CN101886104B - Method for preparing human chromosome P16 gene probe and application thereof - Google Patents
Method for preparing human chromosome P16 gene probe and application thereof Download PDFInfo
- Publication number
- CN101886104B CN101886104B CN 200910039411 CN200910039411A CN101886104B CN 101886104 B CN101886104 B CN 101886104B CN 200910039411 CN200910039411 CN 200910039411 CN 200910039411 A CN200910039411 A CN 200910039411A CN 101886104 B CN101886104 B CN 101886104B
- Authority
- CN
- China
- Prior art keywords
- gene
- probe
- clone
- human chromosome
- gene probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for preparing a human chromosome P16 gene probe and also relates to a method for preparing a human chromosome P16 gene detection kit by using the human chromosome P16 gene probe. The human chromosome P16 gene probe and the corresponding kit can be applied to accurately and rapidly detecting human chromosome P16 genetic abnormality.
Description
Technical field
The present invention relates to a kind of preparation method of human chromosome P 16 gene probe, also relate to and utilize human chromosome P 16 gene probe to prepare a kind of human chromosome P 16 gene detection kit, use human chromosome P 16 gene probe of the present invention and corresponding test kit and can detect extremely accurately and rapidly human chromosome P 16 gene.
Background technology
The P16 gene is again MTS (multiple tumor suppressor 1) gene, be positioned human chromosome 9p21, participate in Control of cellcycle directly, negative regulator cell proliferation and division, finding in the mankind's 50% tumor cell line has homozygous deletion, sudden change, thinks that P16 is than the prior a kind of new type anticancer gene of P53.the P16 gene is in lung cancer, mammary cancer, cerebral tumor, bone tumor, skin carcinoma, bladder cancer, kidney, ovarian cancer, find homozygous deletion and nonsense in lymphoma and melanoma, missense and phase shift mutation [Kaye FJ.RB and cyclin dependent kinase pathways:defining a distinctionbetween RB and p16 loss in lung cancer[J] .Oncogene, 2002, 21 (45): 6908-6914.] [BazanV, Zanna I, Migliavacca M, et al.Prognostic significance of p16INK4a alterationsand 9p21 loss of heterozygosity in locally advanced laryngeal squamous cell carcinoma[J] .J Cell Physiol, 2002, 192 (3): 286-293.] [Yoshida S, Todoroki T, Ichikawa Y, etal.Mutations of p16Ink4/CDKN2 and p15Ink4B/MTS2 genes in biliary tract cancers[J] .Cancer Res, 1995, 55 (13): 2756-2760.] [Calero Moreno TM, Gustafsson G, GarwiczS, et al.Deletion of the Ink4-locus (the p16ink4a, p14ARF and p15ink4b genes) predicts relapse in children with ALL treated according to the Nordic protocolsNOPHO 86 and NOPHO 92[J] .Leukemia, 2002, 16 (10): 2,037 2045.], show that the P16 gene is with disappearance, sudden change mode wide participation tumour forms, detecting the P16 gene has or not change to the susceptibility of judgement patient tumors and the prognosis of predicting tumors, has very important clinical meaning.
Genome analysis commonly used at present can be carried out the analysis of chromosome abnormalty, but this need to carry out cell cultures and the high-quality Metaphase Chromosome sheet of preparation, and this is extremely difficult and consuming time for tumour cell.In order to solve this technical barrier, one of them thinking is screen and prepare corresponding sectional analysis gene probe, but chromosome segment analyzing gene probe prepares the method that lacks a system and maturation at present.
The inventor designs on the basis that studies for a long period of time and screens human chromosome P 16 gene probe, and utilizes fluorescence in situ hybridization technique to detect human chromosome P 16 gene in mid-term or interval cell.It uses double-stranded DNA nucleic acid probe and the chromosomal DNA complementary sequence hybridization of fluorescent substance mark, the position of show dna sequence in core or on karyomit(e).The inventor also develops human chromosome P 16 gene detection kit on this basis, that this test kit has is quick, non-invasive, susceptibility is high and the advantage such as high specificity, need not to carry out cell cultures, just can detect the abnormal of human chromosome P 16 gene in mid-term and interval cell.
Due to the preparation method who the invention provides this human chromosome P 16 gene probe, and independent research and development human chromosome P 16 gene detection kit on this basis, to breaking away from the dependence to import reagent, the blank of filling up domestic this detection field has very great meaning.
Summary of the invention
An object of the present invention is to provide a kind of preparation method of human chromosome P 16 gene probe.
The preparation process of a preferred embodiment human chromosome P 16 gene probe comprises according to the present invention:
(1) colony screening: the P16 gene is positioned at human chromosome 9p21 section, selects to include this gene cloning.
(2) clone's culture ﹠ identification: buy the clone, get appropriate clone bacterium liquid and add in the TB nutrient solution (chlorampenicol resistant) of 500ml, shake bacterium in 37 ℃ of shaking tables and cultivated 24~48 hours; Use the STS primer pair to carry out clone identification.
(3) P16 gene probe preparation: to identifying positive bacterium liquid, carry out the extraction of plasmid DNA; By suitable dilution plasmid DNA, quantitative to plasmid DNA; Then, by the nick translation method, plasmid DNA is carried out fluorescent mark; Marked product is carried out ethanol precipitation and concentrated; Obtain the P16 probe, lucifuge ,-20 ℃ of storages.
(4) P16 gene probe checking: use mankind's proper splitting lymphocyte in mid-term to drip sheet and carry out the probe checking.
Preferred embodiment according to the present invention, the clone who selects in the colony screening step number is: RP11-149I2 (Invitrogen RPCI11.C).
Preferred embodiment according to the present invention, the STS primer sequence that uses in clone's culture ﹠ identification step is respectively upstream primer 5 '-ATCCAACATGCCATAGCTCC-3 ' and downstream primer 5 '-TTTGTCCCATGTCACTGGAA-3 ', and the pcr amplification condition is: 95 ℃ 5 minutes; (94 ℃ 30 seconds, 56 ℃ 30 seconds, 72 ℃ 45 seconds) * 40 circulations; 72 ℃ 10 minutes.
Preferred embodiment according to the present invention, in P16 gene probe preparation process, the cloned plasmids DNA extraction can be used commercially available plasmid extraction kit, the Plasmid Maxi Kit of preferred Qiagen company.
Preferred embodiment according to the present invention, in P16 gene probe preparation process, cloned plasmids DNA's is quantitatively the absorbancy that will measure respectively after the plasmid DNA dilution under 260nm and 280nm, calculates production concentration.
Preferred embodiment according to the present invention, in P16 gene probe preparation process, plasmid DNA is carried out fluorescent mark and can be used commercially available nick translation labelling kit, the Nick Translation Kit of preferred abbott company.
Preferred embodiment according to the present invention, the fluorescein of P16 Probe labelling is fluorescein-labeled dUTP, and preferred Spectrum dUTP.
Preferred embodiment according to the present invention, P16 gene probe concentration method are that the ethanol precipitation is concentrated, use at last 5ulHuman Cot-1DNA (1ug/ul) dissolution precipitation.
Another object of the present invention is to utilize the P16 gene probe to prepare a kind of P16 gene probe detection kit.
In order to realize the present invention, we have adopted following technical scheme:
(1) sample process and film-making: all types of samples are processed according to in-situ hybridization method.
(2) hybridization: preparing hybrid liquid mainly comprises label probe and hybridization buffer.Carry out the hybridization of 8~16 hours under suitable temp, then wash away not in conjunction with upper and probe non-specific binding with suitable washing lotion; The DAPI counterstain is redyed.
(3) observe fluorescent signal by the corresponding filter block of fluorescent microscope, observe the P16 gene and whether lack or increase.
Test kit based on the invention of above technical scheme comprises: 1) hybridization solution, DAPI counterstain, and 2) separate and concentrate the packing box of packing these reagent bottles or pipe.
According to a preferred embodiment of the invention, by hybridization buffer, fluorescently-labeled P16 gene probe and H
2O is mixed with hybridization solution, wherein uses the amount of P16 gene probe to be 1.5ul~3ul in every person-portion hybridization solution, and hybridization buffer is 7ul, uses H
2O mends to 10ul.
According to a preferred embodiment of the invention, the component of hybridization buffer comprises deionized formamide, SSC, and T 500, wherein deionized formamide concentration is 50%~70%, T 500 concentration is 0.1g/ml.
According to a preferred embodiment of the invention, wherein DAPI counterstain compound method is that 50~250ng DAPI is dissolved in the anti-liquid (10mg/ml Ursol D/PBS, glycerine mixed solution) that fades of 1ml.
Utilize test kit of the present invention, according to the fluorescence in-situ hybridization method of routine to mid-term of people and interval cell carry out the P16 gene test.
The present invention compared with prior art has following advantages:
(1) can detect accurately and rapidly and good reproducibility as a result people P16 gene;
(2) need not to carry out cell cultures and the high-quality Metaphase Chromosome sheet of preparation, can be used for mid-term or interval cell P16 gene counting, operate relatively simple;
(3) by being prepared into test kit, can realize the application in fields such as oncobiology, cytogenetics, antenatal diagnosis, understand contacting of P16 gene and tumour generation etc.
Description of drawings
Fig. 1 shows the electrophoresis result of clone identification.Purpose product 184bp.
Fig. 2 shows mankind's proper splitting lymphocyte in mid-term P16 gene test result.
Embodiment
The following example is intended to illustrate rather than limit the present invention.
Embodiment 1: the preparation method of people P16 gene probe
(1) design of primers colony screening: the P16 gene is positioned at human chromosome 9p21 section, selects to include this gene cloning: RP11-149I2.
(2) clone's culture ﹠ identification: buys corresponding clone Invitrogen RPCI11.C, get in the TB nutrient solution (chlorampenicol resistant) that 50ul adds 500ml to, shake bacterium cultivation 24~48 hours in 37 ℃ of shaking tables; Bacterium liquid uses the STS primer pair to carry out clone identification.The STS primer pair: upstream primer 5 '-ATCCAACATGCCATAGCTCC-3 ' and downstream primer 5 '-TTTGTCCCATGTCACTGGAA-3 ', the pcr amplification condition is: 95 ℃ 5 minutes; (94 ℃ 30 seconds, 56 ℃ 30 seconds, 72 ℃ 45 seconds) * 40 circulations; 72 ℃ 10 minutes.Amplified production carries out the electrophoresis checking, and the 184bp left and right has bright band (referring to accompanying drawing 1) as a result.
(3) P16 gene probe preparation: identify positive bacterium liquid, use the Plasmid Maxi Kit of Qiagen company, the working method that requires is to specifications carried out ultralow copy extraction of plasmid DNA, and is quantitative to plasmid DNA by the absorbancy of measuring 260nm and 280nm place; According to formula: double-stranded DNA concentration (ng/ul)=OD260 * 50 (ng/ul) calculates plasmid DNA concentration.Adopt autoclaved ultrapure water dilution to be 100ng/ul, adopt the centrifuge tube packing of 1.5ml ,-20 ℃ of sealings are preserved.
By the nick translation method, plasmid DNA is carried out fluorescent mark, the fluorescein of probe mark is Spectrum dUTP.Adopt the Nick Translation Kit of abbott, by following scheme, prepare the PCR reaction system on ice under strict lucifuge condition.
10×NT buffer 5ul
dTTP(1mM) 0.5ul
d3TPs(1mM) 1ul
Spectrum-Orange dUTP 0.5ul
NT enzyme 10ul
DNA(100ng/ul) 10ul
H
2O 23ul
Cumulative volume 50ul
Joined rear concussion mixing, 15 ℃ of marks 12 hours, then 70 ℃ hatched 10 minutes inactivators.Get 5ul and use 2% sepharose to do electrophoresis, require to exist the band of disperse between 100-500bp.
Marked product is carried out ethanol precipitation and concentrated, add successively sodium-acetate and dehydrated alcohol by following scheme in the 1.5ml centrifuge tube, lucifuge, preparation on ice:
Marked product 45ul
Human Cot-1DNA 5ul
Sodium-acetate (3mol/L) 5ul
Dehydrated alcohol 125ul
Mixing is placed in-70 ℃ of refrigerators at least 2 hours, and centrifugal 30 minutes of 4 ℃ of 13000rpm carefully remove supernatant, stir precipitation, add 70% ethanol of 1ml, 4 ℃ 13000 rev/mins centrifugal 15 minutes, carefully remove supernatant, stir precipitation, lucifuge is dry.Use 5ul Human Cot-1 DNA (1ug/ul) dissolution precipitation, obtain the P16 gene probe, lucifuge ,-20 ℃ of storages.
(4) P16 gene probe checking: use mankind's proper splitting lymphocyte in mid-term to drip sheet and carry out the probe checking.Comprise mid-term or interphase chromosome DNA, during fluorescence in situ hybridization, chromosomal DNA shows as discernible karyomit(e) or nucleus on form.
The preparation of embodiment 2:P16 gene detecting kit
Take 10 person-portions/box as example.
(1) hybridization solution preparation
The P16 gene probe that takes a morsel is diluted to 50ng/ul, according to the form below preparing hybrid liquid:
(2) DAPI counterstain preparation
The anti-liquid that fades: the necessary lucifuge of substantial length of operation, the Ursol D of 10mg is dissolved in the PBS of 1ml, adds 9ml glycerine, repeatedly shakes mixing, and regulating pH is 9.0 ,-20 ℃ of storages.Whole solution should be for colourless or slightly faint yellow, if present yellow or the orange abandoned well that needs is prepared again.
With deionized water preparation 1mg/ml DAPI storage liquid.
The DAPI solution (1mg/ml) of getting 2.5ul is dissolved in the anti-liquid that fades of 1ml, repeatedly shakes mixing under the lucifuge condition ,-20 ℃ of airtight preservations of lucifuge.
(3) finished product assembling
The component title | Specification | Quantity |
Hybridization solution (containing the P16 gene probe) | The 100ul/ pipe | 1 pipe |
The DAPI counterstain | The 100ul/ pipe | 1 pipe |
Specification sheets | 1 part |
The using method of embodiment 3:P16 gene detecting kit
Take mankind's proper splitting lymphocyte in mid-term as example.
(1) human peripheral is cultivated and the karyomit(e) preparation
Blood sampling: after the wetting injection needle tube of heparin (0.2ml), conventional extracting vein blood 1~2ml rotates syringe mixing heparin.Inoculation (aseptic technique in Bechtop): in each culturing bottle (RPMI-1640 5ml, the pH7.2 that contain 20% serum), add whole blood 0.25~0.30ml (No. 7 syringe needle 13~15), PHA 5mg, cover tightly plug, shake up gently.Cultivate: culturing bottle is placed in 37 ℃ of constant incubators cultivates 72h.Stop cultivating front 2~4h, add 1~2 of 0.01% colchicine solution (100 μ g/ml) (No. 7 syringe needles), making final concentration is 0.2 μ g/ml nutrient solution.After shaking up gently, put back to incubator and continue to cultivate 2~4h.Results: the hemocyte after cultivating is collected in centrifuge tube, the centrifugal 8min of 1000r/min after balance, supernatant discarded.
(2) sample preparation
Hypotonic: as to add 37 ℃ of 0.075mol/L KCl solution to 8ml in centrifuge tube, blow and beat gently the mixing cell with suction pipe, be placed in 37 ℃ of water bath incubation 15min.Pre-fix: drip the methyl alcohol of new preparation-Glacial acetic acid stationary liquid 1~2ml in the centrifuge tube, blow and beat gently the centrifugal 8min of 1000r/min after mixing, supernatant discarded with suction pipe.Fixing: as to add the stationary liquid of new preparation to 8ml, the standing 30min of room temperature.The centrifugal 8min of 3000r/min, supernatant discarded.Can repeat again to fix 1 time.Film-making: according to what of sedimentation cell, (0.5~1ml), cell suspension is made in piping and druming gently to add the proper amount of fresh stationary liquid.Draw a small amount of cell suspension with dropper, drop on slide glass microscopy.
(3) film-making
Get clean slide, get respectively 3ul after re-suspended cell, 10ul and 30ul suspension are added drop-wise to the different positions on slide glass, note not overlapping; Dry under room temperature; Observe trizonal cell density with 20 * object lens under phase microscope, record cell obviously not overlapping, and quantity is in added cell suspension amount more than 100~200; If cell density and number are suitable, separately get a clean slide glass, drip appropriate cell suspension; If the zone that drips the 30ul suspension still the cell a few days very little, separately get the 30ul suspension and repeat to drip to this zone, dry, observe; If still cell number is too many in the zone of dropping 3ul suspension, with fresh stationary liquid diluting cells suspension, repeating step drips sheet to be observed.
(4) slide ethanol is aging
Hot platform is heated to 95 degree; Take out cover glass, dry standby; One is folded into 4~8 layers of square gauze, soaks into dehydrated alcohol; Respectively drip the dehydrated alcohol of 160ul on the hybridization zone of slide glass; Cover gently the cover glass of 24 * 24mm, the light compression; Slide glass is placed on the hot platform of 95 ℃ of preheatings, covers the gauze (covering slide glass fully) that has soaked into dehydrated alcohol, then cover previously prepd square cover (covering slide glass fully), timing 2 minutes; From hot platform removing caps, gauze, take off slide glass, remove gently cover glass, continue pre-treatment step.
(5) slide pre-treatment
Slide is put into the 1 * PBS of 37 ± 1 ℃ and was hatched 5 minutes, and in pepsin solution, digestion is 15 minutes; 1 * PBS room temperature washing 3 minutes; 1% paraformaldehyde/PBS room temperature is fixed 10 minutes; 1 * PBS room temperature washing 3 minutes; 70%, 85%, 100% gradient ethanol dehydration is each 3 minutes; Room temperature is dried slide; Continue crossover process.
(6) the same time variation of sample and probe
Take out hybridization solution from test kit, the concussion mixing, instantaneous centrifugal; Add the hybridization solution of 8ul to the hybridization zone, covered, gently press hybridization solution is evenly distributed rapidly, avoids producing bubble; Rubber cement covers along cover glass edge mounting the edge that cover glass contacts with slide glass fully; On the hot platform of 78 ± 1 ℃, sex change is 2 minutes 30 seconds; Slide is put into the hybridizing box of preheating, lucifuge, 37 ± 1 ℃ of overnight incubation (approximately 16 hours); Continue the post-hybridization washing step.
(7) post-hybridization washing and redying
General washing methods (recommendation): take out the hybridizing box of overnight incubation, carefully remove rubber cement and cover glass; Slide is put into the 50% methane amide/2 * SSC washing 15 minutes of 37 ± 1 ℃; Put it in the staining jar of 2 * SSC, 37 ± 1 ℃ were washed 15 minutes again; Put it in the staining jar that fills 0.1%NP40/2 * SSC, 37 ± 1 ℃ were washed 5 minutes again; Room temperature 70%, 85%, 100% gradient ethanol dewatered each 3 minutes successively; Dry the dark place.
Fast washing method: take out the hybridizing box of overnight incubation, carefully remove rubber cement and cover glass; Slide is put into the 0.3%NP40/0.4 * SSC of 73 ± 1 ℃, washed 2 minutes; Put it into again in 0.1%NP40/2 * SSC room temperature washing 2 minutes; Room temperature 70%, 85%, 100% gradient ethanol dewatered each 3 minutes successively; Dry the dark place.
Redye: drip 10ul DAPI to the slide glass target area, covered, the light pressure avoids producing bubble, in the dark deposits, and be to be seen.
(8) interpretation of result
Under Olympus BX60 fluorescent microscope, observe respectively division phase that DAPI redyes and the fluorescent signal of hybridization with WU, WG filter group, use the CCD photographic recording.Seek under 40 * object lens, count under 100 * object lens; Adjust suitable focal length, signal and background are had clear and definite concept; Signaling point is because being positioned at cell; When there is fluorescent signal point in the extracellular, note with cell in signaling point distinguish, preferably can avoid this zone and count; Adjusting focal length finds signaling point in the different levels of core; The P16 number gene in each cell observed in record.
(9) result is judged
Operate by the treatment process requirement, record P16 number gene (referring to accompanying drawing 2).The demonstration of fluorescence in situ hybridization result, on Metaphase Chromosome, visible two signaling points, have no other fluorescent signal; In interphase nuclei, rarely seen two signaling points, have no other fluorescent signal.
Above content is in conjunction with concrete preferred implementation further description made for the present invention, can not assert that concrete enforcement of the present invention is confined to these explanations.For the general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, can also make some simple deduction or replace, all should be considered as belonging to protection scope of the present invention.
Sequence table
<110〉Da'an Gene Company, Zhongshan University
<120〉a kind of preparation method of human chromosome P 16 gene probe and application thereof
<140>
<141>
<160>2
<210>1
<211>20
<212>DNA
<213〉artificial sequence
<220>
<223〉according to the specific nucleotide sequence design, with the primer as pcr amplification.
<400>1
atccaacatgccatagctcc
<210>2
<211>20
<212>DNA
<213〉artificial sequence
<220>
<223〉according to the specific nucleotide sequence design, with the primer as pcr amplification.
<400>2
tttgtcccatgtcactggaa
Claims (2)
1. the preparation method of a human chromosome P 16 gene probe is characterized in that preparation process comprises:
(1) colony screening: the P16 gene is positioned at human chromosome 9p21 section, selects to include this gene cloning, and the clone who selects number is: RP11-149I2;
(2) clone's culture ﹠ identification: buy clone Invitrogen RPCI11.C, get appropriate clone bacterium liquid and add in the TB nutrient solution (chlorampenicol resistant) of 500ml, shake bacterium in 37 ℃ of shaking tables and cultivated 24~48 hours; Use the STS primer pair to carry out clone identification, its primer sequence is respectively upstream primer 5 '-ATCCAACATGCCATAGCTCC-3 ' and downstream primer 5 '-TTTGTCCCATGTCACTGGAA-3;
(3) P16 gene probe preparation: to identifying positive bacterium liquid, carry out the extraction of plasmid DNA; By suitable dilution plasmid DNA, quantitative to plasmid DNA; Then, by the nick translation method, plasmid DNA is carried out fluorescent mark; Marked product is carried out ethanol precipitation and concentrated; Obtain the P16 probe, lucifuge ,-20 ℃ of storages;
The fluorescein of P16 Probe labelling is fluorescein-labeled dUTP;
(4) P16 gene probe checking: use mankind's proper splitting lymphocyte in mid-term to drip sheet and carry out the probe checking.
2. according to claim 1 method is further characterized in that in clone's culture ﹠ identification step, the pcr amplification condition is: 95 ℃ 5 minutes; (94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 45 seconds) * 40 circulations; 72 ℃ 10 minutes.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200910039411 CN101886104B (en) | 2009-05-12 | 2009-05-12 | Method for preparing human chromosome P16 gene probe and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200910039411 CN101886104B (en) | 2009-05-12 | 2009-05-12 | Method for preparing human chromosome P16 gene probe and application thereof |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2011103827224A Division CN102517382A (en) | 2009-05-12 | 2009-05-12 | Human chromosome P16 gene detection kit and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101886104A CN101886104A (en) | 2010-11-17 |
CN101886104B true CN101886104B (en) | 2013-05-15 |
Family
ID=43072195
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 200910039411 Active CN101886104B (en) | 2009-05-12 | 2009-05-12 | Method for preparing human chromosome P16 gene probe and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101886104B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103131757B (en) * | 2011-11-25 | 2015-05-06 | 中山大学达安基因股份有限公司 | Ovarian cancer individualized treatment detection reagent case and application thereof |
-
2009
- 2009-05-12 CN CN 200910039411 patent/CN101886104B/en active Active
Non-Patent Citations (3)
Title |
---|
Chromosome 9 monosomy by fluorescence in situ hybridization of bladder irrigation specimens is predictive of tumor recurrence;Ichabod Jung等;《The Journal of Urology》;19991231;第162卷;第1900-1903页 * |
Ichabod Jung等.Chromosome 9 monosomy by fluorescence in situ hybridization of bladder irrigation specimens is predictive of tumor recurrence.《The Journal of Urology》.1999,第162卷第1900-1903页. |
Kevin C. Halling等.A comparison of cytology and fluorescence in situ hybridization for the detection of urothelial carcinoma.《The Journal of Urology》.2000,第164卷1768-1775. * |
Also Published As
Publication number | Publication date |
---|---|
CN101886104A (en) | 2010-11-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102399772B (en) | Preparation method for probes related to breast cancer molecular markers and application of same | |
CN103409504A (en) | FISH (fluorescence in situ hybridization) probe, kit and detection method for detecting Her2 (human epidermal growth factor receptor 2) gene free from repetitive sequence | |
CN101886103A (en) | Method for preparing human chromosome 17 enumeration probe and application thereof | |
CN104561360A (en) | TOP2A gene abnormality detection probe, kit and method | |
CN102876676A (en) | Blood serum/blood plasma micro ribonucleic acid (miRNA) marker relevant with pancreatic cancer and application thereof | |
CN102517382A (en) | Human chromosome P16 gene detection kit and application thereof | |
CN101886101A (en) | Method for preparing human chromosome 3 enumeration probe and application thereof | |
CN109825587B (en) | Glioma prognostic marker CPVL and application thereof | |
CN105420397A (en) | PML gene and RARA gene detection probe, preparation method thereof and reagent kit | |
CN101886104B (en) | Method for preparing human chromosome P16 gene probe and application thereof | |
CN113599524A (en) | Application of HNRNPC and RBMX as target points in preparation of products for treating small cell lung cancer | |
CN108531544A (en) | A kind of method of miR-181b target genes screening | |
CN109554370B (en) | Aptamer targeting human poorly differentiated gastric cancer cells and application thereof | |
CN108913774B (en) | C-KIT somatic mutation gene detection KIT and detection method thereof | |
Xu et al. | In vitro methods for analyzing miRNA roles in cancer cell proliferation, invasion, and metastasis | |
CN104561357A (en) | EGFR gene amplification detection probe, kit and method | |
CN114457161B (en) | Application of lncRNA AC145207.5 in colorectal cancer diagnosis, treatment and drug sensitivity improvement | |
CN101886102A (en) | Method for preparing human chromosome 7 enumeration probe and application thereof | |
WO2017114006A1 (en) | Aml1 gene and eto gene detection probe, preparation method therefor, and test kit | |
CN114686486A (en) | Application of reagent for detecting MYOD1 gene expression quantity in preparation of osteosarcoma transformation rhabdomyosarcoma or osteosarcoma prognosis preparation | |
WO2017114005A1 (en) | Terc gene and/or myc gene detection probe, preparation method therefor, and reagent kit | |
CN102899390A (en) | Small cell lung cancer markers and their detection | |
CN102994631B (en) | Kit for differential diagnosis of liposarcomas and preparation method thereof | |
CN107312778A (en) | A kind of cancer diagnosing kit and medicine for treatment compositions | |
CN105483255A (en) | TOP2A gene detection probe, preparation method thereof and reagent kit |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CP01 | Change in the name or title of a patent holder |
Address after: 510665 No. 19 incense Hill Road, hi tech Industrial Development Zone, Guangdong, Guangzhou Patentee after: Guangzhou Da'an gene Co.,Ltd. Address before: 510665 No. 19 incense Hill Road, hi tech Industrial Development Zone, Guangdong, Guangzhou Patentee before: DA AN GENE CO., LTD. OF SUN YAT-SEN University |
|
CP01 | Change in the name or title of a patent holder |