CN101899460B - Method for preparing fusion protein capable of lowering food allergen reaction - Google Patents
Method for preparing fusion protein capable of lowering food allergen reaction Download PDFInfo
- Publication number
- CN101899460B CN101899460B CN 201010113940 CN201010113940A CN101899460B CN 101899460 B CN101899460 B CN 101899460B CN 201010113940 CN201010113940 CN 201010113940 CN 201010113940 A CN201010113940 A CN 201010113940A CN 101899460 B CN101899460 B CN 101899460B
- Authority
- CN
- China
- Prior art keywords
- antrx
- antrxr
- sequence
- gene
- fusion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for preparing fusion protein capable of lowering food allergen reaction, comprising the following steps: obtaining a thioredoxin gene Trx and a thioredoxin reductase gene TrxR in a thioredoxin system; designing a fusion peptide sequence; fusing the genes Trx and TrxR by the fusion peptide sequence; then, obtaining a recombination strain containing the fusion gene; and finally, carrying out heterology expression purification. The invention colons the genes of two proteins in an AnTrx system with wide application meaning in the industry and fuses and improves the genes of Trx and TrxR, and a disulfide bond in the food protein is reduced by incubating with the food protein so as to lower the allergen reaction thereof. Meanwhile, improvement by gene fusion causes An-TrxR and An-Trx to be convenient to apply in the food industry when An-TrxR and An-Trx serve as a food additive.
Description
Technical field
The invention belongs to biological technical field, relate to DNA recombinant technology and the application of technical field of bioengineering, be specifically related to a kind of utilize genetic engineering technique obtain corresponding bioprotein reduce food allergy method.
Background technology
Allergy is a ubiquitous problem from all parts of the world, and food anaphylaxis is a kind of of anaphylactic disease, and is the inducement of severe allergy disease.The epidemiological study demonstration, approximately 33% anaphylaxis is brought out by food, and food anaphylaxis has become important food-safety problem, has caused widely to pay close attention to.According to epidemiology survey, approximately there is 2%～2.5% people (6,000,000～7,000,000) to live through food anaphylaxis in the U.S., infant's incidence approximately 4%～6%, children and adult be 1%-2% approximately.In Britain, the incidence adult of food anaphylaxis reaction is 1.4%～1.9%, and children account for 5%.Nearly 1,000 ten thousand people's morbidities, wherein 1,000,000 people react serious.Holland white people food anaphylaxis incidence adult is 1.4%, and children are 5%～7%.Children's hospital of Medical University Of Chongqing carried out the food anaphylaxis epidemiological survey to 314 children below 2 years old in 1 year, the food anaphylaxis sickness rate of making a definite diagnosis is 5.2%.
Food anaphylaxis has two types: a kind of is type Ⅰ hypersensitivity reaction, shows as to have eaten to cause in irritated food 2h urticaria, blood urine, asthma attack etc. to occur.Serious anaphylaxis is accompanied by expiratory dyspnea, severe patient can collapse shock, even threat to life.Along with increasing of food variety, anaphylactic disease is lasting ascendant trend in recent years.
At present, various types of food anaphylaxiies do not have specifics, and unique effective measure for the treatment of are strictly to avoid the absorption of specific food antigen.Simultaneously, of a great variety due to food, area, season, individual food habits are all different, thereby treatment and diagnosis bring difficulty.Simultaneously, although be not that all protein all can cause allergy, in food, 90% anaphylactogen is protein, thereby the important channel of prevention food anaphylaxis is the protein allergy in prevention food.The food anaphylaxis that most protein causes is the disulfide linkage due to protein interior.Therefore the disulfide bond reduction in albumen can be reduced the allergenicity in food.Thioredoxin system in organism can be gone back the disulfide linkage of crude protein.The Trx system extensively exists in organism, is the albumen system of reduction potential in another maintenance cell except the gsh system.Complete thioredoxin system comprises Trx (Trx) thioredoxin reductase (TrxR) and Reduced nicotinamide-adenine dinucleotide (NADPH).Wherein Trx is the small molecular protein of a kind of 12-13kD, contains a conservative active region (WCGPC), and reduced form Trx has important effect on cellular oxidation reduction adjusting and anti-oxidative defense.Thioredoxin reductase is the dimer enzyme that is full of the FAD structural domain that a kind of NADPH relies on, and belongs to pyridine nucleotide-disulphide oxydo-reductase family member, and it keeps the reduced form of Trx in system.Under the existence of NADPH, Trx is reduced by thioredoxin reductase, and then, the Trx that is reduced then removes the disulfide linkage in restore target albumen.Existing studies have shown that, the Trx system in intestinal bacteria beta-lactoglobulin and the wheat gliadin in can reconstituted milk, the albumen after reduction is proved to be and has effectively reduced allergenicity.But this kind albumen system not yet drops into application as foodstuff additive in foodstuffs industry, simultaneously, contain two kinds of albumen in the Trx system, and inconvenience is arranged in actually operating more.
The filamentous fungus aspergillus niger is a kind of important industrial microorganism and pattern fungi, and its genome total order is announced, and it is widely used in fermentation industry, for the production of citric acid and various industrial enzymes.In the bioprocess of further Development and Production fuels and chemicals, aspergillus niger is an omnipotent cell factory, because it can tolerate low pH value, can utilize carbon source widely, and relatively high transformation efficiency is arranged.And as the Trx system of one of cell two large antioxidant system, in the fermentation of Aspergillus niger process, in the tolerance to unfavourable condition, play very large effect.
Research finds, has the natural connection peptides that is comprised of 22 amino acid (Wieles et al., 1995 between the TrxR in Mycobacterium leprae (Mycobacterium leprae) and Trx; Wang et al., 1998) enzyme that, can be used for other microorganism Trx system merges.In recent years, the development of protein fusion technology is day by day perfect, and is widely used in obtaining the antibody of difunctional or multi-functional protein or specific function.Based on join end to end fusion method (Horton et al., 1989 of the gene of overlapping extension (splicing-by-overlap extension, SOE); Lu et al., 2006), the present structure that often is used to fusion rotein, its advantage is to introduce any extra amino-acid residue, also need not closure is identified.
Therefore, utilize that Trx system in aspergillus niger is researched and developed efficiently, foodstuff additive easily, most important for the allergenicity that reduces processed food, improve and seek suitable Trx system, be the important way that advances this research.
