CN101892320A - Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D - Google Patents
Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D Download PDFInfo
- Publication number
- CN101892320A CN101892320A CN2010103011781A CN201010301178A CN101892320A CN 101892320 A CN101892320 A CN 101892320A CN 2010103011781 A CN2010103011781 A CN 2010103011781A CN 201010301178 A CN201010301178 A CN 201010301178A CN 101892320 A CN101892320 A CN 101892320A
- Authority
- CN
- China
- Prior art keywords
- seq
- base sequence
- primer
- specially
- specific amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a multiple PCR identification method of salmonella serogroups A, B, C1, C2 or D, belonging to the technical field of food safety detection. The method comprises the following steps: step 1: respectively designing specific amplification primer pairs according to a base sequence such as 5 nucleic acids as shown in SEQ ID NO:1-5; and step 2: detecting a sample by utilizing the specific amplification primer pairs obtained in the step 1 and adopting a conventional PCR method, and determining the type of the salmonella serogroup in the sample. The determined type of the salmonella serogroup in the sample is concretely as follows: the gel electrophoresis detection is carried out, wherein if 350bp and 466bp bands exist, the result shows that the serogroup A exists; if 177bp bands exist, the result shows that the serogroup B exists; if 623bp bands exist, the result shows that the serogroup C1 exists; if 540bp bands exist, the result shows that the serogroup C2 exists; and if 466bp bands exist, the result shows that the serogroup D exists. The method of the invention can be used for quickly and accurately identifying the salmonella of the serogroups A, B, C1, C2 or D, and avoids the defects of complicated operation, time and labor consumption and high cost of the existing method.
Description
Technical field
The present invention relates to a kind of multiple PCR identification method of food safety detection technical field, specifically is the multiple PCR identification method of a kind of Salmonellas serologic group A, B, C1, C2, D.
Background technology
Salmonellas (Salmonella) is one of most important food-borne pathogens, can pass through food (particularly animal food) and propagate, and can cause human gastroenteritis, septicemia, dysentery and typhoid fever.Serotype is the core of its identification research in research Salmonellas epizootic disease, and for the outburst of monitoring of diseases, the trend of propagation and disease control play an important role.The isolated Salmonellas in the whole world has more than 2500 kind of serotype at present, and China has 300 kinds of serotypes approximately, but the serotype relevant with human diseases mainly concentrates on A～E serologic group, and wherein the pathogenic Salmonellas of A～D group accounts for 70%.
In the practice, the separation of Salmonellas, evaluation and somatotype mainly are to adopt state's calibration method (GBT4789.4-2008), and according to the biochemical reaction of Salmonellas, and antigen antibody reaction is carried out, and somatotype identifies.Though this method is intuitive and reliable, also exist the defective of some, as time-consuming longer, detecting usually needs 3～5 days; Can't identify for some special bacterial strains (bacterial strain such as rough type), need in the practice more simply, authentication method fast and accurately.Round pcr has characteristic fast and accurately, and the serotype that is applied to Salmonellas identifies that very big potentiality are arranged.At present, the target spot that is used for identifying the multiple PCR method of Salmonellas serologic group A～D mainly is the specific gene that adopts the rfb gene cluster of Salmonellas.
Find through literature search prior art, Luk J.M., Kongmuang U., people such as Reeves P.R. the 2118th～2213 page of " Journal of Clinical Microbiology " (clinical microbiology magazine) 1993 the 31st the 8th phase of volume deliver be entitled as " Selective amplification of abequose and paratose synthasegenes (rfb) by polymerase chain reaction for identification of Salmonella majorserogroups (A, B, C2, and D) " (identify the main serologic group (A of Salmonellas by PCR selective amplification abequose and paratose synthase gene (rfb), B, C2 and D)).Though this method can be good at distinguishing the Salmonellas of different serologic group, be merely able to identify serologic group B, C2 and D (A), can not identify serologic group C1; Because the target gene homology of serologic group A and D is high, both can't be distinguished.After this have many researchers constantly to explore new detection target spot, but target spot still derive from the rfb gene cluster mostly.Because the antigenic structure of Salmonellas is polymorphism, gene order in its corresponding rfb gene cluster between each Salmonellas serotype put in order and lack, situation such as sudden change also has nothing in common with each other, be difficult for being designed for the multi-primers that PCR method is identified, therefore the detection method majority is to identify with detection chip, makes appraisal cost too high.
Summary of the invention
The objective of the invention is to overcome the deficiencies in the prior art, the multiple PCR identification method of a kind of Salmonellas serologic group A, B, C1, C2, D is provided.The Salmonellas that method of the present invention can be identified A, B, C1, C2 and D5 kind serologic group has fast and accurately avoided existing method complex operation, wastes time and energy defective with high costs.
