CN101906467A - Fluorescent quantitative PCR method for detecting prorocentrum minimum - Google Patents
Fluorescent quantitative PCR method for detecting prorocentrum minimum Download PDFInfo
- Publication number
- CN101906467A CN101906467A CN2009101982586A CN200910198258A CN101906467A CN 101906467 A CN101906467 A CN 101906467A CN 2009101982586 A CN2009101982586 A CN 2009101982586A CN 200910198258 A CN200910198258 A CN 200910198258A CN 101906467 A CN101906467 A CN 101906467A
- Authority
- CN
- China
- Prior art keywords
- quantitative pcr
- prorocentrum minimum
- primer
- dilution
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a fluorescent quantitative PCR method for detecting prorocentrum minimum, which comprises the following steps of: (1) pretreating alga liquid, namely extracting sample alga liquid, centrifuging to collect cells, washing with buffer solution and resuspending to obtain alga liquid to be treated; (2) optimizing a fluorescent quantitative PCR primer and concentration, wherein a primer sequence PM-liF is CCCCCATGCAGAGACTCAA, a primer sequence PM-liR is CAGCAAGGACAGGCACAGAA, and the final concentration of the primer is 200nmol/L; and (3) detecting the cells of the prorocentrum minimum, namely performing fluorescent quantitative PCR amplification after treating the alga liquid to be treated, and calculating the number of the cells and the DNA content of the prorocentrum minimum according to a regression equation. The method has the advantages of simple operation, environmental friendliness, accurate detection result, high sensitivity and good repeatability of the established standard curve, high linearity among points of the standard curve, good application prospect in the field of alga authentication, and the like.
Description
Technical field
The field is identified in the detection that the invention belongs to prorocentrum minimum, particularly relates to a kind of method of fluorescence quantitative PCR detection prorocentrum minimum
Background technology
Red tide is predicted that matter of utmost importance is that the red tide algae is detected, traditional algae is identified and divides by morphologic observation, from pigment, chromatoplast, the difference of reserve substance etc. is distinguished alga cells not of the same race, this is a thing that wastes time and energy, and different kind difference is very trickle, the non-professional who is engaged in this work for a long time is difficult to competent this work, and environment has a significant impact the algae form, identifies the difficult more of kind of existence.
At present, the method for utilizing molecular biology method to detect little algae is day by day ripe, and these methods have solved some algae classification and evaluation problem that is difficult to distinguish from form from molecular level.(Polymerase ChainReaction, PCR) since the technological invention, this technology just is applied to numerous areas since the polymerase chain reaction.Many scholars come algae is identified by some gene fragment amplification of little algae, for example pass through rrna rDNA sequential analysis, the pcr amplification and the order-checking of rrna transcribed spacer (ITS), thereby finish the kind of microalgae is identified, yet this method sensitivity is not high, and can't be quantitative, promptly can not determine frustule quantity in the water body.Fluorescence in situ hybridization also is the detection means that little in recent years algae is identified, some scholar utilizes large ribosomal subunit (LSU) and ITS to distinguish sub-probe some red tide microalgae is identified, and is high but this technology requires probe, and quantitative weak effect.Real-time fluorescence quantitative PCR detects and to become little in recent years algae and detect a focus direction, and this method is very sensitive, though required laboratory apparatus (quantitative real time PCR Instrument) costs an arm and a leg, still has many laboratories multiple little algae that utilized this technical evaluation.
Prorocentrum minimum (Prorocentrum minimum) is the multiple red tide algae in Chinese marine site, causes a lot of red tides in recent years, therefore, this algae is carried out effective sensitive detect to avoid the generation of red tide, becomes the topic that paid close attention to by people at present.
Summary of the invention
Technical problem to be solved by this invention provides a kind of method of fluorescence quantitative PCR detection prorocentrum minimum, this method has simple to operate, environmentally friendly, advantages such as detected result is accurate, the highly sensitive good reproducibility of setting up of typical curve, become highly linear between the typical curve each point, and in 30 circulations, just can detect 0.5 cell and 10pg genomic dna, have a good application prospect in algae evaluation field.
The method of a kind of fluorescence quantitative PCR detection prorocentrum minimum of the present invention comprises:
(1) pre-treatment of algae liquid
Draw samples algae liquid, centrifugal collecting cell is used after the PBS damping fluid washed twice of pH 7.0 resuspendedly then, and making density is 2.5 * 10
8The pending algae liquid of cell/L;
(2) fluorescence quantification PCR primer design and specificity checking
Compare from GenBank acquisition prorocentrum minimum ITS sequence and with the corresponding sequence of other little algaes, select in the ITS zone and other little algae ITS1 district that there were significant differences, design the fluorescent quantitation primer that is suitable for SYBRGreen I method with Primer Express 3.0, primer sequence is:
PM-1iF:CCCCCATGCAGAGACTCAA,
PM-1iR:CAGCAAGGACAGGCACAGAA;
To design among primer and the GenBank sequence and carry out the Blast comparison, the specificity of checking primer, optimize the primer final concentration to 200nmol/L, respectively the broken algae liquid of algae of the same race is not carried out fluorescent quantitative PCR then, amplification shows that the sample that contains prorocentrum minimum DNA has amplification, and other contrast little algae sample does not have amplification;
(3) number of cells of prorocentrum minimum and genomic dna detect
Get the pending algae liquid that obtains in the step (1) in centrifuge tube, carry out ultrasonication in ice bath, microscopic examination all is broken until all cells, algae liquid is pressed 1: 10 times of dilution, 5 extent of dilution, each extent of dilution repeats 3 times, carries out fluorescent quantitative PCR then.The extension increasing sequence of prorocentrum minimum DNA is as follows:
Cccccatgcagagactcaagggcagcaagccaggctcagaccgtcttctgtgcctg tccttgctg, length 65bp.
The regression coefficient that fluorescent quantitative PCR result obtains is 0.989, and the highly sensitive good reproducibility of setting up with this method of typical curve is described, becomes highly linear between the typical curve each point, then according to regression equation:
y=-3.277x+43.708
Wherein: x is a cell count, and y is C
TBe worth, calculate the number of cells of prorocentrum minimum;
Extract the prorocentrum minimum genomic dna with the CTAB method, detect the original DNA initial concentration, then genomic dna is carried out 1: 10 times of dilution with Biophometre (German Eppendof company), 7 extent of dilution, each extent of dilution repeats 3 times, finally detects dna content.
Ultrasonication in the described step (3) is ultrasonic power 200W, ultrasonic time 3 seconds, 3 seconds pitch times;
The condition of the fluorescent quantitative PCR in the described step (3) is: 94 ℃ of 10min, 94 ℃ of 15s, 60 ℃ of 1min, 40 circulations; 94 ℃ of 15s of solubility curve, 60 ℃ of 1min, 94 ℃ of 15s, amplification system is 20 μ L systems, 2 μ L genomic dnas, 10 μ L, 2 * Power SYBR Green Mater mix, primer PM-1iF and PM-1iR (initial concentration is 10 μ M) 0.4 μ L (the primer final concentration is 200nmol/L), 7.2 μ L ddH
2O.
Beneficial effect
Fluorescence quantitative detecting method of the present invention has simple to operate, environmentally friendly, advantages such as detected result is accurate, the highly sensitive good reproducibility of setting up of typical curve, become highly linear between the typical curve each point, and in 30 circulations, just can detect 0.5 cell and 10pg genomic dna, have a good application prospect in algae evaluation field.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Embodiment 1
The drafting of typical curve
(1) pre-treatment of algae liquid
The prorocentrum minimum algae liquid that grows into logarithmic phase is contrasted little algae (chain Alexander algae with other, the different cap algae of ring-type, the triumphant human relations algae of Michaelis, short triumphant human relations algae, Chaetoceros) algae liquid, centrifugal collecting cell carries out microscopic counting, and then with resuspended after PBS (PH7.0) the damping fluid washed twice, making density is 2.5 * 10
8The pending algae liquid of cell/L;
(2) fluorescence quantification PCR primer design and specificity checking
Compare from GenBank acquisition prorocentrum minimum ITS sequence and with the corresponding sequence of other little algaes, select in the ITS zone and other little algae ITS1 district that there were significant differences, design the fluorescent quantitation primer that is suitable for SYBRGreen I method with Primer Express 3.0, primer sequence is:
PM-1iF:CCCCCATGCAGAGACTCAA,
PM-1iR:CAGCAAGGACAGGCACAGAA;
To design among primer and the GenBank sequence and carry out the Blast comparison, the design primer, optimize primer concentration, select the primer final concentration of 200nmol/L then, with the specificity of other contrast algaes as contrast checking primer, respectively the broken algae liquid of algae of the same race is not carried out fluorescent quantitative PCR, amplification shows that the sample that contains prorocentrum minimum DNA has amplification, and other contrast little algae sample does not have amplification;
(3) sensitivity detects
Get the pending prorocentrum minimum algae of the 10mL that obtains in (1) liquid in the 50mL centrifuge tube, carry out ultrasonication (power 200W, ultrasonic time 3 seconds, 3 seconds pitch times) in ice bath, microscopic examination all is broken until all cells; Algae liquid is pressed 1: 10 times of dilution (from 5000 cell to 0.5 cells), 5 extent of dilution, 3 repetitions of each extent of dilution; Carry out fluorescent quantitative PCR then, 94 ℃ of 10min of amplification condition, 94 ℃ of 15s, 60 ℃ of 1min, 40 circulations.
Get standard regression equation: y=-3.277x+43.708 according to the result, wherein x is a cell count, and y is C
TValue;
Extract the prorocentrum minimum genomic dna with the CTAB method, surveying the original DNA initial concentration with Biophometre (German Eppendof company) is 50ng/ μ L, genomic dna is diluted (from 100ng to 10fg) according to 1: 10 times, 7 extent of dilution, 3 repetitions of each extent of dilution finally detect 10pg DNA.
Embodiment 2
Adopt the method for embodiment 1 that prorocentrum minimum algae liquid to be measured is divided into 6 different concns groups, get 3mL prorocentrum minimum algae liquid respectively, at first count with microscope, get 10mL algae liquid again, centrifugal collecting cell, and resuspended with the 10mL aseptic deionized water, and ultrasonic wave is carried out fragmentation to sample.Carry out fluorescent quantitative PCR then, according to the C of each sample gained
TValue calculates cell quantity according to standard equation.Each sample detection is set 3 parallel sample, and the result is as shown in table 1, and as can be seen from Table 1, quantitative fluorescent PCR quantitative result and microscopic counting be basically identical as a result.
Table 1 microscopic counting and Real-time round pcr count results are relatively
Claims (3)
1. the method for a fluorescence quantitative PCR detection prorocentrum minimum comprises:
(1) pre-treatment of algae liquid
Extract the sample algae liquid in the marine site, centrifugal collecting cell is used after the PBS damping fluid washed twice of pH 7.0 resuspendedly then, and making density is 2.5 * 10
8The pending algae liquid of cell/L;
(2) fluorescence quantification PCR primer and concentration optimization
The fluorescent quantitation primer sequence of SYBR method is:
PM-1iF:CCCCCATGCAGAGACTCAA,
PM-1iR:CAGCAAGGACAGGCACAGAA;
The primer final concentration is: 200nmol/L;
(3) number of cells of prorocentrum minimum and genomic dna detect
Get the pending algae liquid that obtains in the step (1) in centrifuge tube, in ice bath, carry out ultrasonication, microscopic examination all is broken until all cells, algae liquid is pressed 1: 10 times of dilution, 5 extent of dilution, each extent of dilution repeats 3 times, carries out fluorescent quantitative PCR then, and the extension increasing sequence of prorocentrum minimum DNA is as follows:
Cccccatgcagagactcaagggcagcaagccaggctcagaccgtcttctgtgcctg tccttgctg, length 65bp.
According to regression equation, calculate the number of cells of prorocentrum minimum then;
Extract the prorocentrum minimum genomic dna with the CTAB method, adopt Biophometre to detect the original DNA initial concentration, then genomic dna is carried out 1: 10 times of dilution, do 7 extent of dilution, as the fluorescent quantitation template, each extent of dilution repeats 3 times, finally detects dna content.
2. the method for a kind of fluorescence quantitative PCR detection prorocentrum minimum according to claim 1 is characterized in that: the ultrasonication in the described step (3) is ultrasonic power 200W, ultrasonic time 3 seconds, 3 seconds pitch times.
3. the method for a kind of fluorescence quantitative PCR detection prorocentrum minimum according to claim 1 is characterized in that: the fluorescent quantitative PCR program in the described step (3) is: 94 ℃ of 10min, 94 ℃ of 15s, 60 ℃ of 1min, 40 circulations; 94 ℃ of 15s of solubility curve, 60 ℃ of 1min, 94 ℃ of 15s, amplification system is 20 μ L systems, 2 μ L genomic dnas, 10 μ L, 2 * Power SYBR Green Mater mix, primer PM-1iF and PM-1iR (initial concentration is 10 μ M) 0.4 μ L (the primer final concentration is 200nmol/L), 7.2 μ L ddH
2O.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009101982586A CN101906467B (en) | 2009-11-03 | 2009-11-03 | Fluorescent quantitative PCR method for detecting prorocentrum minimum |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009101982586A CN101906467B (en) | 2009-11-03 | 2009-11-03 | Fluorescent quantitative PCR method for detecting prorocentrum minimum |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101906467A true CN101906467A (en) | 2010-12-08 |
CN101906467B CN101906467B (en) | 2012-07-18 |
Family
ID=43262051
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009101982586A Expired - Fee Related CN101906467B (en) | 2009-11-03 | 2009-11-03 | Fluorescent quantitative PCR method for detecting prorocentrum minimum |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101906467B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102115779A (en) * | 2010-12-09 | 2011-07-06 | 中国海洋大学 | Detection method used for detecting variety and quantity of red tide algae |
CN102433390A (en) * | 2012-01-09 | 2012-05-02 | 上海海洋大学 | Method for detecting Prorocentrum lima |
CN107523613A (en) * | 2016-11-17 | 2017-12-29 | 国家海洋局南海环境监测中心 | The method of single dinoflagellate cysts Molecular Identification |
CN112980937A (en) * | 2021-03-17 | 2021-06-18 | 自然资源部第二海洋研究所 | Harmful algal bloom molecule rapid detection method based on high-throughput sequencing |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101216416A (en) * | 2008-01-17 | 2008-07-09 | 上海交通大学 | Real time fluorescent quantitative PCR detection method for blue algae producing microcystic toxins |
-
2009
- 2009-11-03 CN CN2009101982586A patent/CN101906467B/en not_active Expired - Fee Related
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102115779A (en) * | 2010-12-09 | 2011-07-06 | 中国海洋大学 | Detection method used for detecting variety and quantity of red tide algae |
CN102115779B (en) * | 2010-12-09 | 2013-05-08 | 中国海洋大学 | Detection method used for detecting variety and quantity of red tide algae |
CN102433390A (en) * | 2012-01-09 | 2012-05-02 | 上海海洋大学 | Method for detecting Prorocentrum lima |
CN102433390B (en) * | 2012-01-09 | 2013-08-07 | 上海海洋大学 | Method for detecting Prorocentrum lima |
CN107523613A (en) * | 2016-11-17 | 2017-12-29 | 国家海洋局南海环境监测中心 | The method of single dinoflagellate cysts Molecular Identification |
CN112980937A (en) * | 2021-03-17 | 2021-06-18 | 自然资源部第二海洋研究所 | Harmful algal bloom molecule rapid detection method based on high-throughput sequencing |
Also Published As
Publication number | Publication date |
---|---|
CN101906467B (en) | 2012-07-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102154503B (en) | Method for detecting DNA (deoxyribonucleic acid) content of CHO (cholesterol) cells by probe | |
CN103361439B (en) | Method for integrated detection of nine beer-spoilage bacteria | |
CN101906467B (en) | Fluorescent quantitative PCR method for detecting prorocentrum minimum | |
CN103866034A (en) | Multiple real-time fluorescence quantification PCR (polymerase chain reaction) detection kit and detection method for helicobacter pylori in gastric juice | |
CN104561333B (en) | The method of the green damp waterside liverwort algae of a kind of Rapid identification | |
CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
CN104561281A (en) | Brown tide algae species detection method and kit | |
CN104480202A (en) | Towel gourd reference gene and application thereof | |
CN103074428B (en) | A kind of mycobacterium tuberculosis TB detection kits | |
CN104673926A (en) | Pine wood nematode PCR (polymerase chain reaction) detection kit and detection method thereof | |
CN101368203A (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
CN102121042A (en) | Method for identifying pathogenic bacteria of drinking water by using surface enhanced Raman spectroscopy | |
CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
CN102676678B (en) | PCR (Polymerase Chain Reaction) primer group for distinguishing five types of shellfish bait microalgae | |
CN102417931B (en) | Polymerase chain reaction (PCR) fluorescence detection kit and detection method for candida albicans | |
CN102002537A (en) | Reagent assisting in identifying sowbane mosaic virus (SoMV) and application thereof | |
CN101768632B (en) | Method for detecting aspergillus by polymerase chain reaction | |
CN102392077B (en) | Primer sequence for detecting concentration of toxic Microcystis aeruginosa in water and method thereof | |
CN1699598A (en) | Probe and method for detecting red naked dinoflagellate | |
CN103540677B (en) | Primer and kit for real-time fluorescence quantification PCR (Polymerase Chain Reaction) detection of chlamydophila abortus Taqman-MGB (Minor Groove Binder) probe as well as detection method | |
CN103173555B (en) | Proteusbacillus vulgaris multi-serotype strain specific primer and multiple polymerase chain reaction (PCR) detection method | |
CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
Liu et al. | Simultaneous detection of enteric bacteria from surface waters by QPCR in comparison with conventional bacterial indicators | |
CN104673927A (en) | Pseudomonas aeruginosa PCR (polymerase chain reaction) detection kit and detection method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120718 Termination date: 20121103 |