Summary of the invention
The object of the present invention is to provide a kind of method for preparing the fusion rotein that reduces the food allergen reaction, it utilizes SOE (splicing-by-overlap extension, based on overlapping extension) method obtains containing the antigen-4 fusion protein gene of aspergillus niger thioredoxin gene and thioredoxin reductase gene, further obtain containing again the recombinant bacterial strain of fusion gene, by gene is both merged improvement, and by with food in the hatching with the disulfide linkage in reductive food albumen of albumen, thereby reduce the food allergens reaction.The present invention by the following technical solutions for this reason: it comprises the following steps: the acquisition of thioredoxin gene Trx and thioredoxin reductase gene TrxR in the Trx system, design warm peptide sequence, utilize the fusogenic peptide sequence that gene Trx and TrxR are merged, then obtain to contain the recombinant bacterial strain of fusion gene, carry out at last the heterogenous expression purifying.
Technical scheme of the present invention specifically realizes by following steps successively:
(1) acquisition of Trx system genes involved
According to the aspergillus niger Trx of Dutch DSM company report and the doubtful gene order of thioredoxin reductase, amplify respectively An-TrxR and An-Trx with PCR method from the aspergillus niger genome.And according to the primer of gene order design with restriction enzyme site NdeI and HindIII.
(2) design warm peptide sequence
According to the protein structure of thioredoxin reductase and Trx, design fusogenic peptide sequence (Link A, LinkB).Link A is according to the natural connection peptides gene order design of the TrxR in Mycobacterium leprae (Mycobacterium leprae) and the 22aa between Trx.Link B is the flexible peptide (GGGGS) of artificial design
3
(3) contain the structure of the recombinant bacterial strain of Trx system fusion gene
Utilize the SOE method with Link A and Link B, An-TrxR and An-Trx sequence to be merged respectively.Cut respectively product and the plasmid Pet-29b of fusion gene with restriction endonuclease NdeI and HindIII.Fusion sequence is connected with plasmid.And change in Host Strains BL21 and express.
(4) heterogenous expression purifying
Utilize 6 that Pet29b contains histidine-tagged, by the affinity chromatography sulfur purification oxygen fusion rotein of albumen system also.
The characteristics of the higher anti-adversity ability that the present invention has according to aspergillus niger, utilize the Trx system can Reduction of Disulfide, and the disulfide linkage in albumen is this principle that causes the major cause of food anaphylaxis, utilize the SOE method that the Trx in the Trx system (Trx) and thioredoxin reductase (TrxR) are merged, to reduce albumen allergenic response in food.
The invention has the advantages that, it will have the gene clone of two albumen of the AnTrx system of widespread use meaning in industry, and gene that will be both merges improvement, by with food in the hatching with the disulfide linkage in reductive food albumen of albumen, thereby reduce its allergenic response.Simultaneously, the improvement by gene fusion makes An-TrxR and An-Trx as a kind of foodstuff additive the time, obtains easy on food industry applications.
Description of drawings
Fig. 1 is the SDS-PAGE collection of illustrative plates after parent AnTrx/AnTrxR and RMT, TMR in the present invention, RGT, four kinds of expressing fusion proteins of TGR, M: molecular weight marker.
Fig. 2 is in the present invention under room temperature in DTT reduction AnTrx and fusion rotein after the AnTrx part, activity (OD650) figure of its reduction Sigma I8405.
The left figure of Fig. 3 is parent's albumen in the present invention (AnTrx, AnTrxR) and fusion rotein RMT and the RGT reduction to the gliadine disulfide linkage, utilize after mBBr mark reduction sulfydryl and after the SDS-PAGE electrophoresis fluorescence developing figure, right figure swimming lane 4～8 is identical with left figure, but dyes through Kao Masi light blue R250.
Embodiment
A kind of method for preparing the fusion rotein that reduces the food allergen reaction of the present invention comprises the following steps successively:
1.AnTrx gene cloning
(1) find the relevant sequence number (CAK43619) of class aspergillus niger Trx in aspergillus niger (A.niger) genome from NCBI.
(2) extraction of the total DNA of bacterial strain: inoculated aspergillus niger (Aspergillus niger) 3.4523 bacterial strain spore suspensions after cultivating 3 days under 25 ℃, extract total DNA by the liquid nitrogen grinding method to potato culture PDA flat board.
(3) design pair of primers, obtain containing the AnTrx sequence of intron from the aspergillus niger genome.
Forward primer: AACACCCATATGTCTCACAAGGTTCACG (the 1st sequence in sequence table)
Reverse primer: TGGAAGCTTTGCAAGCAGAGCCTGG (the 2nd sequence in sequence table)
Take the aspergillus niger genome as template, amplification contains the fragment (456bp) of the AnTrx of intron.PCR adopts 50 μ l systems, comprises 50ng aspergillus niger genome, 0.2 μ M primer, 0.2mM dNTP, 2.5mMMgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 45s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 456bp, and rubber tapping is reclaimed, and is connected with the pGEMT-easy carrier, and the sample presentation order-checking, determine that the sequence that obtains is the Trx sequence that contains intron after transforming and identifying.
(4) design pair of primers utilizes gene overlap extension method (SOE) method to obtain the AnTrx gene order of intronless.
Forward primer:
ATCATATGTCTCACAAGGTTCAC GACATCACCTCTAAGGCCGAGTTCGCCGAGA (the 3rd sequence in sequence table)
Reverse primer: TGGAAGCTTTGCAAGCAGAGCCTGG (the 4th sequence in sequence table)
Utilize this primer to obtain the AnTrx sequence of intronless from the AnTrx sequence that contains intron that has obtained.
The amplification of the AnTrx fragment of intronless: take the AnTrx genome that contains intron as template, the Partial Fragment (324bp) of amplification intronless.PCR adopts 50 μ l systems, comprises that 50ng contains the AnTrxDNA of intron, 0.2 μ M primer, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5Utaq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 45s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 308bp, and rubber tapping is reclaimed, and is connected with the pGEMT-easy carrier, and the sample presentation order-checking, determine that the sequence that obtains is the Trx sequence of intronless after transforming and identifying.
2.AnTrxR gene cloning
(1) find the relevant sequence number (CAK43946) of class aspergillus niger Trx in aspergillus niger (A.niger) genome from NCBI.
(2) extraction of the total DNA of bacterial strain: inoculated aspergillus niger (Aspergillus niger) 3.4523 bacterial strain spore suspensions after cultivating 3 days under 25 ℃, extract total DNA by the liquid nitrogen grinding method to potato culture PDA flat board.
(3) design primer, obtain containing the AnTrxR sequence of intron from the aspergillus niger genome.
Forward primer: AACACCCATATGTCTCACAAGGTTCACG (the 5th sequence in sequence table)
Reverse primer: TGGAAGCTTTGCAAGCAGAGCCTGG (the 6th sequence in sequence table)
Contain the amplification of the AnTrxR fragment of intron: take the aspergillus niger genome as template: PCR adopts 50 μ l systems, comprises that 50ng contains the aspergillus niger genomic dna of intron, 0.2 μ M primer, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 60s and 72 ℃ extend 30s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 1240bp.
(4) utilize gene overlap extension method (SOE) method to obtain the AnTrxR gene order of intronless
Amplification obtains the AnTrxR sequence of intronless from the AnTrxR sequence that contains intron that has obtained, owing to containing two introns in whole gene order, therefore the Partial Fragment a1 and the b1 that are divided into two sections amplification intronlesses, need design a, b, three pairs of primers of c, obtain removing the fragment of First Intron with primer a group, obtain removing the fragment of second intron with primer b group, resulting that two sheet degree have mutually overlapping part, recycling primer c organizes, and obtains the AnTrxR gene of intronless after two overlapping zones are merged.
Primer a group:
Forward primer:
ATAGCTCTCATATGGTGCACACCAACGTCGTTATCATCGGCTCCGGCCCCGCCGCC CACA (the 7th sequence in sequence table)
Reverse primer: CAATGCAGCCGGATCCGGCACTGGTGATGGCCTGGC (the 8th sequence in sequence table)
Primer b group:
Forward primer: GCCATCACCAGTGCCGGATCCGGCTGCATTGCCGCTC (the 9th sequence in sequence table)
Reverse primer: TGGAAGCTTTGCAAGCAGAGCCTGG (the 10th sequence in sequence table)
Primer c group:
Forward primer: AACACCCATATGTCTCACAAGGTTCACG (the 11st sequence in sequence table)
Reverse primer: TGGAAGCTTTGCAAGCAGAGCCTGG (the 12nd sequence in sequence table)
The amplification of the AnTrxR fragment of intronless: take the AnTrxR genome that contains intron as template, because two introns are contained in the centre, therefore be divided into Partial Fragment a1 and the b1 of two sections amplification intronlesses.
1. the amplification of fragment a1: PCR adopts 50 μ l systems, comprises that 50ng contains the AnTrx DNA of intron, 0.2 μ M primer a group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 60s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 937bp.
2. the amplification of fragment b1: PCR adopts 50 μ l systems, comprises that 50ng contains the AnTrx DNA of intron, 0.2 μ M primer b group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 30s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 195bp, and rubber tapping obtains two fragments after reclaiming.
3. again carry out pcr amplification, PCR adopts 50 μ l systems, comprises DNA, the DNA of 25ng b fragment, 0.2 μ M primer c group, 0.2mM dNTP, the 2.5mM MgCl of 25ng a fragment
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 60s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of bp.Be connected with the pGEMT-easy carrier, the sample presentation order-checking, determine that the sequence that obtains is the Trx sequence of intronless after transforming and identifying.
3. connect the gene order of the connection peptides of AnTrxR gene and AnTrx gene
The gene order of connection peptides is respectively Link A and Link B, Link A is that Link B be the flexible peptide (GGGGS) that manually designs according to the natural connection peptides gene order design of the TrxR in Mycobacterium leprae (Mycobacterium leprae) and the 22aa between Trx
3
Take primer sets A1-A3 as example, at first utilize the A1 group, the end of AnTrxR gene order is added part first half fusogenic peptide sequence LinkerA, recycling A2 group is added latter half fusogenic peptide LinkerA sequence with the front end of AnTrx gene, and the fusogenic peptide sequence of the front terminal sequence of AnTrx and the AnTrxR end of front is slightly overlapping.Utilize afterwards overlapping extension, SOE method namely with the primer of A3 group, contains two of obtaining previously and links together after the AnTrxR of fusogenic peptide sequence and AnTrx merge, and obtains the fusion rotein sequence of fusogenic peptide LinkerA in addition.
The principle of design primer sets B1-B3, C1-C3, D1-D3 is identical with design primer sets A1-A3.
①Linker A：
GCTAACGAAACAACAGAGGAAACTGGAGACGTTGACAGTACCGACACAACCGATTG GAGCACTGCG (the 13rd sequence in sequence table)
②LinkerB：
GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATC (the 14th sequence in sequence table)
3. utilize the overlapping extension of SOE method to obtain fusion sequence.
The design primer:
A1：
Forward primer:
AACACCCATATGTCTCACAAGGTTCACG (the 15th sequence in sequence table)
Reverse primer:
GTCGGTACTGTCAACGTCTCCAGTTTCCTCTGTTGTTTCGTTAGCAAGCAGAGGGT TGGACTTGTA (the 16th sequence in sequence table)
A2：
Forward primer:
ACTGGAGACGTTGACAGTACCGACACAACCGATTGGAGCACTGCGATGTCTCACAA GGTTCACGACA (the 17th sequence in sequence table)
Reverse primer:
TGGAAGCTTTGCAAGCAGAGCCTGG (the 18th sequence in sequence table)
A3：
Forward primer:
AACACCCATATGTCTCACAAGGTTCACG (the 19th sequence in sequence table)
Reverse primer:
TGGAAGCTTTGCAAGCAGAGCCTGG (the 20th sequence in sequence table)
B1：
Forward primer:
ACTGGAGACGTTGACAGTACCGACACAACCGATTGGAGCACTGCGATGGTGCACAC CAACGTCGTTA (the 21st sequence in sequence table)
Reverse primer:
TGGAAGCTTTGCAAGCAGAGCCTGG (the 22nd sequence in sequence table)
B2：
Forward primer:
AACACCCATATGTCTCACAAGGTTCACG (the 23rd sequence in sequence table)
Reverse primer:
GTCGGTACTGTCAACGTCTCCAGTTTCCTCTGTTGTTTCGTTAGCTGCAAGCAGAG CCTGGATCTTC (the 24th sequence in sequence table)
B3：
Forward primer:
AACACCCATATGTCTCACAAGGTTCACG (the 25th sequence in sequence table)
Reverse primer:
TGGAAGCTTTGCAAGCAGAGCCTGG (the 26th sequence in sequence table)
C1：
Forward primer:
AACACCCATATGTCTCACAAGGTTCACG (the 27th sequence in sequence table)
Reverse primer:
CCACCCGACCCACCACCGCCCGAGCCACCGCCACCAAGCAGAGGGTTGGACTTGTA (the 28th sequence in sequence table)
C2：
Forward primer:
GCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCCATGTCTCACAAGGTTCACGA (the 29th sequence in sequence table)
Reverse primer:
TGGAAGCTTTGCAAGCAGAGCCTGG (the 30th sequence in sequence table)
C3：
Forward primer:
AACACCCATATGTCTCACAAGGTTCACG (the 31st sequence in sequence table)
Reverse primer:
TGGAAGCTTTGCAAGCAGAGCCTGG (the 32nd sequence in sequence table)
D1：
Forward primer:
GCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCCATGGTGCACACCAACGTCGTT A (the 33rd sequence in sequence table)
Reverse primer:
TGGAAGCTTTGCAAGCAGAGCCTGG (the 34th sequence in sequence table)
D2：
Forward primer:
AACACCCATATGTCTCACAAGGTTCACG (the 35th sequence in sequence table)
Reverse primer:
CCACCCGACCCACCACCGCCCGAGCCACCGCCACCTGCAAGCAGAGCCTGGATCTT C (the 36th sequence in sequence table)
D3：
Forward primer:
AACACCCATATGTCTCACAAGGTTCACG (the 37th sequence in sequence table)
Reverse primer:
TGGAAGCTTTGCAAGCAGAGCCTGG (the 38th sequence in sequence table)
4. take the AnTrx that obtained and AnTrxR gene order as template, the clone obtains containing the gene fragment of part connection peptides sequence respectively, then both are merged.