The present invention realizes by following technical scheme,
The present invention relates to the multiple PCR identification method of a kind of Salmonellas serologic group A, B, C1, C2, D, comprise the steps:
The type of Salmonellas serologic group is specially in described definite sample: detect the pcr amplification result with agarose gel electrophoresis, if 350bp and 466bp band are arranged, then explanation has serologic group A; If the 177bp band is arranged, then explanation has serologic group B; If the 623bp band is arranged, then explanation has serologic group C1; If the 540bp band is arranged, then explanation has serologic group C2; If the 466bp band is arranged, then explanation has serologic group D.
In the step 1, described specific amplification primer is to being specially,
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:1 is to being specially:
The base sequence of upstream primer shown in SEQ ID NO:6,
The base sequence of downstream primer is shown in SEQ ID NO:7;
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:2 is to being specially:
The base sequence of upstream primer shown in SEQ ID NO:8,
The base sequence of downstream primer is shown in SEQ ID NO:9;
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:3 is to being specially:
The base sequence of upstream primer shown in SEQ ID NO:10,
The base sequence of downstream primer is shown in SEQ ID NO:11;
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:4 is to being specially:
The base sequence of upstream primer shown in SEQ ID NO:12,
The base sequence of downstream primer is shown in SEQ ID NO:13;
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:5 is to being specially:
The base sequence of upstream primer shown in SEQ ID NO:14,
The base sequence of downstream primer is shown in SEQ ID NO:15.
In the step 2, described conventional PCR method is specially, and it is right to get 5 pairs of specific amplification primers, is diluted to 5 μ M respectively, by 1: 1: 1: mix at 1: 1 mix primer, add afterwards in the PCR reaction system; 30 μ L PCR reaction systems are specially: 10 * PCR reaction buffer, 3.0 μ L, the Mg of 25mmol/L
2+2.0 μ L, the dNTP 2.0 μ L of 2.5mmol/L, Taq enzyme 1U, template solution 2 μ L, mix primer is got 5 μ L, last moisturizing to 30 μ L; The pcr amplification process is as follows: 94 ℃ of pre-sex change 5min, and 35 circulations afterwards, each round-robin program is specially: 94 ℃ of sex change 60s, 60 ℃ of annealing 60s, 72 ℃ are extended 30s; After the loop ends, 72 ℃ are extended 10min, are cooled to 12 ℃ at last.
It is right to the invention still further relates to a kind of primer, and the base sequence of upstream primer is shown in SEQ ID NO:6, and the base sequence of downstream primer is shown in SEQ ID NO:7;
Perhaps the base sequence of upstream primer is shown in SEQ ID NO:8, and the base sequence of downstream primer is shown in SEQ ID NO:9;
Perhaps the base sequence of upstream primer is shown in SEQ ID NO:10, and the base sequence of downstream primer is shown in SEQ ID NO:11;
Perhaps the base sequence of upstream primer is shown in SEQ ID NO:12, and the base sequence of downstream primer is shown in SEQ ID NO:13;
Perhaps the base sequence of upstream primer is shown in SEQ ID NO:14, and the base sequence of downstream primer is shown in SEQ ID NO:15.
The invention still further relates to a kind of nucleic acid, its base sequence is shown in SEQ ID NO:1; Perhaps its base sequence is shown in SEQ IDNO:2; Perhaps its base sequence is shown in SEQ ID NO:3; Perhaps its base sequence is shown in SEQ ID NO:4; Perhaps its base sequence is shown in SEQ ID NO:5.
Compared with prior art, the present invention has following beneficial effect: adopt detection method of the present invention to identify A, B, C1, C2, the D of Salmonellas serologic group, detection time is short, owing to need not adopt the antiserum(antisera) that must use in the traditional detection method, can also be used to detect some antiserum(antisera) can not detected bacterial strain, as the bacterial strain that antigen is not expressed, remedy the defective of immunodetection, have practicality more; Simultaneously, detection target spot of the present invention is to adopt new gene order, has single specificity, and detected result is special, and the result judges simply, has reduced the detection cost.
Description of drawings
The electrophoresis photo of multiplex PCR qualification result among Fig. 1 embodiment.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, for example the Sambrook equimolecular is cloned: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.The bacterial strain that relates among the embodiment all belongs to prior art, and those skilled in the art can obtain from disclosed commercial channel at an easy rate.
Embodiment
(1) through bioinformatic analysis, the special target spot of the Salmonellas serologic group A that finds is one section dna sequence dna (SEQ ID NO:1) that comes from Pparatyphoid A strains A TCC9150 genom sequence 1927369～1928354bp, the primers designed of utilization primer-design software Primer Premier 5.0 a pair of serologic group A of design in this segment DNA sequence section.
Primer sequence is as follows:
SA-L：AACAGATCCTGCACCATATC；(SEQ?ID?NO：6)
SA-R：CAGTTTCATGATGGCAGAG；(SEQ?ID?NO：7)
(2) through bioinformatic analysis, the special target spot of the Salmonellas serologic group B that finds is gene STM2087 (SEQ IDNO:2), the primers designed of utilization primer-design software Primer Premier 5.0 a pair of serologic group B of design in this fragment gene sequence section.
Primer sequence is as follows:
SB-L：CGATGAGGGTTTCTAATCTC；(SEQ?ID?NO：8)
SB-R：TCTTGCTTCAGTATCCCTTG；(SEQ?ID?NO：9)
(3) through bioinformatic analysis, the special target spot of the Salmonellas serologic group C1 that finds is gene SCH_2092 (SEQID NO:3), the primers designed of utilization primer-design software Primer Premier 5.0 a pair of serologic group C1 of design in this fragment gene sequence section.
Primer sequence is as follows:
SC1-L：CAGTCACAACCTGGAAGA；(SEQ?ID?NO：10)
SC1-R：ATACAAGCCGCTGAGTGA；(SEQ?ID?NO：11)
(4) through bioinformatic analysis, the special target spot of the Salmonellas serologic group C2 that finds is for comprising one section sequence of gene SNSL254_A2005 (SEQ ID NO:4), the primers designed of utilization primer-design software Primer Premier 5.0 a pair of serologic group C2 of design in this segment DNA sequence section.
Primer sequence is as follows:
SC2-L：CAGTAGAGACGACGGAGTTC；(SEQ?ID?NO：12)
SC2-R：TACATGCTTGGCTGAGACTA；(SEQ?ID?NO：13)
(5) through bioinformatic analysis, the special target spot of the Salmonellas serologic group D that finds is gene STY3763 (SEQ IDNO:5), and utilization primer-design software Primer Premier 5.0 designs the primer of deciding of a pair of serologic group D mirror in this fragment gene sequence.
Primer sequence is as follows:
SD-L：GCCAATAAACTCCACAACAT；(SEQ?ID?NO：14)
SD-R：GGATCATGCGTTAAATGTCT；(SEQ?ID?NO：15)
5 pairs of specific amplification primers getting the step 1 gained are right, are diluted to 5 μ M respectively, by 1: 1: 1: mix at 1: 1 mix primer;
The PCR reaction system of 30 μ L is specially: 10 * PCR reaction buffer, 3.0 μ L, the Mg of 25mmol/L
2+2.0 μ L, the dNTP 2.0 μ L of 2.5mmol/L, Taq enzyme 1U, template solution is got 2 μ L, and mix primer is got 5 μ L, last moisturizing to 30 μ L;
The PCR loop parameter is set as follows: 94 ℃ of pre-sex change 5min, and 35 circulations afterwards, each round-robin program is specially: 94 ℃ of sex change 60s, 60 ℃ of annealing 60s, 72 ℃ are extended 30s; After the loop ends, 72 ℃ are extended 10min, are cooled to 12 ℃ at last.
Verify from the Salmonellas reference culture of serologic group such as A, B, C, D and E with 15 strains.The dna solution of this 15 strain Salmonellas reference culture is respectively got 2 μ L as the PCR reaction template, increases according to the PCR reaction system and the reaction parameter of step 2.Behind pcr amplification, point sample carries out electrophoresis in 2% sepharose respectively, and observes electrophoresis result in the gel imaging instrument.Verify the result as shown in Figure 1, among Fig. 1, swimming lane 1～15: Salmonellas reference culture ATCC 9150 (A), ATCC14028 (B), ATCC 15611 (B), ATCC 6017 (B), CMCC 50017 (C1), ATCC 7001 (C1), ATCC 10708 (C1), ATCC 51741 (C1), ATCC 12002 (C2), CMCC 50770 (D), ATCC13076 (D), CMCC 50335 (D), CMCC 50098 (D), ATCC 9270 (E), ATCC 4840 (G); Swimming lane 16: negative control; Swimming lane 17: positive control, template are ATCC 9150, and ATCC 14028, and ATCC 10708, ATCC12002, the DNA mixed solution of ATCC 13076 these 5 kinds of bacterial strains; Swimming lane M:100bp molecular weight standard.By the electrophoresis result of Fig. 1 as can be known, swimming lane 1 detects 350bp and 466bp band; Swimming lane 2～4 has all detected the 177bp band; Swimming lane 5～8 has all detected the 623bp band; Swimming lane 9 has detected the 540bp band; Swimming lane 10～13 has detected the 466bp band; Swimming lane 14,15,16 does not all detect band; Swimming lane 17 has detected 350bp, 466bp, 177bp, 623bp, 540bp band; By the detected result susceptible of proof: if 350bp and 466bp band are arranged, then explanation has serologic group A; If the 177bp band is arranged, then explanation has serologic group B; If the 623bp band is arranged, then explanation has serologic group C1; If the 540bp band is arranged, then explanation has serologic group C2; If the 466bp band is arranged, then explanation has serologic group D.This explanation utilizes the detection method of present embodiment to detect to have excellent specificity, good detection effect is arranged.
Sequence table
＜110〉Shanghai Communications University
＜120〉multiple PCR identification method of Salmonellas serologic group A, B, C1, C2, D
<130>10010
<160>15
<170>PatentIn?version?3.3
<210>1
<211>986
<212>DNA
＜213〉Salmonella paratyphi A
<400>1
gctgttgctg?atggagtgct?ggtgcataac?ccttatccct?tttactctgg?tacttctgct 60
gtagaaatca?gacatggtga?attaatcctt?cgttatggcg?aaattgctaa?tggatcacac 120
ataggtgggt?cgtctgtgaa?aaaaggtcag?attattgcta?aggtggggag?gctgaacagt 180
ggttcatcta?tgttgcatct?ggaaatttat?accaatggag?catcctcggc?cagtcttaca 240
acacgtgtag?gtgaattaag?aaggcgttcc?gatgtaacag?atcctgcacc?atatctgaat 300
gtatggaaaa?ataatcttcc?aaaagtttga?tcttcaagga?attgataaag?tgcttaaata 360
tataggtttt?attttagttc?tgatgttatc?tggcattgtt?ggttgtgctg?caaccgaacc 420
tggcaacata?ccattagatg?gcctaaacac?taatagcttc?gacattgggg?agattactga 480
tggagagatt?actgatgatt?tgaggcactc?cacttgcact?ctgcgcctgg?ccgataataa 540
gaaggaggat?tcctataact?atattgaagg?ggcgatttgt?cctgcggatg?gtgaagaatg 600
tacttactct?gccatcatga?aactgaatgg?gaatataaca?atattgaaac?agatatcatc 660
aggtgaaaat?gactcagtat?ataaaaataa?ggatttttct?atcttcataa?aacagattcc 720
agtggcagag?caaaatgatg?atgaaggaag?cgacattaaa?gccactattg?tcgtcaaaac 780
aaaaagcgat?gaaaaaacac?ttaatatgac?gggatactgt?ggggtttaaa?aaatgaatat 840
tctcttacga?aaataaagca?aatcagaata?gattttttaa?aatttgtaat?gcgtaactct 900
atctggaaag?taagttgatg?ataaaatcaa?aaggcagata?tcaccgcaca?atctggacgc 960
tcgaagaact?ggaattcgtg?aaaacc 986
<210>2
<211>1002
<212>DNA
＜213〉Salmonella typhimurium
<400>2
atgcttatat?cattttgtat?tccaacttat?aatagaaaag?aatatcttga?agagttgttg 60
aatagtataa?ataatcagga?aaaatttaat?ttagatattg?agatatgtat?atcagataat 120
gcctctactg?atggtacaga?ggaaatgatt?gatgtttgga?ggaacaatta?taatttccca 180
ataatatatc?ggcgtaatag?cgttaacctt?gggccagata?ggaattttct?tgcttcagta 240
tcccttgcga?atggggatta?ttgttggata?tttggcagtg?atgatgctct?tgcgaaagac 300
tcgttagcga?tattacaaac?ttatctcgat?tctcaagcag?atatatattt?atgtgacaga 360
aaagagaccg?ggtgtgattt?agttgagatt?agaaaccctc?atcgttcttg?gctcagaaca 420
gatgatgaac?tttatgtgtt?taataataat?ttagataggg?aaatctatct?cagtagatgc 480
ttatctattg?gtggtgtatt?tagctatcta?agttctttaa?tagtaaaaaa?agaacgatgg 540
gatgccattg?attttgatgc?gtcctatatt?ggcacttcct?atcctcatgt?atttatcatg 600
atgagcgtat?ttaatacgcc?agggtgcctt?ttgcattata?tatcaaaacc?actcgtaata 660
tgccgaggag?ataatgatag?tttcgagaag?aaaggaaagg?ccagacgaat?tttaattgat 720
tttattgcat?atttaaaatt?agctaatgat?ttttacagta?aaaatatatc?tttaaaacga 780
gcatttgaaa?atgttttgct?aaaagagaga?ccatggttat?atacaacttt?ggctatggca 840
tgttatggca?atagtgatga?aaaaagagat?ttatctgaat?tttatgcaaa?gctaggttgt 900
aataaaaata?tgatcaacac?tgtacttcga?tttgggaaac?tagcatatgc?agtgaaaaat 960
attaccgtgc?ttaagaattt?tactaaacgg?ataattaagt?ag 1002
<210>3
<211>1527
<212>DNA
＜213〉Salmonella choleraesuls
<400>3
atgcgaacta?taaaagcgat?taacaacttt?aaagttgatt?tatttattac?tttttttctt 60
attgcgctag?gattttatct?tcgaactata?tttgtctcta?agatgggcgc?tgatttaaca 120
ggtgtgatgt?tgttatttac?acaactgact?gcttatttaa?atctcgccga?gcttggcata 180
ggggtagctg?cggcaagcct?tttatacaag?ccgctgagtg?agggggatta?tgcaaaaata 240
aaatacttaa?ctttattgct?gtctacaatc?tatagatata?tctcgttttt?agttttattg 300
ataggtatag?taattggctt?tggtatttac?tttttcatcg?attctgttaa?tgcagtaagt 360
cacgttttta?tttattgggc?attttttgta?ataaatacat?ctttaactta?ttcttatgca 420
aagcattcaa?ctctattaac?tgcaaatcag?caatattcag?tagtccgtaa?aatacagggt 480
ggcgggaaaa?tattaattat?tgcgctgcaa?atattgctat?tagtcaccac?acataatttc 540
ttactctatt?tgctcgttga?aactattggc?gtgatagtac?agtattttat?atttaaaaat 600
attattaata?acgacatcca?ttttaaggta?gttccacaat?ctattagcga?tgatgaaaaa 660
acaacattaa?aaaatgaatt?aaaaataaaa?ataaaaaaca?tgttttttca?taagattggt 720
ggtgtgttag?ttttaaatac?tgattatttg?ctagtttcaa?aatttcttaa?tttaagctac 780
gtcacgattt?atggaagtta?tatgatggtc?ttccaggttg?tgactgtgct?tatgtccagt 840
tttgttaatg?ctattacagc?tagtgtgggt?aattttttaa?tcaatcaaaa?tgatgatgaa 900
gttaccagta?ttgcaaagca?atttaacaca?gtatttatag?cattggctac?cttcatttct 960
ttgaatatgt?attttttggt?taatgacttt?attaccagct?ggataggcga?aaaattcata 1020
ctaggtaatg?gtattgttat?attaatgctt?gttaatgtat?ttataagtgt?cattagaatt 1080
ccttgtgata?tttttaaaaa?cgcaactggt?ttttttgggg?atgtatatta?tcctttgctt 1140
gagggagtgg?ttaatttatt?tttttccgcg?ctcctggctt?tttatattgg?tcttcccggt 1200
attattattg?gcacgattat?atctaatgta?ttaattacat?taattgcaaa?gccattatat 1260
ctatatggta?aaatgtttgg?tagatttaat?gcattaaaaa?agtacttgtc?atttgtactg 1320
aaacctttaa?tattctcatt?tgttattttg?gctgtttttt?attttacaag?agaacaaata 1380
attttcttta?aagtttccaa?ctggtttgac?tttataagta?agcttactat?tgtatcgctg 1440
gtaagtatga?ttatagtttt?tgcggttttt?tatgcagatg?ctaactttag?gtcttttgtt 1500
aaaagaattt?tacgcgtggt?attttaa 1527
<210>4
<211>986
<212>DNA
＜213〉Newport Salmonellas
<400>4
tgaatatact?gtcgttgcca?gtagagacga?cggagttcag?cgccgattct?cttaaaaaca 60
gtgaccacct?cagtgtggat?ttatccgcct?tcagccggga?tggctatatt?gcgccaggga 120
attacctgct?tgatatttac?gtgaatgaca?gactcattca?caatcaataa?aaagtcagtg 180
tggtggagat?tagcgacgag?cactcacggt?tctgcatcat?ctctgcactg?gcagacatgc 240
tcgggttaaa?agaggagaac?cgccgactac?tcgggcccgt?ccggcagtgt?ctgaaactga 300
acactacgca?tggtaaagta?acatacagcc?cggataacca?atctctgtta?gtcactctgc 360
cccaagtctg?gatagaatac?cagaatctgg?cttgagtacc?ccggcccgct?ggagtgatgg 420
tgtcacagcc?gccctgctga?gctataacct?gatgacgaac?ctgtggtcta?cattccactg 480
gtattggcat?ctgaagctgc?acgcgaaaga?tctggctgga?aaatggcata?gccattcata 540
gtctcagcca?agcatgtact?gcaattgacc?ctgcagatct?cgtcaatttt?gaatctctgg 600
ctgtcgcttg?catatgctgg?gttctcctta?gccccctcgt?tcctaagttt?gtaatgcaga 660
gacggttttt?atgtttgtaa?attttctggc?gcgatggttt?tgctcacaag?tggtaagttg 720
tttttctttt?ccagtgtaat?atgttaaatt?tctcgcactg?attaattcac?tttttgtacg 780
acatgcacaa?tctaacgcca?gaattattgc?aaactccatc?tgtaagaagc?aacagagaca 840
gaagtcttga?tatagccaag?ggaattatga?tgctgtctgt?tgttgctgga?cacattgcaa 900
atttcccatt?tggggaggta?ttctattact?atcaagttgc?cggatttttt?ctgctatcgg 960
gttatttctt?tcattacgac?aagtat 986
<210>5
<211>1037
<212>DNA
＜213〉salmonella typhi
<400>5
attatcaaac?gctggcgcgc?catgtcgccc?ccgcgcaatg?cggcgcagta?ctgaaagcca 60
atggctatgg?cttgggggcg?gaggcgattg?cgccagccct?gtatgcggcc?aattgccgga 120
tcttttttgt?cgcgcaactt?tctgaagggg?tggcgctacg?taacatcctg?tcggctgacg 180
cgatggtggt?gttgcttaat?ggcgtcatgc?cgcaggcgat?gccgttttgt?tgcgcgcaac 240
agatcacacc?attgttgaat?tccgttgacc?aggtgatgac?gtggctggcg?ttacaggagg 300
ctcggtcgca?gcggcgtccg?gtcttgatcc?agcttgactc?tggtatgtcg?cggctggggg 360
tgacgccgga?gcaactggcg?cggctggccg?cgatttttcg?ccagcgtggc?tgggctgcgc 420
cagactatat?catcagccat?ctggccaacg?ccgacaggcc?ggatcatgcg?ttaaatgtct 480
atcagcatac?gctactccag?caggcaaaaa?aggcattccc?aaccagccgt?tattcgctgg 540
caaattcctg?cggtatgttt?ctgcatccgg?cctggcggga?agatctttgc?cgtccgggcg 600
ttgcgctgtt?cggcgtcgcc?cagccgtggt?tttcaacgcc?gttaaaaccg?gcatttacgc 660
tgacgttgac?cattttgcgc?gtgcaagacg?tgccggttgg?gacgccgatt?ggctacggca 720
gtacggttac?taccactcgc?ccgctgcgta?tcgccacggt?atccgccgga?tacgctgatg 780
ggattccgcg?taatttgcgt?cctccggcgg?gcgtgtgctg?gcgcggggtt?cggttgccgg 840
tgttggggcg?ggtctgcatg?gacagcttta?tggtggacgc?cagcgccatc?atgccaacgt 900
ctggcgatgt?tgtggagttt?attggcgtga?gccagacgct?ggaagaggtt?gctgccgcct 960
gcgataccat?cccttatgag?attatggccc?ggcttggcgc?acgttttcgg?cgcataatgc 1020
agcccgcaga?agcttga 1037
<210>6
<211>20
<212>DNA
<213>artificial
<220>
＜223〉artificial sequence
<400>6
aacagatcct?gcaccatatc 20
<210>7
<211>19
<212>DNA
<213>artificial
<220>
＜223〉artificial sequence
<400>7
cagtttcatg?atggcagag 19
<210>8
<211>20
<212>DNA
<213>artificial
<220>
＜223〉artificial sequence
<400>8
cgatgagggt?ttctaatctc 20
<210>9
<211>20
<212>DNA
<213>artificial
<220>
＜223〉artificial sequence
<400>9
tcttgcttca?gtatcccttg 20
<210>10
<211>18
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>10
cagtcacaac?ctggaaga 18
<210>11
<211>18
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>11
atacaagccg?ctgagtga 18
<210>12
<211>20
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>12
cagtagagac?gacggagttc 20
<210>13
<211>20
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>13
tacatgcttg?gctgagacta 20
<210>14
<211>20
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>14
gccaataaac?tccacaacat 20
<210>15
<211>20
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>15
ggatcatgcg?ttaaatgtct 20
Claims (5)
1. the multiple PCR identification method of a Salmonellas serologic group A, B, C1, C2, D is characterized in that, comprises the steps:
Step 1, according to 5 nucleic acid shown in base sequence SEQ ID NO:1～5, it is right to design specific amplification primer respectively;
Step 2 utilizes the specific amplification primer of step 1 gained right, adopts conventional PCR method test sample, determines the type of Salmonellas serologic group in the sample;
The type of Salmonellas serologic group is specially in described definite sample: detect the pcr amplification result with agarose gel electrophoresis,
If 350bp and 466bp band are arranged, then explanation has serologic group A;
If the 177bp band is arranged, then explanation has serologic group B;
If the 623bp band is arranged, then explanation has serologic group C1;
If the 540bp band is arranged, then explanation has serologic group C2;
If the 466bp band is arranged, then explanation has serologic group D.
2. the multiple PCR identification method of Salmonellas serologic group A according to claim 1, B, C1, C2, D is characterized in that, in the step 1, described specific amplification primer is to being specially:
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:1 is to being specially:
The base sequence of upstream primer is shown in SEQ ID NO:6;
The base sequence of downstream primer is shown in SEQ ID NO:7;
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:2 is to being specially:
The base sequence of upstream primer is shown in SEQ ID NO:8;
The base sequence of downstream primer is shown in SEQ ID NO:9;
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:3 is to being specially:
The base sequence of upstream primer is shown in SEQ ID NO:10;
The base sequence of downstream primer is shown in SEQ ID NO:11;
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:4 is to being specially:
The base sequence of upstream primer is shown in SEQ ID NO:12;
The base sequence of downstream primer is shown in SEQ ID NO:13;
The specific amplification primer of the nucleic acid of base sequence shown in SEQ ID NO:5 is to being specially:
The base sequence of upstream primer is shown in SEQ ID NO:14;
The base sequence of downstream primer is shown in SEQ ID NO:15.
3. the multiple PCR identification method of Salmonellas serologic group A according to claim 1 and 2, B, C1, C2, D, it is characterized in that, in the step 2, described conventional PCR method is specially, it is right to get 5 pairs of specific amplification primers, be diluted to 5 μ M respectively, by 1: 1: 1: mix at 1: 1 mix primer, add afterwards in the PCR reaction system; 30 μ L PCR reaction systems are specially: 10 * PCR reaction buffer, 3.0 μ L, and the Mg2+2.0 μ L of 25mmol/L, the dNTP2.0 μ L of 2.5mmol/L, Taq enzyme 1U, template solution 2 μ L, mix primer is got 5 μ L, last moisturizing to 30 μ L; The pcr amplification process is as follows: 94 ℃ of pre-sex change 5min, and 35 circulations afterwards, each round-robin program is specially: 94 ℃ of sex change 60s, 60 ℃ of annealing 60s, 72 ℃ are extended 30s; After the loop ends, 72 ℃ are extended 10min, are cooled to 12 ℃ at last.
4. a primer is right, it is characterized in that, the base sequence of upstream primer is shown in SEQ ID NO:6, and the base sequence of downstream primer is shown in SEQ ID NO:7;
Perhaps the base sequence of upstream primer is shown in SEQ ID NO:8, and the base sequence of downstream primer is shown in SEQ ID NO:9;
Perhaps the base sequence of upstream primer is shown in SEQ ID NO:10, and the base sequence of downstream primer is shown in SEQ ID NO:11;
Perhaps the base sequence of upstream primer is shown in SEQ ID NO:12, and the base sequence of downstream primer is shown in SEQ ID NO:13;
Perhaps the base sequence of upstream primer is shown in SEQ ID NO:14, and the base sequence of downstream primer is shown in SEQ ID NO:15.
5. a nucleic acid is characterized in that, its base sequence is shown in SEQ ID NO:1; Perhaps shown in SEQ ID NO:2; Perhaps shown in SEQ ID NO:3; Perhaps shown in SEQ ID NO:4; Perhaps shown in SEQ IDNO:5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010103011781A CN101892320B (en) | 2010-02-04 | 2010-02-04 | Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010103011781A CN101892320B (en) | 2010-02-04 | 2010-02-04 | Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101892320A true CN101892320A (en) | 2010-11-24 |
| CN101892320B CN101892320B (en) | 2012-11-07 |
Family
ID=43101664
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010103011781A Active CN101892320B (en) | 2010-02-04 | 2010-02-04 | Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101892320B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103266179A (en) * | 2013-05-28 | 2013-08-28 | 上海交通大学 | Multiplex PCR (Polymerase Chain Reaction) detection method for salmonella typhimurium and serum variants of salmonella typhimurium |
| CN104087654A (en) * | 2013-04-01 | 2014-10-08 | 中国农业大学 | Multiple PCR identification kit of salmonella and five serotypes of salmonella |
| CN104774969A (en) * | 2015-05-08 | 2015-07-15 | 江苏省家禽科学研究所 | Multi-PCR detection kit and method for identifying poultry salmonella |
| CN109762914A (en) * | 2019-01-28 | 2019-05-17 | 浙江省检验检疫科学技术研究院 | HRM serotype method, target gene, specificity amplification primer and the kit of salmonella food-borne pathogens |
-
2010
- 2010-02-04 CN CN2010103011781A patent/CN101892320B/en active Active
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104087654A (en) * | 2013-04-01 | 2014-10-08 | 中国农业大学 | Multiple PCR identification kit of salmonella and five serotypes of salmonella |
| CN104087654B (en) * | 2013-04-01 | 2016-04-27 | 中国农业大学 | The identification with multi-plex PCR test kit of Salmonellas and five kinds of serotypes thereof |
| CN103266179A (en) * | 2013-05-28 | 2013-08-28 | 上海交通大学 | Multiplex PCR (Polymerase Chain Reaction) detection method for salmonella typhimurium and serum variants of salmonella typhimurium |
| CN103266179B (en) * | 2013-05-28 | 2014-10-22 | 上海交通大学 | Multiplex PCR (Polymerase Chain Reaction) detection method for salmonella typhimurium and serum variants of salmonella typhimurium |
| CN104774969A (en) * | 2015-05-08 | 2015-07-15 | 江苏省家禽科学研究所 | Multi-PCR detection kit and method for identifying poultry salmonella |
| CN109762914A (en) * | 2019-01-28 | 2019-05-17 | 浙江省检验检疫科学技术研究院 | HRM serotype method, target gene, specificity amplification primer and the kit of salmonella food-borne pathogens |
| CN109762914B (en) * | 2019-01-28 | 2022-03-22 | 浙江省检验检疫科学技术研究院 | HRM serotyping method, target gene, specific amplification primer and kit for salmonella food-borne pathogenic bacteria |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101892320B (en) | 2012-11-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102703587B (en) | Loop-mediated isothermal amplification method for detecting lyme disease spirochete | |
| US6004747A (en) | Salmonella identification by the polymerase chain reaction | |
| CN103898227B (en) | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof | |
| CN103382507A (en) | One-step dual RT-PCR detection kit of 1-type and 3-type duck hepatitis A virus, primer pairs and method thereof | |
| CN107988340B (en) | PCR amplification primer for rapidly detecting mycoplasma ovipneumoniae and application thereof | |
| CN101892320B (en) | Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN102417929B (en) | Specific PCR detection method of Riemerella anatipestifer | |
| CN105063218A (en) | Multiple quantitative PCR (polymerase chain reaction) kit for quick combined detection of four bacteria difficult to cultivate and identify | |
| Kaelin et al. | Cervicovaginal DNA virome alterations are associated with genital inflammation and microbiota composition | |
| CN104561283A (en) | Serotyping PCR (polymerase chain reaction) method for haemophilus parasuis | |
| CN103882140A (en) | Rapid diagnosis kit for mycobacterium tuberculosis | |
| CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN107058463B (en) | Primer for identifying salmonella H antigen | |
| CN102618634A (en) | PCR (polymerase chain reaction) detection method for specificity of salmonella typhimurium | |
| WO2011001449A2 (en) | Primers, pcr reaction mixture and methods thereof | |
| CN104152537A (en) | Swine-derived eperythrozoon detecion kit, method and applications | |
| CN101760553A (en) | Genotype inspection method and genotyping inspection method of staphylococcal enterotoxin | |
| CN102154466B (en) | Nucleotides with specificity to internal transcribed spacer(ITS) of neisseria meningitidis and application thereof | |
| CN101748215B (en) | Detection method for infant salmonella PCR and nucleic acid and primer pair thereinto | |
| CN104342497A (en) | Method for LAMP (looped-mediated isothermal amplification) detection of trypanosoma evansi variant strain with deletion of ToTat1.2 gene | |
| WO2008140832A2 (en) | Method for rapid detection of clostridium botulinum | |
| Dias et al. | Diversity of mutations in the atpC gene coding for the c Subunit of F0F1 ATPase in clinical isolates of optochin-resistant Streptococcus pneumoniae from Brazil | |
| CN102311950A (en) | Nucleotide specific to wzt of Legionella pneumophila serogroup 1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |