CN101892203A - Crystal of thymidylate synthetase (ThyX) of helicobacter pylori and preparation method - Google Patents

Abstract

The invention discloses a crystal of thymidylate synthetase (ThyX) of helicobacter pylori. The crystal structure is a unit cell that a is equal to 222.15, b is equal to 49.26, c is equal to 142.49, alpha is equal to 90 degrees, beta is equal to 98.65 degrees and gamma is equal to 90 degrees; and the protein space group of the crystal is C2. The crystal structure lays a foundation for designing a small molecular inhibitor and an antibacterial agent.

Description

The crystal of thymidylate synthetase (ThyX) of helicobacter pylori and preparation method

Technical field

The invention belongs to molecular biology and applied microbiology field, particularly the crystal of the thymidylate synthetase (ThyX) of helicobacter pylori and preparation method.

Background technology

Helicobacter pylori (Helicobacter pylori, H.pylori) be the Grain-negative microaerobe, it is the important paathogenic factor of chronic gastritis, gastro-duodenal ulcer, take place closely relatedly with cancer of the stomach, stomach mucous membrane associated lymphoid tissue lymphoma, the World Health Organization is with its row position one class virulence factor.According to statistics, crowd H.pylori infection rate in the world surpasses 50%, and it is severe day by day to adopt antibiotic therapy H.pylori infection institute to face the multidrug resistance situation at present clinically.Therefore, screen and find that new pharmacological agent target spot becomes a big research focus in recent years, this infects effective prevention and treatment H.pylori, has important theory directive significance and clinical value.

1, thymidylate synthase has been brought into play important effect in DNA synthetic, the protein structure of the thymidylate synthase of H.pylori and human body cell is different fully with catalyst mechanism, and the former also may be closely related with the ulcer that H.pylori infect to cause, and these make it become an ideal drug target.

Nucleotide is the synthesis material of thymus nucleic acid (DNA), is the essential material of organism heredity and cellular metabolism.Deoxythymidine acid (dTMP) does not have corresponding ribonucleotide, can not directly be reduced by ribonucleotide to obtain.Except can decomposing by thymidylate kinase, some unicellular lower eukaryotes utilize the ectogenic Nucleotide, nearly all biology all must have the thymidylate synthase of self to satisfy metabolic needs, and biomass cells mainly all passes through the synthetic dTMP of following dual mode.Most of biomass cellss comprise that human body is all by the synthetic dTMP of A approach, but comprise H.pylori and dsDNA virus in some pathogenic bacterium, can not realize the folic acid circulation owing to lack the gene of coding Tetrahydrofolate dehydrogenase (FolA), simultaneously do not contain thymidylate kinase and can not utilize ectogenic Nucleotide, can only be by the synthetic dTMP of B approach.Therefore, human body cell is to synthesize self required dTMP by two kinds of different thymidylate synthases (ThyA and ThyX, i.e. TS and FDTS) in two kinds of distinct modes with H.pylori.Studies show that though ThyX and ThyA catalysis dTMP synthetic all, the aminoacid sequence of the two, protein structure and catalyst mechanism are all fully different, do not have cross action between the two.In addition, studies show that: ThyX itself is also closely related with the generation of H.pylori infection back ulcer, is a kind of important virulence factor.Therefore, ThyX is good target in the design of H.pylori antibacterials.

2, thymidylate synthase becomes the important target of micromolecular inhibitor design in recent years owing to its vital role in DNA metabolism and gene expression regulation, is mainly used in antitumor and anti-infective aspect.

Optionally the ThyX inhibitor can make pathogenic bacterium dead because of the thymidylic acid dyssynthesis; Simultaneously, owing to only contain ThyA in the human cell, therefore can reduce the toxic side effect of medicine again as far as possible; Therefore, a lot of inhibitor at ThyX are used for anti-infective aspect.Studies show that simultaneously thymidylate synthase has dual-use function, it has participated in the synthetic of dTMP; As a kind of regulate albumen it by suppressing the expression of some gene participating in apoptosis of transcriptional regulatory, therefore in antitumor research, good application prospects is arranged, as far back as 2002, just there is the inhibitor of 5 kinds of thymidylate synthases to be applied to tumor treatment (raltitrexed, pemetrexed clinically, nolatrexed, ZD9331, and GS7904L), in recent years, anti-tumor small molecular at ThyA constantly increases, and has brought into play significant role in chemotherapy of tumors.In addition, by different pathogenic bacterium ThyX sequence alignments are shown, though ThyX homology between each bacterial strain is not high, in participating in 26 Key residues of substrate bonded, there are 16 to be conservative fully, therefore may have same or analogous active centre and substrate binding pocket.More than the explanation of these results of study, by the thymidylate synthase inhibitor suppress dTMP synthetic to come anti-infective and antitumor be feasible, this also provides some directive significances for the inhibitor design at the thymidylate synthase ThyX of H.pylori.Simultaneously, because the catalytic reaction of ThyX relates to the participation of multiple substrate and coenzyme, comprise substrate dUMP and coenzyme F AD and methylene tetrahydrofolate and NADP ⁺/ NADPH ⁺, the analogue of substrate or coenzyme can be as the competitive inhibitor of enzyme, thereby has increased the screening scope of inhibitor.

3, proteic structure is the basis of function, resolves the protein structure of ThyX, and the design of determining its active centre, substrate binding pattern, furtheing investigate its catalyst mechanism and micromolecular inhibitor is had the important theory directive significance and medical use is worth.

The research of protein expression (proteomics) and protein structure (structure biology), with the identification of study of human disease-related gene position, identify and the research of expressed protein structure and function is drug screening and find to have opened up limitless prospect, find to have brought opportunity to new drug, along with further developing of science and technology, it is the drug screening that lead compound is carried out on the basis that the investigator begins with proteinic crystalline structure, and this class screening method comprises:

Virtual drug screening and design (computer assisted medicinal design) based on protein three-dimensional structure.

The development of molecular biology and structure biology, the three-dimensional structure of many target proteins matter is provided, therefore, according to complementary principle, drug design method according to proteinic three-dimensional structure is widely used, it is different with traditional pharmaceutical chemistry method, be according to proteinic three-dimensional structure, find suitable with it small molecule structure at binding site, generally can be divided into two kinds of approach: one is based on the virtual screening that is also referred to as of database search, promptly according to the shape and the constitutional features of receptor binding site, the compound of organic molecule library is docked to receptor binding site one by one with its three-dimensional structure, in the small molecules database, finds the molecule suitable with combining site.

Thymidylate synthetase (ThyX) carries out medicinal design as target and screening especially has special advantages: (1) is inferred according to the function of ThyX, and it is the enzyme that participates in the helicobacter pylori important physiological function.Inhibitor at ThyX can directly suppress the synthetic of product dTMP, causes the death of helicobacter pylori, the drug effectiveness height.(3) ThyX albumen is very easy to express, and can obtain protein in a short time and carry out drug screening.(4) thymidylate synthetase (ThyX) of helicobacter pylori and Human thymidylate synthetase ThyA are inequality at protein sequence, protein structure and catalyst mechanism, and therefore the antibacterials security at the ThyX design is good, and the people is had no side effect.

By literature search, find open report with content same document of the present invention.

Summary of the invention

The thymidylate synthetase (ThyX) crystal preparation method who the purpose of this invention is to provide a kind of helicobacter pylori.Described crystalline structure is laid a good foundation for designing its micromolecular inhibitor and antibacterials.

The object of the present invention is achieved like this:

The crystalline structure of the thymidylate synthetase (ThyX) of helicobacter pylori has a=222.15, b=49.26, c=142.49; α=90 °, β=98.65 °, γ=90 ° structure cell unit, described crystalline albumen spacer is C2.

The proteic sequence signature of the thymidylate synthetase (ThyX) of helicobacter pylori is the nucleotide sequence shown in the SEQ ID NO:1.

The thymidylate synthetase (ThyX) crystalline biologic activity unit of helicobacter pylori, the limbs that each ThyX of described activity unit is made up of four ThyX monomer molecules, four couples of substrate dUMP and cofactor FAD molecule are arranged in each limbs, and each forms the enzymatic activity center jointly to the binding pocket of substrate dUMP and cofactor FAD and near amino acid.

Described limbs are the functional unit of ThyX.

Near the described active centre amino acid comprises Arg70, His71, Tyr110, Asn166, Asp167, Lys201.

Described substrate dUMP is folding fixing by coming from β 3, each FAD by the amino acid on three subunits that come from the limbs and its hydrogen bond fellowship that forms to its fixed action.

Described participation FAD bonded amino acid comprises Arg70, His71, Ser73, Glu76, Arg97, Val105, Tyr110, Arg188, Asn192 and Leu196 etc.Participate in dUMP bonded amino acid and comprise Arg89, Glu94, Arg97, Ser107, Ser108, Arg109, Lys170 and Arg197 etc.

The crystalline preparation method of the thymidylate synthetase (ThyX) of helicobacter pylori has following steps:

1) with the thyX gene clone in helicobacter pylori 26599 genomes to expression vector pET-30a, obtain the pET30a-ThyX recombinant plasmid, recombinant plasmid through transform, express, induce, purifying, obtain purity and all once high ThyX albumen;

2) the meteorological diffusion process of step 1) gained albumen utilization hanging drop is carried out crystallization and is obtained the proteic crystal of ThyX;

3) with the precession method to step 2) in the single crystal that obtains carry out X-ray diffraction and collect data, handle and collect the diffraction data that obtains, with the molecular replacement method of Molecular Replacement, obtain the crystal of ThyX.

The present invention is by cloning the thyX gene in the gene to helicobacter pylori (Helicobacter pylori) 26695, be cloned among the expression vector pET-30a, after the LB liquid nutrient medium amplification culture, after inducing 4 hours in substratum a large amount of thymidylate synthetase of secreting, expressing.And then to carrying out the sieve chromatography purifying through affinity chromatography with on AKTA (GE) purifying instrument behind the bacterial cell disruption.Check proteic purity by SDS-PAGE.(Millipore USA) is concentrated to higher concentration with it with the ultrafiltration and concentration pipe behind the albumen that obtains electrophoresis pure (＞95%).Using hanging drop gas phase diffusion method to carry out crystal then cultivates.The crystallization condition screening reagent box of Hampton (USA) company is used in the screening of crystallization condition.After obtaining good screening conditions, promptly under this condition, cultivate albumin crystal.The crystal diffraction on roentgen machine that obtains.Use HKL2000,0, softwares such as ccp4 are handled, final this proteic three-dimensional structure that obtains.

The present invention discloses the crystalline structure of thymidylate synthetase (ThyX) of helicobacter pylori first, for next step designs its micromolecular inhibitor and antibacterials are laid a good foundation.The micromolecular inhibitor of design is by blocking substrate dUMP or/and the binding site of cofactor FAD and enzyme ThyX on the space structure; On the other hand by important amino acid site in the pocket of blocking-up ThyX active centre; Thereby reach blocking-up helicobacter pylori ThyX catalysis dTMP route of synthesis, cause helicobacter pylori and can't grow, reach the effect of anti-helicobacter pylori owing to lack dTMP.

Description of drawings

Fig. 1 is the scintigram that the SDS-PAGE of ThyX protein in purge process analyzed;

The ThyX protein crystal that Fig. 2 obtains;

Fig. 3 shows ThyX-FAD-dUMP enzyme 3 d structure model.Fig. 3 A and Fig. 3 B are respectively vertical view and side elevational view, can observe substrate among Fig. 3 A and be combined in structure centre, and avtive spot is positioned at substrate in conjunction with the center;

Fig. 4 is a ThyX protein substrate dUMP binding pocket amino acid composition diagram;

Fig. 5 is a ThyX albumen cofactor FAD binding pocket amino acid composition diagram;

Fig. 6 is that ThyX proteolytic enzyme catalytic center pocket amino acid is formed.

Embodiment

Reagent

The worker is given birth in primer Shanghai

Restriction endonuclease Takara

Hampton?Research?Kits Hampton?USA

Instrument

AKTA purifying instrument Hiload 16/60 Superdex200 prep grade GE

Ultrafiltration and concentration pipe Millipore, USA

Whizzer Hitachi, himac CRT, rotor R5S2

Ni-NTA post 5ml Novagen

Clone the ThyX gene in the gene of helicobacter pylori (Helicobacter pylori) 26695, be cloned among the expression vector pET-30a, after the LB liquid nutrient medium amplification culture, after inducing 4 hours in substratum a large amount of thymidylate synthetase of secreting, expressing.And then to carrying out the sieve chromatography purifying through affinity chromatography with on AKTA (GE) purifying instrument behind the bacterial cell disruption.Check proteic purity by SDS-PAGE.(Millipore USA) is concentrated to higher concentration with it with the ultrafiltration and concentration pipe behind the albumen that obtains electrophoresis pure (＞95%).Using hanging drop gas phase diffusion method to carry out crystal then cultivates.The crystallization condition screening reagent box of Hampton (USA) company is used in the screening of crystallization condition.After obtaining good screening conditions, promptly under this condition, cultivate albumin crystal.The crystal diffraction on roentgen machine that obtains.Use HKL2000,0, softwares such as ccp4 are resolved and the optimization protein structure.

Concrete steps of the present invention are as follows

1, the clonal expression of ThyX

The ThyX gene order of announcing according to GenBank (NCBI-Gene ID:899757) designs primer (P1:5 ' GG AAT TC CATATGTGGATCA CCCAAGAAAC 3 '; P25 ' CGGCTCGAGATGCTTCAAACAATCTTC 3 '), wherein upstream primer is introduced the NdeI restriction enzyme site, downstream primer removes terminator codon and adds the XhoI restriction enzyme site), pcr amplification ThyX full-length gene, adopt NdeI, XhoI enzyme to be connected to expression vector pET-30a after cutting, Transformed E .coli BL21 (DE3), the Screening and Identification positive recombinant.IPTG 1mM final concentration, 37 ℃ of temperature, induction time 4 hours.The expression of SDS-PAGE electrophoresis detection ThyX.

2, the purifying of ThyX

(1) through after the thalline amplification culture, 2L bacterium liquid is collected thalline in 4 ℃ of centrifugal 30min of 4000rpm (Hitachi, himac CRT, rotor R5S2).After discarding the upper strata substratum, bacterial sediment utilizes vibration of vortex vibrator and pipettor to inhale repeatedly and blows abundant suspension thalline, the final about 30ml of bacterial suspension with the resuspended thalline of Lysis buffer of 30ml ice precooling.

(2) ultrasonic cell-break machine lysing cell (the new sesame in Ningbo, JY92-IIN), working parameter is made as power 300W, working hour 3s, pitch time 6s, multiplicity 150 times.Ultrasonic end can be observed bacterium liquid and has been transformed into yellow translucently by the thickness yellow shape that turns white, and then bacterial lysate is transferred in the centrifuge tube, and with 14,000g high speed centrifugation 30min collects supernatant in 4 ℃ of precooling whizzers.

(3) Ni-NTA post (Novagen, 5ml) affinitive layer purification.Ultraviolet Detector monitors the 280nm photoabsorption, and the peristaltic pump flow velocity is made as 1ml/min.To split bacterium supernatant part and slowly be added to the Ni-NTA chromatography column of using Lysis buffer balance good in advance, target protein is because C has 6 His-tag on holding, but specificity is incorporated on the gel media of Ni-NTA.Use Wash buffer behind the end of the sample instead and walk 10 CV of pillar (column volume), in the hope of using the lower concentration imidazoles with the abundant flush away of the albumen of non-specific binding in the pillar, wash is to the stable reading of Ultraviolet Detector, re-use Elution buffer wash-out target protein, the imidazoles of high density can be competed in conjunction with Ni, makes the target protein wash-out, keeps a close eye on the uv-absorbing uphill process, collect elution peak, 4 ℃ of placements.Treat that SDS-PAGE identifies its expression amount and purity.After the albumen wash-out is finished, Elution Buffer is continued to wash after 5 column volumes of pillar, successively change pure water and 20% ethanol into and respectively wash 5 column volumes, pillar is packed up 4 ℃ of preservations.The record uv-absorbing changes in whole chromatography process.

(4) sieve chromatography.The Ni-NTA post elution peak of collecting is used molecular weight cut-off 10,000 centrifugal ultrafiltration evaporating pipes (Millipore, Amicon Ultra-15,10K NMWL), the centrifugal 1ml that is concentrated into of 2100g RCF.Use earlier 20mM TrispH7.5 before using molecular sieve Hiload 16/60 Superdex200 prep grade, 150mM NaCl, 2mM DTT, 5% glycerine damping fluid pre-equilibration, then 1ml albumen is concentrated sample on the concentrated solution, flow velocity 1ml/min is set, absorbancy wavelength monitoring 280nm and 445nm, collect different elution peaks, SDS-PAGE electrophoresis detection purity of protein (Fig. 1).

3, the crystallization of enzyme

Parent ThyX recombinant protein is collected the limbs peak and is concentrated to certain volume by behind the sieve chromatography, and this moment, the composition of proteic damping fluid composition and molecular sieve damping fluid was consistent (50mM Tris-HCl, pH 7.5,150mM NaCl, 5% glycerine).In protein concentrate solution, add the long-pending parent diluted protein solution (50mMTris-HCl of diploid, pH 7.5,5% glycerine), making the composition of the final damping fluid of albumen is (50mM Tris-HCl, pH7.5,50mM NaCl, 5% glycerine), continue to be concentrated into about 15mg/ml, carry out the crystallization condition search, concentration is determined by the PCT experiment, and is carried out 2 and 4 times of dilutions with damping fluid.What the crystallization of ThyX was adopted is hanging drop gas phase diffusion method, and 1 μ l albumen and 1 μ l pond liquid are mixed a little on the cover glass of silication, and back-off is sealed on the groove that contains 450 μ l pond liquid, carries out the crystallization of hanging drop gas phase diffusion at 16 ℃.Through the Index under the room temperature condition, Crystal Screen, the search of the preliminary crystallization condition of Hampton Research Kits such as Crystal Screen2.On 1st, observe after three days respectively,, yellow crystallite occurred among 2.0MAmmonium Sulfate and the 1.4M Sodium/Phosphate pH8.2 at 0.1M HEPES pH7.5.

The optimizing process of ammonium sulfate condition simply is described below: the 1. concentration screening of ammonium sulfate, determine that 2M-2.4M ammonium sulfate is more suitable.2. the pH value of crystallization solution screening, pH 4.0-10.0,0.5 pH interval of elder generation, pH4.0, pH4.50.1M sodium acetate; PH5.0, pH5.5,0.1M Trisodium Citrate; PH6.0, pH6.50.1M neoarsycodile; PH7.0, pH7.50.1M HEPES; PH8.0, pH8.50.1M Tris; PH9.0, pH9.50.1M CAPSO; PH10.0CAPS; Observe crystal maximum under the pH7.0 condition.Fine tuning pH again, 0.1MHEPES between pH7.0-8.0 0.2 pH at interval, it is best to draw the crystal boundary that goes out under the pH6.8-7.2.3. the additive screen of Hamptom Research and detergent screen find that 300mM NaKTar makes crystal become big.4. organic screening: contained glycerine, Virahol, ethylene glycol etc. find that glycerine and ethylene glycol can make crystal become big, but only there is glycerine that crystal shape is become corner angle are arranged more, and ethylene glycol can make crystal become circle.The crystal growth condition of Que Dinging is a 2.4M ammonium sulfate at last, 0.1M HEPES pH7.0,300mMNaKTar, 5% glycerine.Obtain to have the yellow ThyX crystal (Fig. 2) of better diffraction force at last.

4, X-ray diffraction and structure elucidation

The ThyX crystalline diffraction data that are used for structure elucidation are built in Japan on the synchrotron radiation station photon factory beam line 17A of ripple and are collected, and the temperature 95K of data gathering, the detector of use are the CCD of ADSC Quantum series.All data are all from same ThyX crystal.

Use Mosflm (V7.0.4) finishes the indexing to data, to the correction of described ThyX crystal parameter and parameter detector, the integration of strength values.Use the pointless in the CCP4 (V6.1.1) to determine spacer, and by inspection scattering h00,0k0,001 delustring rule has been determined the exactness of spacer.The merging of intensity data, conversion and data statistic analysis from diffracted intensity to the structure factor amplitude are finished by Scala.

After collecting proteic X ray diffracting data, at first using (comprising Mosflm etc.) software such as HKL2000 that previous step is collected the diffraction data that obtains in rapid handles, obtain complete data file: secondly, use Phaser, Molrep etc. in CNS or the CCP4 routine package, utilize the method for molecular replacement (MolecularReplacement), obtain the fine three dimensional structure of albumen ThyX and substrate.

By the existing model of other bacterial classifications, adopt different monomers or disome to adopt the molecular replacement method of phaser, amore, molrep respectively, look for six molecules.The final phase information preferably that obtained.Specific as follows:

The data that adopt are ThyX parent crystalline data, and resolving power is

(1) selection of model

Selected in the PDB storehouse model as molecular replacement respectively, also can only adopt a kind of model with the highest two existing structure 1KQ4, the 1V4E of H.pylori ThyX homology.

(2) adopt chainsaw that model is carried out pre-treatment (optional)

At first be to be the sequence of H.pylori ThyX with the series jump among the model, remove the sequence that some are not compared among the model, promptly unnecessary sequence is removed the H among the model simultaneously ₂Small molecules such as O, ion, ligand.The model that obtains like this helps molecular replacement and is better separated, especially when the identity of sequence is low relatively.

Chainsaw will import two files: one is the .pdb file of model; Another is align file (a pir form), can generate by clusterW2.

(3) molecular replacement

Matthews correlation shows in asymmetry unit of H.pylori ThyX may exist 3-8 molecule.Its chromatography behavior is limbs under solution state.The spinning function shows and has tangible noncrystal six fold axis.

We adopt Phaser to carry out molecular replacement, and the disome that adopts the 1V4E behind 1KQ4 and the Superpose is sought 3 molecules as model, i.e. 6 bodies, and separating of obtaining can not further be revised, and Rfree is more than 50, the density map poor continuity that obtains.But on the model that obtains from the molecular replacement result, the very approaching correct model of the structure of hexasomic.Consider that there is noncrystal symmetry in ThyX, next step adopts DM to be solvent flattening by six-fold averageing.

(4)FreeRflag(optional)

FreeRflag's do not need this step for having had in the .mtz file that obtains.The .mtz file generate that is obtained by initial integration obtains freeRflag.

(5)FreeRflag(optional)

The above-mentioned freeRflag that obtains is incorporated in the .mtz file of the model correspondence that obtains behind the molecular replacement.

(6)NCSmask

Two molecule bc among the result who is obtained by molecular replacement generate a .mask file bc.mask.

(7) to make solvent level and smooth for DM

Adopt the following resolving power of 5 dusts to carry out solvent flattening.

Select perturbation using all reflections.

Select solvent average, and other molecules can obtain with respect to the postrotational angle of some molecules very translation parameters in the model that the input of corresponding position obtains by Superpose.

Move 100 circulations.

Behind the end of run to the density map continuity is clearly better, and the FOM value directly rises to 0.749 from original 0.185.

(8) adopt DM to carry out the phase place expansion

Select perturbation using phase extension resolution step.

Phase place is extended to resolving power 2.5 dusts.

Move 1000 circulations.

FOM rises to more than 0.8 behind the end of run, and density map is further improved.

(9)Resolve

Adopt Resolve further density to be revised.

(10)Arpwarp

Adopt the above-mentioned .mtz file that obtains to take mould automatically, about 90% AA finishes by taking mould automatically, and remaining manually finishes.

Structural modifications

The correction of ThyX structure is carried out in routine package CNS (V1.21), and the adjustment of model is finished with coot (V5.0.2).

Final this proteic three-dimensional structure (Fig. 3 A, B) that obtains.By the aminoacid sequence in the three-dimensional structure can see the structure that is obtained actual be that the 2nd methionine(Met) (the 24th amino acids) from the ThyX protein sequence begins to express, the amino acid of back can be observed in structure until last the 231st amino acids, and this can illustrate that this structure is the ThyX proteic three-dimensional structure of 1-3 in the step really.

5, helicobacter pylori ThyX key amino acid site is analyzed

The active centre of the helicobacter pylori thymidylate synthetase that above-mentioned embodiment obtains, wherein each ThyX is made up of four ThyX monomer molecules, and limbs are its functional unit.Four couples of substrate dUMP and cofactor FAD molecule are arranged in each limbs, therefore 4 substrate binding pockets are arranged.By bonded substrate dUMP and cofactor FAD in the ThyX structure that obtains, according to these the two kinds micromolecular binding site analyses that participate in catalytic process, determined the substrate binding pocket of this enzyme, the enzymatic activity central pocket of the binding pocket of cofactor FAD and ThyX.Each FAD to its fixed action, comprises Arg70, His71, Ser73, Glu76, Arg97, Val105, Tyr110, Arg188, Asn192 and Leu196 etc. by the amino acid on three subunits that come from the limbs and its hydrogen bond fellowship that forms.Each substrate dUMP is mainly fixed by the amino acid that comes from β 3 pleated sheets, comprises Arg89, Glu94, Arg97, Ser107, Ser108, Arg109, Lys170 and Arg197 etc.

Comprise amino acid such as Arg97, His98, Arg197, Asn186.Enzyme active center is made of jointly substrate dUMP and cofactor FAD binding pocket and near amino-acid residue, and important amino acid comprises Arg70, His71, Tyr110, Asn166, Asp167, Lys201 etc. near the active centre.

Table one ThyX crystal parameter diffraction data

Rmerge＝∑hkl∑i|Ii(hkl)-<I(hkl)>|∑hkl∑iIi(hkl)，where<I(hkl)>

is?the?mean?of?the?observations?Ii(hkl)of?reflection?hkl.

*Numbers?in?parentheses?are?for?the?highest?resolution?shellbetween?2.64?and

6, virtual screening

Select the model of the amino acid of ThyX albumen catalytic activity residue and participation substrate dUMP and cofactor FAD binding pocket composition as virtual screening, the figure of binding pocket sees Fig. 4,5.With molecular docking (Molecular Docking) and virtual screening (Virtual Screening) method, searched the drug data base CMC of MDL company, use of the important amino acid site analysis of Insight II software simultaneously, filter out the compound of being selected with above-mentioned important amino acid site high-affinity to participating in substrate and cofactor binding site and participating in the enzyme catalysis process.

Obtain the crystalline structure of thymidylate synthetase (ThyX) of helicobacter pylori, for next step designs its micromolecular inhibitor and antibacterials are laid a good foundation.The micromolecular inhibitor of design can be by blocking-up substrate dUMP on the space structure or/and the binding site of cofactor FAD and ThyX; By important amino acid site in the pocket of blocking-up ThyX active centre, block helicobacter pylori ThyX catalysis dTMP route of synthesis on the other hand, cause helicobacter pylori and can't grow owing to lack dTMP thereby reach.Finally reach the effect of anti-helicobacter pylori.Not only the germ resistance at helicobacter pylori is strong to go up the medicine that designs based on this mechanism, and human body has no side effect simultaneously, and can not produce resistance, and generally speaking, this type of medicine has good security, validity and stability.

Claims (7)

1. the crystal of the thymidylate synthetase (ThyX) of a helicobacter pylori, it is characterized in that: described crystalline structure has a=222.15, b=49.26, c=142.49; α=90 °, β=98.65 °, γ=90 ° structure cell unit, described crystalline albumen spacer is C2.

2. the albumen of the thymidylate synthetase (ThyX) of the described helicobacter pylori of claim 1, its sequence signature is to have the nucleotide sequence shown in the SEQ ID NO:1.

3. the thymidylate synthetase (ThyX) crystalline biologic activity unit of the described helicobacter pylori of claim 1, it is characterized in that: the limbs that each ThyX of described activity unit is made up of four ThyX monomer molecules, four couples of substrate dUMP and cofactor FAD molecule are arranged in each limbs, and each forms the enzymatic activity center jointly to the binding pocket of substrate dUMP and cofactor FAD and near amino acid.

4. activity unit according to claim 3 is characterized in that: near the amino acid the described active centre comprises Arg70, His71, Tyr110, Asn166, Asp167 and Lys201.

5. activity unit according to claim 3 is characterized in that: described substrate dUMP is folding fixing by coming from β 3, each FAD by the amino acid on three subunits that come from the limbs and its hydrogen bond fellowship that forms to its fixed action.

6. activity unit according to claim 5, it is characterized in that: participate in FAD bonded amino acid during described ThyX is proteic and comprise Arg70, His71, Ser73, Glu76, Arg97, Val105, Tyr110, Arg188, Asn192 and Leu196 participate in dUMP bonded amino acid and comprise Arg89, Glu94, Arg97, Ser107, Ser108, Arg109, Lys170 and Arg197 during ThyX is proteic.

7. the crystalline preparation method of the described ThyX of claim 1 is characterized in that following steps are arranged:

1) with the thyX gene clone in helicobacter pylori 26599 genomes to expression vector pET-30a, obtain the pET30a-ThyX recombinant plasmid, recombinant plasmid through transform, express, induce, purifying, obtain purity and all once high albumen ThyX;

2) step 1) gained albumen carries out the meteorological diffusion process of hanging drop and carries out crystallization;

3) collect X ray diffracting data with the precession method, handle and collect the diffraction data that obtains,, obtain the crystal of ThyX with the molecular replacement method of MolecularReplacement.

Images