Protein fusion technology comprises that end to end fusion (end-to-end fusion) and insert merge (insertion fusion), protein groups branch after fusion strengthens or weakens activity (Trujillo et al., 1997) separately because of interaction.Therefore, protein merges needs to select suitable connection peptides and integration technology to be optimized, and the protein ingredient forward of fusion is done mutually.
Design following RMT, TMR, RGT, four kinds of fusion genes of TGR are because connect reversedly AnTrxR gene and AnTrx gene in the first place respectively with two kinds of fusogenic peptides, with two kinds of fusogenic peptides be for the impact of investigating any catalytic efficiency on fusion rotein of these two kinds of fusogenic peptides more better, the first connection reversedly is because whether want to investigate AnTrxR holds and change to some extent in the activity that the C end merges at N, and whether AnTrx changes to some extent at the N end with in the activity that C holds.Simultaneously, for whole AnTrx system, also want by designing this four kinds of fusion roteins, actually or want to understand system enzyme that AnTrxR the is placed on fusion rotein N end high system enzyme that AnTrxR is placed on fusion rotein C end of living and live high.
(1) acquisition of fusion gene RMT (connecting AnTrxR and AnTrx with LinkerA):
1. end contains the acquisition of gene (M1) sequence of the AnTrxR of connection peptides sequence: take the AnTrxR genome that do not contain intron as template, PCR adopts 50 μ l systems, comprises that 50ng does not contain the AnTrxRDNA of intron, 0.2 μ M primer A1 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 60s; Circulate rear 72 ℃ and extend again 7min.
2. head end contains the acquisition of the gene (M2) of the AnTrx of connection peptides sequence: take the AnTrx genome that do not contain intron as template, PCR adopts 50 μ l systems, comprises that 50ng does not contain the AnTrxR DNA of intron, 0.2 μ M primer A2 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5Utaq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 30s; Circulate rear 72 ℃ and extend again 7min.
3. the acquisition of RMT: M1, M2 are merged respectively: take M1 and M2 gene as template, PCR adopts 50 μ l systems, comprises 25ngM1 and 25ng M2,0.2 μ M primer A3 group, 0.2mM dNTP, 2.5mMMgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 100s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 1494bp.
(2) acquisition of fusion gene TMR (connecting AnTrx and AnTrxR with LinkerA):
1. head end contains the acquisition of the gene (M1 ') of the AnTrxR of connection peptides sequence: take the AnTrxR genome that do not contain intron as template, PCR adopts 50 μ l systems, comprises that 50ng does not contain the AnTrxRDNA of intron, 0.2 μ M primer B1 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 60s; Circulate rear 72 ℃ and extend again 7min.
2. end contains the acquisition of gene (the M2 ') sequence of the AnTrx of connection peptides sequence: take the AnTrx genome that do not contain intron as template, PCR adopts 50 μ l systems, comprises that 50ng does not contain the AnTrxDNA of intron, 0.2 μ M primer B2 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 30s; Circulate rear 72 ℃ and extend again 7min.
3. the acquisition of TMR: M1 ', M2 ' are merged respectively: take M1 ' and M2 ' gene as template, PCR adopts 50 μ l systems, comprises 25ng M1 ' and 25ng M2 ', 0.2 μ M primer B3 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 100s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 1494bp.
(3) acquisition of fusion gene RGT (Linker B connects AnTrxR and AnTrx):
1. end contains the acquisition of gene (G1) sequence of the AnTrxR of connection peptides sequence: take the AnTrxR genome that do not contain intron as template, PCR adopts 50 μ l systems, comprises that 50ng does not contain the AnTrxRDNA of intron, 0.2 μ M primer C1 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 60s; Circulate rear 72 ℃ and extend again 7min.
2. head end contains the acquisition of the gene (G2) of the AnTrx of connection peptides sequence: take the AnTrx genome that do not contain intron as template, PCR adopts 50 μ l systems, comprises that 50ng does not contain the AnTrxR DNA of intron, 0.2 μ M primer C2 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5Utaq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 30s; Circulate rear 72 ℃ and extend again 7min.
3. the acquisition of RGT: G1, G2 are merged respectively: take G1 and G2 gene as template, PCR adopts 50 μ l systems, comprises 25ng G1 and 25ng G2,0.2 μ M primer B3 group, 0.2mM dNTP, 2.5mMMgCl
21 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 100s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 1467bp.
(4) acquisition of fusion gene TGR (LinkerB connects AnTrx and AnTrxR):
1. head end contains the acquisition of the gene (G1 ') of the AnTrxR of connection peptides sequence: take the AnTrxR genome that do not contain intron as template, PCR adopts 50 μ l systems, comprises that 50ng does not contain the AnTrxR DNA of intron, 0.2 μ M primer D1 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5Utaq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 60s; Circulate rear 72 ℃ and extend again 7min.
2. end contains the acquisition of gene (the G2 ') sequence of the AnTrx of connection peptides sequence: take the AnTrx genome that do not contain intron as template, PCR adopts 50 μ l systems, comprises that 50ng does not contain the AnTrxDNA of intron, 0.2 μ M primer D2 group, 0.2mM dNTP, 2.5mM MgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 30s; Circulate rear 72 ℃ and extend again 7min.
3. the acquisition of TGR: G1 ', G2 ' are merged respectively: take G1 ' and G2 ' gene as template, PCR adopts 50 μ l systems, comprises 25ng G1 ' and 25ng G2 ', 0.2 μ M primer D3 group, 0.2mM dNTP, 2.5mMMgCl
2, 1 * taq polymerase buffer and 1.5U taq polysaccharase and 1.5Upfu polysaccharase.First 94 ℃ of sex change 5min after mixing, this is by 35 circulations: 94 ℃ of sex change 30s, 65 ℃ of annealing 30s and 72 ℃ extend 100s; Circulate rear 72 ℃ and extend again 7min.Amplification obtains the fragment of 1467bp.
Use this method, obtain respectively fusion gene RMT, TMR, RGT, TGR.
5. the structure of prokaryotic expression carrier pET-AnTrx, pET-AnTrxR, pET-RMT, pET-TMR, pET-RGT, pET-TGR
PET-AnTrx builds: the AnTrx sequence that amplification obtains is inserted in prokaryotic expression carrier pET-29b+ after restriction enzyme NdeI and HindIII digestion, builds prokaryotic expression carrier pET-AnTrx.
The structure of pET-AnTrxR, pET-RMT, pET-TMR, pET-RGT, pET-TGR is the same.
6. the amplification of recombinant plasmid and target protein are expressed
Recombinant plasmid pET-AnTrx, pET-AnTrxR, pET-RMT, pET-TMR, pET-RGT, pET-TGR are transformed respectively intestinal bacteria E.coli DH5 α with the thermal shock conversion method, after the PCR evaluation of process bacterium colony and enzyme are cut evaluation and order-checking, extract positive colony Plasmid Transformation E.coli BL21 (DE3), be cultured to logarithmic phase (OD under 37 ℃, 150r/min condition
600=0.8), after then adding 0.5mM IPTG, the conversion bacterial strain that wherein contains plasmid pET-AnTrx, pET-AnTrxR inducing culture under 30 ℃ and 160r/min condition spends the night.The conversion bacterial strain that contains plasmid pET-RMT, pET-TMR, pET-RGT, pET-TGR inducing culture under 25 ℃ and 160r/min condition spends the night.
7. the soluble analysis of recombinant protein
Bacterium liquid by after inducing in centrifugal collection step 4 carries out the cell ultrasonication, and working procedure is for being ultrasonic time 15s, off time 15s and omnidistance time 20min.After 4 ℃ of centrifugal collection supernatants of lower 10000g, system analyzes with discontinuous sodium lauryl sulphate-polyacrylamide gel (SDS-PAGE) electrophoretic buffer.Get the 20 broken supernatant liquors of μ l, add 5.0 μ L 5 * sample-loading buffers [60mM Tris-HCl, pH 6.8; 25% (w/v) glycerine; 2% (w/v) SDS, 14.4mM beta-mercaptoethanol and 0.1% tetrabromophenol sulfonphthalein].In discontinuous gel, concentrated glue and resolving gel concentration are respectively 5% and 12.5%.The applied sample amount of each swimming lane is 15 μ L, carries out electrophoresis on HoeferminiVE vertical electrophoresis system (Amersham Pharmacia Biotech).The electric current of sample in concentrated glue keeps 12mA, and the electric current in separation gel keeps 18mA.After electrophoresis finishes.Gel dyes in staining fluid (1.20g examines horse and tears light blue R250,250mL ethanol, 80mL acetic acid and 670mL dd-H2O) and spends the night, and then decolouring in destainer (250mL ethanol, 80mL acetic acid and 670mL dd-H2O) is until background is colourless.
8. protein purification
With 6 * His label, can adopt Ni due to recombinant protein
2+Affinity chromatography is carried out purifying.
(1) get and induce rear bacterium liquid 50ml, 4 ℃ of centrifugal 10min of lower 5000r/min collect thalline, precipitation is suspended in 25ml Binding Buffer (50mM Tris-HCl, pH 7.8,500mM NaCl and 5mM imidazoles) in, ultrasonic disruption thalline under ice bath, 4 ℃ of centrifugal 25min of lower 12000r/min get 4 ℃ of supernatants and save backup.
(2) adopt
Purifier (GE Healthcare, Uppsala, Sweden) purification system carries out purifying to target protein.Before loading, use the Binding Buffer of 10 times of column volumes with the flow velocity balance nickel post of 5ml/min; Flow velocity is the 1ml/min loading, again with Binding Buffer 5-10 volume of flow velocity balance nickel post with 5ml/min; Gradient elution, with 5 column volumes of Elution Buffer wash-out of 10%, 20%, 30% and 100%, flow velocity is 5ml/min successively, carries out OD280 albumen absorption peak and collects elutriant.Collect elution peak by SDS-PAGE analyzing and testing purity.Find that at last AnTrx and the AnTrxR purity of protein after wash-out in 10%Elution Buffer is the highest, and the purity of fusion rotein albumen in the wash-out concentration of 20% Elution Buffer is the highest.
(3) SDS-PAGE identifies the purification part Sephadex that obtains
TMThe G-25 desalination.Fig. 1 is the SDS-PAGE collection of illustrative plates after AnTrx and AnTrxR single expression and amalgamation and expression in the present invention.(a) swimming lane 1～7 is respectively the cytoclasis liquid of empty carrier contrast and independent AnTrxR, AnTrx, RMT, TMR, RGT and the TGR that expresses.(b) collection of illustrative plates after swimming lane 2-7 expression product purifying in figure a.M: molecular weight marker.
9, the reconstruct of fusion rotein
Because AnTrxR contains coenzyme F AD, but its great expression in E.coli BL21 (DE3), and the purification step of back, make AnTrxR wherein partly be pheron, for reconstruct AnTrxR part, thereby carry out the determination of activity in later stage, AnTrxR, RMT, TMR, RGT and TGR and its coenzyme F AD (Sigma St.Louis, USA) are together hatched.The FAD concentrated solution is added in the fusion rotein solution that purifying has been crossed, and making its ultimate density is 5 times of protein concentration.Incubated in the dark the region between the heart and the diaphragm 20 minutes.Recycling HiTrap (GE Healthcare) desalting column is removed FAD and protein solution is converted to the phosphate buffered saline buffer of 0.1M, pH7.0 (Williams et.al., 1967;
Et.al., 2007)
10, the enzyme activity determination of AnTrx, AnTrxR and fusion rotein RMT RGT TMR TGR.
(1) activity of AnTrx part in the activity of use Nephelometric Determination AnTrx and fusion rotein.
Because Trx can be made free β chain become water-fast precipitation by Trx reducible Sigma I8405 α chain and the disulfide linkage between the β chain of dithiothreitol (DTT) (DTT) reduction and reduced form, measure the activity of AnTrx therefore adopt nephelometry (Holmgren, 1979).Prepare fresh Sigma I8405 reaction solution (1.25mg/mL Sigma I8405 .0.1M PBS, 2.0mM EDTA-Na
2, pH 7.0).10 μ L 200mM DTT are added in 100 μ L sample liquid, hatch 30min under room temperature, then join in 500 μ L Sigma I8405 reaction solutions, the final concentration of protein sample is 4 μ M.Measure the absorption light value of 650nm under room temperature, per minute is measured once, measures altogether 13 times.Enzyme activity was with the OD value representation of the 13rd minute.The results are shown in Figure 2.The curve that Fig. 2 shows for under room temperature in the present invention with after AnTrx part in DTT reduction AnTrx and fusion rotein, its reducing activity (OD to Sigma I8405
650).
Interpretation of result:
OD in the time of 13 minutes
650Reading:
AnTrx：0.046
TGR：0.04
TMR：0.035
RGT：0.024
RMT：0.0125
No matter AnTrx is merged at C end or N end, in fusion rotein, the catalytic activity of AnTrx part always reduces, in RMT and RGT, the catalytic activity of AnTrx part is respectively that in 27.1% and 52.1%, TMR of parent's protein-active and TGR, the catalytic activity with a part is respectively parent's 76.1% and 87.0%.Obviously, be in the catalytic activity of the AnTrx that merges white N end higher than the activity of the AnTrx that is in its C end.
(2) measure the activity of the AnTrxR part in AnTrxR and fusion rotein thereof with the DTNB reduction method
AnTrxR reduction DTNB (Sigma) (Arn é r et al., 1999 with single expression; Luthman ﹠amp; Holmgren, 1982).Reaction solution is 100mM phosphate buffered saline buffer (pH 7.0), contains 2 μ M AnTrxR.The reaction density variation range of DTNB is from 0.2～2mM.After reaction solution and DTNB mixing, adding final concentration is that 0.05mM NADPH (Roche, Shanghai, china) starts reaction.Utilize its absorption light value (OD at 412nm of spectrophotometric determination
412) change.Under the existence of NADPH, the DTNB of 1nmol is become the NTB of 2 μ mol by the AnTrxR reduction.Its enzyme unit definition of living: per minute discharges 2 μ molNTB and is defined as the enzyme unit (extinction coefficient epsilon of living
412nm=2 * 13.6mM
-1cm
-1).
Interpretation of result:
Kinetics Changshu after AnTrxR partial reduction DTNB in table 1:AnTrxR and fusion rotein.
Wherein in RMT and RGT, the catalytic efficiency of AnTrxR part is higher than parent AnTrxR, and in TMR and TGR, the catalytic efficiency of AnTrxR is lower than parent AnTrxR.Because AnTrxR is key enzyme in the reaction of the whole system the first step, and in TMR and RMT, the catalytic efficiency of AnTrxR part is too low, directly investigates parent (AnTrxR, AnTrx), RMT and RGT when therefore investigating in the back the reduction to the disulfide linkage of wheat gliadin.
Thus, the conclusion that obtains is that the general effect of two fusogenic peptides is more or less the same, and the catalytic efficiency of AnTrxR improves greatly when N holds when AnTrxR merges.Although the activity of the part of the AnTrx in fusion rotein RMT and RGT is lower slightly than the parent, but due to increasing substantially of the catalytic efficiency of the enzyme AnTrxR in the reaction of its first step, it can possess the activity of whole AnTrx system under the existence of NADPH, and also more easy on industrial application, be convenient to its whole industrial application of carrying out the back.
11, the reduction of wheat gliadin
Separate according to the different solvabilities of wheat protein and obtain gliadine.Wheat-flour 1g is dissolved among 5mL70% alcohol, sway under room temperature spend the night after 11,000 * g high speed centrifugation 20min.Collect supernatant liquor, and the postlyophilization that spends the night that at room temperature volatilizees, gliadine pulvis (Sun et al.2008) obtained.
The vitality test of different AnTrx system reducing gliadine disulfide linkage, all adopt 100 μ L reaction systems, contain 127.5 μ g gliadines and 5 μ L 6mM NADPH, the content of enzyme is RGT 20 μ g or the RMT 20 μ g of the independent AnTrx that expresses and each 10 μ g of AnTrxR or amalgamation and expression, and establish negative control (any enzyme sample to be measured in reaction system) and positive control (adding 20 μ L 0.05mM DTT in reaction system, the chemical reduction disulfide linkage).After each reaction solution is at room temperature hatched 3h, utilize sulfydryl specific fluorescence molecular probe (mBBr) to be combined principle (Buchanan et al., 1997 of developing the color afterwards with sulfydryl under fluorescence; Del Val et al., 1999), identify the degree that disulfide linkage is reduced, method is to add 8 μ L 30mM mBBr (Sigma) in 20 μ L prolamine solution, under room temperature, the dark 20min that places, then carry out SDS-PAGE electrophoresis and fluorescence developing analysis (the results are shown in Figure 3).
Fig. 3 provides through parent enzyme and the gliadine after merging the enzyme processing is reduced the fluorescence developing result of disulfide linkage after mBBr is combined.The swimming lane 1～3 of left figure: AnTrxR/AnTrx, the RMT, the RGT that are respectively after purifying add NADPH (not containing the dark albumen of alcohol).Swimming lane 4: only have wheat gliadin (not containing enzyme), negative control.Swimming lane 5: with the positive control of DTT reduction wheat gliadin.Swimming lane 6～8: AnTrxR/AnTrx, the RMT, the RGT that are respectively after purifying add NADPH and prolamine.Right figure swimming lane 4～8 is identical with left figure, but Kao Masi light blue R250 dyeing.Result shown in Figure 3 shows: the disulfide linkage that is rich in gliadine after by the DTT chemical reduction, demonstrates very strong brightness.In the situation that NADPH exists, after parent's albumin A nTrx/AnTrxR and fusion rotein RMT and RGT were hatched 3h with gliadine respectively, three's colored intensity difference was also obvious, but all is weaker than above-mentioned positive control.Explanation thus, parent's albumen and fusion rotein RMT, RGT are close to the reducing degree of gliadine disulfide linkage.
Sequence table
＜110〉Zhejiang University
＜120〉a kind of method for preparing the fusion rotein that reduces the food allergen reaction
<130>
<160>38
<170>PatentIn version 3.3
<210>1
<211>28
<212>DNA
＜213〉artificial sequence
<400>1
aacacccata tgtctcacaa ggttcacg 28
<210> 2
<211>25
<212>DNA
＜213〉artificial sequence
<400>2
tggaagcttt gcaagcagag cctgg 25
<210>3
<211>54
<212>DNA
＜213〉artificial sequence
<400>3
atcatatgtc tcacaaggtt cacgacatca cctctaaggc cgagttcgcc gaga 54
<210>4
<211>25
<212>DNA
＜213〉artificial sequence
<400>4
tggaagcttt gcaagcagag cctgg 25
<210>5
<211>28
<212>DNA
＜213〉artificial sequence
<400>5
aacacccata tgtctcacaa ggttcacg 28
<210>6
<211>25
<212>DNA
＜213〉artificial sequence
<400>6
tggaagcttt gcaagcagag cctgg 25
<210>7
<211>60
<212>DNA
＜213〉artificial sequence
<400>7
atagctctcatatggtgcac accaacgtcg ttatcatcgg ctccggcccc gccgcccaca 60
<210>8
<211>36
<212>DNA
＜213〉artificial sequence
<400>8
caatgcagcc ggatccggca ctggtgatgg cc tggc 36
<210>9
<211>37
<212>DNA
＜213〉artificial sequence
<400>9
gccatcacca gtgccggatc cggctgcatt gccgctc 37
<210>10
<211>25
<212>DNA
＜213〉artificial sequence
<400>10
tggaagcttt gcaagcagag cctgg 25
<210>11
<211>28
<212>DNA
＜213〉artificial sequence
<400>11
aacacccata tgtctcacaa ggttcacg 28
<210>12
<211>25
<212>DNA
＜213〉artificial sequence
<400>12
tggaagcttt gcaagcagag cctgg 25
<210>13
<211>66
<212>DNA
＜213〉artificial sequence
<400>13
gctaacgaaa caacagagga aactggagac gttgacagta ccgacacaac cgattggagc 60
actgcg 66
<210>14
<211>44
<212>DNA
＜213〉artificial sequence
<400>14
ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatc 44
<210>15
<211>28
<212>DNA
＜213〉artificial sequence
<400>15
aacacccata tgtctcacaa ggttcacg 28
<210>16
<211>66
<212>DNA
＜213〉artificial sequence
<400>16
gtcggtactg tcaacgtctc cagtttcctc tgttgtttcg ttagcaagca gagggttgga 60
cttgta 66
<210>17
<211>67
<212>DNA
＜213〉artificial sequence
<400>17
actggagacg ttgacagtac cgacacaacc gattggagca ctgcgatgtc tcacaaggtt 60
cacgaca 67
<210>18
<211>25
<212>DNA
＜213〉artificial sequence
<400>18
tggaagcttt gcaagcagag cctgg 25
<210>19
<211>28
<212>DNA
＜213〉artificial sequence
<400>19
aacacccata tgtctcacaa ggttcacg 28
<210>20
<211>25
<212>DNA
＜213〉artificial sequence
<400>20
tggaagcttt gcaagcagag cctgg 25
<210>21
<211>67
<212>DNA
＜213〉artificial sequence
<400>21
actggagacg ttgacagtac cgacacaacc gattggagca ctgcgatggt gcacaccaac 60
gtcgtta 67
<210>22
<211>25
<212>DNA
＜213〉artificial sequence
<400>22
tggaagcttt gcaagcagag cctgg 25
<210>23
<211>28
<212>DNA
＜213〉artificial sequence
<400>23
aacacccata tgtctcacaa ggttcacg 28
<210>24
<211>67
<212>DNA
＜213〉artificial sequence
<400>24
gtcggtactg tcaacgtctc cagtttcctc tgttgtttcg ttagctgcaa gcagagcctg 60
gatcttc 67
<210>25
<211>28
<212>DNA
＜213〉artificial sequence
<400>25
aacacccata tgtctcacaa ggttcacg 28
<210>26
<211>25
<212>DNA
＜213〉artificial sequence
<400>26
tggaagcttt gcaagcagag cctgg 25
<210>27
<211>28
<212>DNA
＜213〉artificial sequence
<400>27
aacacccata tgtctcacaa ggttcacg 28
<210>28
<211>56
<212>DNA
＜213〉artificial sequence
<400>28
ccacccgacc caccaccgcc cgagccaccg ccaccaagca gagggttgga cttgta 56
<210>29
<211>55
<212>DNA
＜213〉artificial sequence
<400>29
gctcgggcgg tggtgggtcg ggtggcggcg gatccatgtc tcacaaggtt cacga 55
<210>30
<211>25
<212>DNA
＜213〉artificial sequence
<400>30
tggaagcttt gcaagcagag cctgg 25
<210>31
<211>28
<212>DNA
＜213〉artificial sequence
<400>31
aacacccata tgtctcacaa ggttcacg 28
<210>32
<211>25
<212>DNA
＜213〉artificial sequence
<400>32
tggaagcttt gcaagcagag cctgg 25
<210>33
<211>56
<212>DNA
＜213〉artificial sequence
<400>33
gctcgggcgg tggtgggtcg ggtggcggcg gatccatggt gcacaccaac gtcgtt 56
<210>34
<211>25
<212>DNA
＜213〉artificial sequence
<400>34
tggaagcttt gcaagcagag cctgg 25
<210>35
<211>28
<212>DNA
＜213〉artificial sequence
<400>35
aacacccata tgtctcacaa ggttcacg 28
<210>36
<211>57
<212>DNA
＜213〉artificial sequence
<400>36
ccacccgacc caccaccgcc cgagccaccg ccacctgcaa gcagagcctg gatcttc 57
<210>37
<211>28
<212>DNA
＜213〉artificial sequence
<400>37
aacacccata tgtctcacaa ggttcacg 28
<210>38
<211>25
<212>DNA
＜213〉artificial sequence
<400>38
tggaagcttt gcaagcagag cctgg 25
Claims (3)
1. method for preparing the fusion rotein that reduces the food allergen reaction is characterized in that it comprises the following steps:
The acquisition of thioredoxin gene AnTrx and aspergillus niger thioredoxin reductase Gene A nTrxR in aspergillus niger Trx system, design fusogenic peptide sequence, utilize the fusogenic peptide sequence that the aspergillus niger thioredoxin gene AnTrx of intronless and the aspergillus niger thioredoxin reductase AnTrxR of intronless are merged, then obtain to contain the recombinant bacterial strain of fusion gene RMT, TMR, RGT, TGR, carry out at last the heterogenous expression purifying; The structure of fusion gene RMT is to connect AnTrxR and AnTrx with LinkerA, the structure of fusion gene TMR is to connect AnTrx and AnTrxR with LinkerA, the structure of fusion gene RGT is for connecting AnTrxR and AnTrx with Linker B, the structure of fusion gene TGR is to connect AnTrx and AnTrxR with LinkerB, the gene order of described Link A is as shown in the 13rd sequence in sequence table, and the gene order of described Link B is as shown in the 14th sequence in sequence table.
2. a kind of method for preparing the fusion rotein that reduces the food allergen reaction according to claim 1, after it is characterized in that described expressing fusion protein, when the catalytic activity of AnTrx self is held than the C that is positioned at fusion rotein as AnTrx when AnTrx is positioned at the N end of fusion rotein, the catalytic activity of AnTrx self is high.
3. a kind of method for preparing the fusion rotein that reduces the food allergen reaction according to claim 1, after it is characterized in that described expressing fusion protein, when the catalytic activity of AnTrxR self is held than the C that is positioned at fusion rotein as AnTrxR when AnTrxR is positioned at the N end of fusion rotein, the catalytic activity of AnTrxR self is high.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010113940 CN101899460B (en) | 2010-02-24 | 2010-02-24 | Method for preparing fusion protein capable of lowering food allergen reaction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010113940 CN101899460B (en) | 2010-02-24 | 2010-02-24 | Method for preparing fusion protein capable of lowering food allergen reaction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101899460A CN101899460A (en) | 2010-12-01 |
| CN101899460B true CN101899460B (en) | 2013-06-19 |
Family
ID=43225379
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010113940 Expired - Fee Related CN101899460B (en) | 2010-02-24 | 2010-02-24 | Method for preparing fusion protein capable of lowering food allergen reaction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101899460B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2528251C2 (en) * | 2012-12-07 | 2014-09-10 | Общество с ограниченной ответственностью "Гематологическая Корпорация" (ООО "ГемаКор") | FUSED PROTEIN OF THIOREDOXIN AND INFESTIN 4 DOMAIN, METHOD FOR PREPARING IT, EXPRESSION PLASMID DNA CODING FUSED PROTEIN, AND BACTERIUM Escherichia coli TRANSFORMED BY THIS PLASMID DNA |
| WO2021197632A1 (en) * | 2020-04-03 | 2021-10-07 | Wacker Chemie Ag | Biocatalyst as a core component of an enzyme-catalyzed redox system for the biocatalytic reduction of cystine |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999020122A1 (en) * | 1997-10-17 | 1999-04-29 | The Regents Of The University Of California | Increasing the digestibility of food proteins by thioredoxin reduction |
-
2010
- 2010-02-24 CN CN 201010113940 patent/CN101899460B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999020122A1 (en) * | 1997-10-17 | 1999-04-29 | The Regents Of The University Of California | Increasing the digestibility of food proteins by thioredoxin reduction |
Non-Patent Citations (6)
| Title |
|---|
| Gregorio del Val et al..Thioredoxin treatment increases digestibility and lowers allergenicity of milk.《J ALLERGY CLIN IMMUNOL》.1999,第103卷(第4期),690-697. * |
| Marcel Thon et al..The Thioredoxin System of the Filamentous Fungus Aspergillus nidulans.《THE JOURNAL OF BIOLOGICAL CHEMISTRY》.2007,第282卷(第37期),27259–27269. * |
| Pan-Fen Wang et al..Thioredoxin Reductase-Thioredoxin Fusion Enzyme from Mycobacterium leprae: Comparison with the Separately Expressed Thioredoxin Reductase.《Biochemistry》.1998,第37卷16378-16389. * |
| RICHARD J. FARIS et al..Improving Digestibility of Soy Flour by Reducing Disulfide Bonds with Thioredoxin.《J. Agric. Food Chem.》.2008,第56卷7146-7150. * |
| 王晓慧 等.黑曲霉硫氧还蛋白的克隆表达纯化及其酶活位点特征分析.《菌物学报》.2010,第29卷(第3期),409-413. * |
| 王晓慧.黑曲霉硫氧还蛋白体系基因的克隆、鉴定、融合及其在食品工程中的应用.《中国优秀硕士学位论文全文数据库基础科学辑》.2010,(第8期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101899460A (en) | 2010-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100374554C (en) | Heat-resistant superoxide dismutase and its conding gene and use | |
| CN110295159A (en) | A kind of enzyme mutant | |
| CN110564707A (en) | Zearalenone hydrolase mutant ZHDM1 and coding gene and application thereof | |
| CN107099521A (en) | A kind of acid resistance zearalenone detoxication enzyme and its encoding gene and application | |
| CN106939315B (en) | Preparation method and application of oxalate decarboxylase | |
| CN110628738B (en) | Method for improving activity of glucose oxidase, mutant and application thereof | |
| CN101899460B (en) | Method for preparing fusion protein capable of lowering food allergen reaction | |
| CN103710367B (en) | A kind of recombined human kallikrein 1 and encoding gene thereof and preparation method | |
| CN107955806B (en) | Preparation method and application of superoxide dismutase Cu, Zn SOD (superoxide dismutase) from deep-sea cucumber | |
| CN115058408B (en) | Metagenome-derived high-specific-activity acid-resistant D-psicose 3-epimerase and encoding gene and application thereof | |
| CN113481187B (en) | Algin lyase mutant and application thereof | |
| CN114317491A (en) | Novel lipase AjLip970 and application thereof | |
| CN107254452A (en) | A kind of preparation and application of the anti-oxidant protease of microbial source | |
| CN110195044A (en) | One group of amino acid sequence that SOD activity and stability can be improved and its application | |
| CN113817758A (en) | Chitosan enzyme gene for encoding Bacillus belgii, chitosanase, preparation method and application thereof | |
| CN109750021A (en) | A kind of scallop carotenoid oxicracking enzyme gene and its application | |
| JP3819969B2 (en) | Recombinant fructosyl amino acid oxidase | |
| CN109022471A (en) | Produce the escherichia expression system of oxalate oxidase, the production method and its application of oxalate oxidase | |
| CN101503679A (en) | QSOX, mutant protein thereof, as well as preparation and use | |
| CN105779408B (en) | The application of acid phosphatase and its relevant biological material in building Soluble phosphorus engineering bacteria | |
| CN117304306B (en) | Recombinant III type collagen Pro.C3 and preparation method and application thereof | |
| CN104313042A (en) | Paenibacillus polymyxa neopullulanase gene as well as method for producing neopullulanase through cloning and expression and fermentation | |
| CN109750053A (en) | A method of farnoquinone is synthesized using restructured Pichia pastoris in expression aromatic series prenyltransferase | |
| CN114317511B (en) | Protein, gene, recombinant vector, expression cassette, host and application | |
| CN113755474B (en) | Carboxypeptidase, and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130619 Termination date: 20160224 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |