; 3 is Bacillus proteus 60 type G2656; 4 is Bacillus proteus 18 type G2621; 5 is Bacillus proteus 14 type G2617.
Embodiment:
For guaranteeing that above and other objects of the present invention feature and advantage become apparent, below especially exemplified by preferred embodiment, and coordinate Figure of description, in conjunction with specific examples, the present invention is described in further detail.The present invention's all ingredients used all has commercially available.
embodiment 1: genomic extraction
In being equipped with that 2YT is little to shake pipe, cultivate Bacillus proteus, at 37 ℃, collecting cell after incubated overnight in 180rpm shaking table, adopts traditional phenol, chloroform extraction method Extraction Methods of Genome to extract genome.Concrete steps are as follows:
(1) collect 1ml bacterium liquid to 1.5ml centrifuge tube, the centrifugal 10min of 12000rpm abandons supernatant and collects thalline.
(2) in this centrifuge tube, add 500 μ l tris-Hcl re-suspended cells, 12000rpm is centrifugal, and 5min removes supernatant.
(3) repeating step (2)
(4) in thalline, add 250ul 50mM Tris-HCl (pH8.0) and 10ul 0.4M EDTA re-suspended cell, add 37 ℃ of the N,O-Diacetylmuramidases insulation 20 minutes of 10ul 10mg/ml.Gram-positive microorganism will spend the night.
(5) to Proteinase K, the 15ul 10%SDS of 3ul 20mg/ml in mixed solution, 50 ℃ of incubations 2 hours.If becoming refrigerant, liquid can not add wherein more appropriate 10%SDS.
(6) add the RNase of 3 ul 10mg/ml, 65 ℃ of incubations 20 minutes.
(7) use isopyknic phenol: chloroform: twice of primary isoamyl alcohol (25:24:1) solution extracting.
(8) get supernatant liquor, then use isopyknic chloroform: primary isoamyl alcohol (49:1) extracting.
(9) 2 times of volume ethanol precipitation DNA for supernatant liquor,
(10) by (9) 4 ℃, the centrifugal 10min of 12000rpm, DNA also washes DNA with 70% ethanol, finally DNA is resuspended in 30ul TE.Genomic dna detects by 0.4% agarose gel electrophoresis.
embodiment 2: the design of primer
The Bacillus proteus sequence of using laboratory to test oneself, for serotype 1 type, 2 types, 3 types, 4 types, 7 types, 8 types, 9 types, 10 types, 11 types, 12 types, 13 types, 14 types, 17 types, 18 types, 19 types, 21 types, 23 types, 24 types, 25 types, 26 types, 27 types, 28 types, 29 types, 30 types, 31 types, 32 types, 33 types, 34 types, 36 types, 37 types, 38 types, 39 types, 40 types, 41 types, 44 types, 45 types, 47 types, 48 types, 50 types, 52 types, 53 types, 54 types, 55 types, 56 types, 57 types, 58 types, 59 types, and 60 types
wzyspecial district's design primer of gene, primer sequence is as shown in table 1 below:
The special primer sequence of 48 kinds of serotypes of table 1 Bacillus proteus
embodiment 3: the screening of special primer
For special district's design primer of the wzt gene of 48 kinds of serotypes of Bacillus proteus, primer sequence (SEQ ID NO:1-SEQ ID NO:96) as shown in table 1.Collected each 1 strain of 48 kinds of Bacillus proteus serotype reference cultures, the specificity of the nearly edge bacterium checking of each 1 strain of the reference culture of 10 kinds of other serotypes of Bacillus proteus and 6 strains primer, strain number and source see the following form 2.
Table 2 is for the reference culture of examination
PCR system is that 10uM primer is according to indication interpolation, the MgCl of table 3
2the testing sample template of 3 μ l, 10 * buffer, 3 μ l, 10mM dNTP 2.4 μ l, 5 U/ μ l Taq polysaccharase 0.3 μ l and 2 μ l, in the thin-walled PCR pipe of 0.2ml, is finally used ddH
2o complements to 30 μ l.All primers all obtain positive findings in 48 kinds of Bacillus proteus templates in sensing range, do not obtain any PCR product band, so these oligonucleotide are high specials in other 10 kinds of Bacillus proteus serotypes and 6 kinds of nearly edge bacterial strain masterplates.
embodiment 4: multiplex PCR system
1. multi-PRC reaction system
1) multiple PCR reagent kit comprises PCR primer, dNTP, damping fluid and archaeal dna polymerase,
Wherein PCR primer sees the above table 1 in detail.Single of the present invention detects and tests the amount of reagent of using is 30 μ l.See the following form 3 concrete composition.
2) preparation of test experience material requested and equipment
MgCl wherein
2, 10 * damping fluid, dNTP, Taq polysaccharase provide by the raw work in Shanghai; It is synthetic that primer mixture is that the sequence of designed, designed offers Shanghai Ying Jun biotech company; Positive reference substance, negative control product and ddH
2o is prepared voluntarily by us.Equipment PCR instrument (having another name called DNA thermal cycling amplification instrument), electrophoresis equipment (comprising electrophoresis apparatus and electrophoresis chamber), gel imaging instrument ,-20 ℃ of refrigerators, supercentrifuge, micropipet and 0.2ml PCR thin-walled tubes of experiment.
Table 3 Multiplex PCR reaction mixture formula
Note: in table, P-1 to P-96 is primer listed in table 1.
2. multi-PRC reaction condition
Multiplex PCR system of the present invention comprises ten group reactions, and the special primer that every group reaction comprises is 4-5 couple.The reaction system of the multiplex PCR of optimizing is listed among table 3.
The final reaction conditions of multi-PRC reaction in the present invention is summarized as follows:
95 ℃, 5 minutes
95 ℃, 50 seconds
58 ℃, 30 circulations in 45 seconds
72 ℃, 1 minute
72 ℃, 5 minutes
embodiment 5:pCR detection system application example
The reference culture of the Bacillus proteus serotype in 48 strain sensing ranges in table 2 is detected according to reaction system and the reaction conditions optimized, and step is as follows:
(1) from strain preservative tube, the bacterium amount that connects of 1:1000 connects bacterium and shakes in pipe to the 2YT that 4ml is housed is little, and 37 ℃, incubated overnight in 180rpm shaking table.
(2) collect 1ml bacterium liquid and extract genome by extracting genome method shown in embodiment 1.
(3) according to the component in table 3 and quantity, add primer, dNTP, damping fluid and enzyme, get the genomic dna of 1 μ l as template.
(4) according to condition described in embodiment 4, carry out PCR reaction.
(5) electrophoresis detection.
(6) interpretation of result is with reference to Fig. 1-10.
The above, it is only preferred embodiment of the present invention, not the present invention is done to any pro forma restriction, any simple modification, equivalent variations and modification that every foundation technical spirit of the present invention is done above embodiment, all still belong in the scope of technical solution of the present invention.
SEQUENCE LISTING
<110> Nankai University
<120> Bacillus proteus various serotype bacterial strain Auele Specific Primer and multi-PCR detection method
<160> 96
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213> Bacillus proteus 1 type
<400> 1
attcctcctg aagagtttg 19
<210> 2
<211> 18
<212> DNA
<213> Bacillus proteus 1 type
<400> 2
tactccccaa gcaccatt 18
<210> 3
<211> 18
<212> DNA
<213> Bacillus proteus 2 types
<400> 3
tgcctttatc caacaacc 18
<210> 4
<211> 18
<212> DNA
<213> Bacillus proteus 2 types
<400> 4
attaggcggg aaatcaag 18
<210> 5
<211> 20
<212> DNA
<213> Bacillus proteus 3 types
<400> 5
atagcatttg aacagccttt 20
<210> 6
<211> 22
<212> DNA
<213> Bacillus proteus 3 types
<400> 6
aactacatat tctccaaaat cc 22
<210> 7
<211> 18
<212> DNA
<213> Bacillus proteus 4 types
<400> 7
atattggctc gtggaaat 18
<210> 8
<211> 20
<212> DNA
<213> Bacillus proteus 4 types
<400> 8
aattcaatga tgatacggag 20
<210> 9
<211> 19
<212> DNA
<213> Bacillus proteus 7 types
<400> 9
acagtaattg ggaatgagg 19
<210> 10
<211> 19
<212> DNA
<213> Bacillus proteus 7 types
<400> 10
aattgtacgg ctttgagtt 19
<210> 11
<211> 18
<212> DNA
<213> Bacillus proteus 8 types
<400> 11
gccttagcat cacccttt 18
<210> 12
<211> 19
<212> DNA
<213> Bacillus proteus 8 types
<400> 12
cacctttcat tacaccacg 19
<210> 13
<211> 20
<212> DNA
<213> Bacillus proteus 9 types
<400> 13
ataacacacc cttaatagcc 20
<210> 14
<211> 19
<212> DNA
<213> Bacillus proteus 9 types
<400> 14
aatcgttttt cagaagcac 19
<210> 15
<211> 17
<212> DNA
<213> Bacillus proteus 10 types
<400> 15
agcaatggga ataagcg 17
<210> 16
<211> 18
<212> DNA
<213> Bacillus proteus 10 types
<400> 16
tcctccagcc aaaggtat 18
<210> 17
<211> 18
<212> DNA
<213> Bacillus proteus 11 types
<400> 17
ttgcaggtag tagagcgg 18
<210> 18
<211> 20
<212> DNA
<213> Bacillus proteus 11 types
<400> 18
tagtgatgat aggataccgc 20
<210> 19
<211> 18
<212> DNA
<213> Bacillus proteus 12 types
<400> 19
ttaggcgttg actggctc 18
<210> 20
<211> 18
<212> DNA
<213> Bacillus proteus 12 types
<400> 20
attagagcgg agacgtgg 18
<210> 21
<211> 18
<212> DNA
<213> Bacillus proteus 13 types
<400> 21
taaatatggg cgttggct 18
<210> 22
<211> 19
<212> DNA
<213> Bacillus proteus 13 types
<400> 22
ttatagggaa tccagcaac 19
<210> 23
<211> 19
<212> DNA
<213> Bacillus proteus 14 types
<400> 23
aagacaatcc ctagcgact 19
<210> 24
<211> 20
<212> DNA
<213> Bacillus proteus 14 types
<400> 24
agaccacttc cactatttcc 20
<210> 25
<211> 18
<212> DNA
<213> Bacillus proteus 17 types
<400> 25
tgccgggatt acagatcc 18
<210> 26
<211> 18
<212> DNA
<213> Bacillus proteus 17 types
<400> 26
tgacttacag ggcctcct 18
<210> 27
<211> 20
<212> DNA
<213> Bacillus proteus 18 types
<400> 27
gtttcgtatt gtggatcttg 20
<210> 28
<211> 19
<212> DNA
<213> Bacillus proteus 18 types
<400> 28
tatcggtgga atcctattg 19
<210> 29
<211> 23
<212> DNA
<213> Bacillus proteus 19 types
<400> 29
taaactatct tattatttcc cga 23
<210> 30
<211> 18
<212> DNA
<213> Bacillus proteus 19 types
<400> 30
tataggatac ccacgcgc 18
<210> 31
<211> 22
<212> DNA
<213> Bacillus proteus 21 types
<400> 31
atgagtggct tgctatcttt at 22
<210> 32
<211> 22
<212> DNA
<213> Bacillus proteus 21 types
<400> 32
tcataatgtt tttgataacc tt 22
<210> 33
<211> 22
<212> DNA
<213> Bacillus proteus 23 types
<400> 33
tgtggtgaag tattaggtgg at 22
<210> 34
<211> 19
<212> DNA
<213> Bacillus proteus 23 types
<400> 34
ttgaaatagc agcgatagg 19
<210> 35
<211> 21
<212> DNA
<213> Bacillus proteus 24 types
<400> 35
ccataacatc ttttaaccca t 21
<210> 36
<211> 20
<212> DNA
<213> Bacillus proteus 24 types
<400> 36
aaaatgtatg aatgcctcct 20
<210> 37
<211> 18
<212> DNA
<213> Bacillus proteus 25 types
<400> 37
tttgtcctta cccgtcag 18
<210> 38
<211> 18
<212> DNA
<213> Bacillus proteus 25 types
<400> 38
atcagccaag ccaatcat 18
<210> 39
<211> 18
<212> DNA
<213> Bacillus proteus 26 types
<400> 39
ctggcaaatc acagtgct 18
<210> 40
<211> 18
<212> DNA
<213> Bacillus proteus 26 types
<400> 40
cgtataaacc ggaacctg 18
<210> 41
<211> 18
<212> DNA
<213> Bacillus proteus 27 types
<400> 41
gcccttatca gcatccat 18
<210> 42
<211> 21
<212> DNA
<213> Bacillus proteus 27 types
<400> 42
ccgaatctat cagaataagg t 21
<210> 43
<211> 20
<212> DNA
<213> Bacillus proteus 28 types
<400> 43
ttctaggatt accatcgcat 20
<210> 44
<211> 20
<212> DNA
<213> Bacillus proteus 28 types
<400> 44
taaaagttct ggcaatgatt 20
<210> 45
<211> 20
<212> DNA
<213> Bacillus proteus 29 types
<400> 45
attatatccg cactaaatcc 20
<210> 46
<211> 23
<212> DNA
<213> Bacillus proteus 29 types
<400> 46
tcaagaagaa gttcaataaa tgt 23
<210> 47
<211> 20
<212> DNA
<213> Bacillus proteus 30 types
<400> 47
tttcttttcc ttatttgcac 20
<210> 48
<211> 20
<212> DNA
<213> Bacillus proteus 30 types
<400> 48
tcaatgggaa gatattcttc 20
<210> 49
<211> 20
<212> DNA
<213> Bacillus proteus 31 types
<400> 49
ggaatatggc gaagtaactc 20
<210> 50
<211> 18
<212> DNA
<213> Bacillus proteus 31 types
<400> 50
ctacttgctc cgaatggg 18
<210> 51
<211> 22
<212> DNA
<213> Bacillus proteus 32 types
<400> 51
tatcactatt cttagcaaca gc 22
<210> 52
<211> 22
<212> DNA
<213> Bacillus proteus 32 types
<400> 52
tgattaaaag gtgaaatacc at 22
<210> 53
<211> 19
<212> DNA
<213> Bacillus proteus 33 types
<400> 53
tttctgacag gctatttgg 19
<210> 54
<211> 19
<212> DNA
<213> Bacillus proteus 33 types
<400> 54
ttgggaagag taaaggagt 19
<210> 55
<211> 20
<212> DNA
<213> Bacillus proteus 34 types
<400> 55
atttacattc caccacttgg 20
<210> 56
<211> 20
<212> DNA
<213> Bacillus proteus 34 types
<400> 56
gtttgtataa tgcttcccac 20
<210> 57
<211> 20
<212> DNA
<213> Bacillus proteus 36 types
<400> 57
agggttacag actccttcac 20
<210> 58
<211> 21
<212> DNA
<213> Bacillus proteus 36 types
<400> 58
atttagatta gccctcagat t 21
<210> 59
<211> 22
<212> DNA
<213> Bacillus proteus 37 types
<400> 59
tcaactttat agagtcgctt tg 22
<210> 60
<211> 19
<212> DNA
<213> Bacillus proteus 37 types
<400> 60
ataattcgcg gaatcctgt 19
<210> 61
<211> 18
<212> DNA
<213> Bacillus proteus 38 types
<400> 61
tgttgctgga catcctgg 18
<210> 62
<211> 18
<212> DNA
<213> Bacillus proteus 38 types
<400> 62
ttatgtaagc cgcagtcc 18
<210> 63
<211> 20
<212> DNA
<213> Bacillus proteus 39 types
<400> 63
gagactacct tcatcgcaat 20
<210> 64
<211> 18
<212> DNA
<213> Bacillus proteus 39 types
<400> 64
caataacgga ggaagcag 18
<210> 65
<211> 22
<212> DNA
<213> Bacillus proteus 40 types
<400> 65
tcattctctg gatttaggta tg 22
<210> 66
<211> 18
<212> DNA
<213> Bacillus proteus 40 types
<400> 66
aataaacacc aagcccag 18
<210> 67
<211> 19
<212> DNA
<213> Bacillus proteus 41 types
<400> 67
tgcccagtta gtagttttg 19
<210> 68
<211> 19
<212> DNA
<213> Bacillus proteus 41 types
<400> 68
gatgatttga tagccgtga 19
<210> 69
<211> 18
<212> DNA
<213> Bacillus proteus 44 types
<400> 69
agaagcaatg cgtttagg 18
<210> 70
<211> 22
<212> DNA
<213> Bacillus proteus 44 types
<400> 70
ctctagtttg agtgattggt tg 22
<210> 71
<211> 21
<212> DNA
<213> Bacillus proteus 45 types
<400> 71
tttattgtaa ctacgggttc t 21
<210> 72
<211> 19
<212> DNA
<213> Bacillus proteus 45 types
<400> 72
ctgaaaaatg gaacatgct 19
<210> 73
<211> 20
<212> DNA
<213> Bacillus proteus 47 types
<400> 73
tttgttagga agtggtatgc 20
<210> 74
<211> 18
<212> DNA
<213> Bacillus proteus 47 types
<400> 74
tgatagccga ccttgaac 18
<210> 75
<211> 18
<212> DNA
<213> Bacillus proteus 48 types
<400> 75
gcggtttaca gtggacat 18
<210> 76
<211> 20
<212> DNA
<213> Bacillus proteus 48 types
<400> 76
gctagtatct gcaccttgtg 20
<210> 77
<211> 22
<212> DNA
<213> Bacillus proteus 50 types
<400> 77
tatgttttat cactcccaaa ct 22
<210> 78
<211> 18
<212> DNA
<213> Bacillus proteus 50 types
<400> 78
tcttattcca aacccagg 18
<210> 79
<211> 21
<212> DNA
<213> Bacillus proteus 52 types
<400> 79
tatgctgtct ataatgcgat g 21
<210> 80
<211> 18
<212> DNA
<213> Bacillus proteus 52 types
<400> 80
tcagaaccgt caatgctt 18
<210> 81
<211> 19
<212> DNA
<213> Bacillus proteus 53 types
<400> 81
agatgccgat gttcaatgg 19
<210> 82
<211> 19
<212> DNA
<213> Bacillus proteus 53 types
<400> 82
cataaggtga tattcggga 19
<210> 83
<211> 18
<212> DNA
<213> Bacillus proteus 54 types
<400> 83
tatcaccaaa cccgactc 18
<210> 84
<211> 22
<212> DNA
<213> Bacillus proteus 54 types
<400> 84
aagatacttg gaataagatt cg 22
<210> 85
<211> 25
<212> DNA
<213> Bacillus proteus 55 types
<400> 85
aacatatact tctctgatta ctctt 25
<210> 86
<211> 18
<212> DNA
<213> Bacillus proteus 55 types
<400> 86
acgaccttcc cattcatc 18
<210> 87
<211> 21
<212> DNA
<213> Bacillus proteus 56 types
<400> 87
tctttatcaa agctgctatt g 21
<210> 88
<211> 18
<212> DNA
<213> Bacillus proteus 56 types
<400> 88
gaaaatgcct aaccaccc 18
<210> 89
<211> 20
<212> DNA
<213> Bacillus proteus 57 types
<400> 89
gcaaataatg gagttctctg 20
<210> 90
<211> 18
<212> DNA
<213> Bacillus proteus 57 types
<400> 90
ataccgttcc tcgtgatg 18
<210> 91
<211> 22
<212> DNA
<213> Bacillus proteus 58 types
<400> 91
ttatgtatcg acacttccaa tt 22
<210> 92
<211> 22
<212> DNA
<213> Bacillus proteus 58 types
<400> 92
aattgctcac taaaggatct ac 22
<210> 93
<211> 19
<212> DNA
<213> Bacillus proteus 59 types
<400> 93
gcctaatttt tggttctcc 19
<210> 94
<211> 21
<212> DNA
<213> Bacillus proteus 59 types
<400> 94
ttctcatata gcctggatct g 21
<210> 95
<211> 19
<212> DNA
<213> Bacillus proteus 60 types
<400> 95
ccttttgtta cagccttct 19
<210> 96
<211> 23
<212> DNA
<213> Bacillus proteus 60 types
<400> 96
attaaacttg tccttgagta agt 23
Claims (4)
1. for detection of the specific PCR primer of Bacillus proteus various serotype bacterial strain, it is characterized in that the nucleotide sequence of described Auele Specific Primer as shown in SEQ ID NO:1-SEQ ID NO:96.
2. Auele Specific Primer claimed in claim 1, Auele Specific Primer is wherein: Bacillus proteus serotype 1 type, 2 types, 3 types, 4 types, 7 types, 8 types, 9 types, 10 types, 11 types, 12 types, 13 types, 14 types, 17 types, 18 types, 19 types, 21 types, 23 types, 24 types, 25 types, 26 types, 27 types, 28 types, 29 types, 30 types, 31 types, 32 types, 33 types, 34 types, 36 types, 37 types, 38 types, 39 types, 40 types, 41 types, 44 types, 45 types, 47 types, 48 types, 50 types, 52 types, 53 types, 54 types, 55 types, 56 types, 57 types, 58 types, 59 types, and 60 types
wzyspecial nucleotide sequence.
3. described in claim 1, the specific PCR primer for detection of Bacillus proteus various serotype bacterial strain detects the application aspect PCR test kit, gene chip or microarray for Bacillus proteus in preparation conduct.
4. contain described in claim 1 the multiplex PCR system for detection of the specific PCR primer of Bacillus proteus various serotype bacterial strain, it is characterized in that it is by 10 * PCR enzyme spcificity reaction buffer, MgCl
2, dNTP, PCR primer, archaeal dna polymerase form; The nucleotide sequence of described PCR primer as shown in SEQ ID NO:1-SEQ ID NO:96; Described primer matched proportion density is as follows:
。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310115652.5A CN103173555B (en) | 2013-04-02 | 2013-04-02 | Proteusbacillus vulgaris multi-serotype strain specific primer and multiple polymerase chain reaction (PCR) detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310115652.5A CN103173555B (en) | 2013-04-02 | 2013-04-02 | Proteusbacillus vulgaris multi-serotype strain specific primer and multiple polymerase chain reaction (PCR) detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103173555A CN103173555A (en) | 2013-06-26 |
| CN103173555B true CN103173555B (en) | 2014-11-26 |
Family
ID=48633742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310115652.5A Active CN103173555B (en) | 2013-04-02 | 2013-04-02 | Proteusbacillus vulgaris multi-serotype strain specific primer and multiple polymerase chain reaction (PCR) detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103173555B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105112513A (en) * | 2015-08-03 | 2015-12-02 | 南开大学 | Nucleotides specific to Proteusbacillus vulgaris O30, O16 and O9 and their application |
| CN105200123A (en) * | 2015-08-03 | 2015-12-30 | 南开大学 | Nucleotides specific to proteusbacillus vulgaris O47, O21, O32 and O23 as well as application of nucleotides |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1560597A (en) * | 2004-03-09 | 2005-01-05 | 扬州大学 | Multiple PCR quickly investigating method for avian influenza virus |
-
2013
- 2013-04-02 CN CN201310115652.5A patent/CN103173555B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1560597A (en) * | 2004-03-09 | 2005-01-05 | 扬州大学 | Multiple PCR quickly investigating method for avian influenza virus |
Non-Patent Citations (4)
| Title |
|---|
| 不同血清型牛源巴氏杆菌多重PCR检测方法的建立;段新华等;《中国畜牧兽医》;21011231;第37卷(第8期);175-177 * |
| 变形杆菌基因分型方法的评价;贾宁等;《中华医院感染学杂志》;20021231;第12卷(第9期);652-654 * |
| 段新华等.不同血清型牛源巴氏杆菌多重PCR检测方法的建立.《中国畜牧兽医》.2101,第37卷(第8期),175-177. * |
| 贾宁等.变形杆菌基因分型方法的评价.《中华医院感染学杂志》.2002,第12卷(第9期),652-654. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103173555A (en) | 2013-06-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Domann et al. | Culture-independent identification of pathogenic bacteria and polymicrobial infections in the genitourinary tract of renal transplant recipients | |
| CN105112519A (en) | CRISPR-based Escherichia coli O157:H7 strain detection reagent box and detection method | |
| CA2596059C (en) | Method of quantitatively analysing microorganism targeting rrna | |
| CN102399877B (en) | Staphylococcus aureus methicillin resistant strain PCR (Polymerase Chain Reaction) detection kit | |
| Maus et al. | Biphasic study to characterize agricultural biogas plants by high-throughput 16S rRNA gene amplicon sequencing and microscopic analysis | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| CN103173555B (en) | Proteusbacillus vulgaris multi-serotype strain specific primer and multiple polymerase chain reaction (PCR) detection method | |
| CN102559863A (en) | Specific nucleic acid identification sequence used for detecting proteus mirabilis, and application thereof | |
| WO2015180484A1 (en) | Nucleotides specific to providencia o31, o41, o42, o43 and o50 and uses thereof | |
| CN105274199B (en) | Kit and its application method a kind of while that detect staphylococcus aureus and the rugged Cronobacter sakazakii of slope | |
| Huang et al. | Detection of Phytophthora nicotianae in soil with real‐time quantitative PCR | |
| Yousef | Detection of bacterial pathogens in different matrices: Current practices and challenges | |
| CN104450930A (en) | Molecular detection method of vibrio parahaemolyticus and application thereof | |
| CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| CN102399876B (en) | Staphylococcus aureus strain PCR (Polymerase Chain Reaction) detection kit | |
| Cui et al. | Establishment and application of a multiplex real-time PCR assay coupled with propidium monoazide for the simultaneous detection of viable Vibrio parahaemolyticus, Vibrio vulnificus and Vibrio alginolyticus | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN104531861B (en) | A kind of molecular detecting method of Enterobacter sakazakii and its application | |
| CN102433385B (en) | Primers for identifying leuconostoc mesenteroides and application thereof | |
| CN101792760A (en) | Method for obtaining nucleotide sequence in V3 region of 16S rRNA genes of bacteria and special primer thereof | |
| Günther et al. | Design and evaluation of an oligonucleotide-microarray for the detection of different species of the genus Kitasatospora |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |