CN101886102A - Method for preparing human chromosome 7 enumeration probe and application thereof - Google Patents
Method for preparing human chromosome 7 enumeration probe and application thereof Download PDFInfo
- Publication number
- CN101886102A CN101886102A CN 200910039408 CN200910039408A CN101886102A CN 101886102 A CN101886102 A CN 101886102A CN 200910039408 CN200910039408 CN 200910039408 CN 200910039408 A CN200910039408 A CN 200910039408A CN 101886102 A CN101886102 A CN 101886102A
- Authority
- CN
- China
- Prior art keywords
- probe
- preparation
- pcr amplification
- pcr
- human chromosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for preparing a human chromosome 7 enumeration probe and preparation of a human chromosome 7 enumeration kit by using the same. A human chromosome 7 can be accurately and quickly counted by applying the human chromosome 7 enumeration probe and the corresponding kit.
Description
Technical field
The preparation method of a kind of human chromosome 7 enumeration probe involved in the present invention, also relate to and utilize human chromosome 7 enumeration probe to prepare a kind of human chromosome 7 enumeration test kit, use human chromosome 7 enumeration probe of the present invention and reagent corresponding box and can count accurately and rapidly No. 7 karyomit(e)s of people.
Background technology
Contain 100,000,000 5 thousand 8 hundred ten thousand bases (account for whole human genome 5%) and 1455 genes on No. 7 karyomit(e)s of people, some of them gene and autism, cystic fibrosis, several leukemia are relevant with lymphoma.Have and studies show that in many malignant tumours, all have No. 7 karyomit(e) trisomys to occur in a large number, as relevant [Brown JA with kidney, Anderl KL, Borell TJ, etc.Simultaneous chromosome 7 and 17 gain and sex chromosome loss provide evidence that renal metanephric adenoma is related to papillary renal cell careinoma.J Urol.1997 Aug; 158 (2): 370-4.]; With astrocytoma closely related [Wessels PH lifetime, Twijnstra A, Kessels AG, etc.Gain of chromosome 7, as detected by in situ hybridization, strongly correlates with shorter survival in astrocytoma grade 2, Genes Chromosomes Cancer.2002Mar; 33 (3): 279-84.]; The polyploid incidence is approximately 13.0%～76.2% in bladder cancer; Be lymphoma development mark, higher [the Bernell P of occurrence frequency in the B cell lymphoma patient; Jacobsson B; Liliemark J; Hjalmar V; Arvidsson I; Hast R, Gain of chromosome 7marks the progression from indolent to aggressive follicle centre lymphoma and is a common finding in patients with diffuse large B-cell lymphoma, British journal of haematology 1998; 101 (3): 487-91.]; No. 7 karyomit(e) polysomy cell count and nodus lymphoideus transferring rate and progress are closely related in mammary cancer, can be used as mammary cancer patient prognostic indicator [Keizo Hirata, Yutaka Tagawa, Kiyotaka Kashima, etc.Frequency of Chromosome 7Gain in Human Breast Cancer Cells:Correlation with the Number of Metastatic Lymph Nodes and Prognosis " .Tohoku J.Exp.Med.; Vol.184; 85-97 (1998)], or the like.Therefore it is significant to carry out this chromosome counting.
Genome analysis commonly used at present can determine that chromosomal non-multiple is unusual, but this need carry out cell cultures and the high-quality Metaphase Chromosome sheet of preparation, and this is extremely difficult and consuming time for tumour cell.In order to solve this technical barrier, one of them thinking is screening and prepares corresponding chromosome counting probe, but chromosome counting probe preparation at present lacks a system and sophisticated method.
The inventor designs on the basis that studies for a long period of time and screens human chromosome 7 enumeration probe, and utilizes fluorescence in situ hybridization technique to detect No. 7 chromosome numbers in mid-term or the interval cell.It uses the double-stranded DNA nucleic acid probe and the chromosomal DNA complementary sequence hybridization of fluorescent substance mark, the position of show dna sequence in nuclear or on the karyomit(e).The inventor also develops the human chromosome 7 enumeration test kit on this basis, and that this test kit has is quick, non-invasive, susceptibility is high and advantage such as high specificity, need not to carry out cell cultures, just can detect No. 7 chromosomal quantity in mid-term and interval cell.
Owing to the invention provides the preparation method of this No. 7 chromosome counting probes, and independent development is developed No. 7 chromosome counting test kits on this basis, to breaking away from the dependence to import reagent, the blank of filling up domestic this detection range has very significant meaning.
Summary of the invention
An object of the present invention is to provide a kind of preparation method of human chromosome 7 enumeration probe.
The preparation process of an embodiment preferred human chromosome 7 enumeration probe comprises according to the present invention:
(1) design of primers: zone pcr amplification primer thing design of No. 7 karyomit(e) kinetochores of people and checking.
(2) cloned plasmids preparation: preparation PCR reaction system is that template is carried out pcr amplification with the people's gene group, and the purpose product behind the purifying is connected with carrier pMD18-T, prepares to comprise the segmental cloned plasmids pMD18-T-C7 of purpose.
(3) C7 probe preparation: can adopt following two kinds of methods to be prepared.
Method one: to comprise the segmental plasmid pMD18-T-C7DNA of purpose is template, carries out pcr amplification, by the PCR reaction amido modified dUTP is incorporated in the purpose product, then through PCR product purification, concentrated, quantitative; PCR product behind the purifying is carried out fluorescent mark, purifying, calculating labeling effciency, quantitative, and obtain the C7 probe, lucifuge ,-20 ℃ of storages.
Method two: to comprise the segmental plasmid pMD18-T-C7DNA of purpose is template, uses fluorescein-labeled dUTP directly to carry out pcr amplification, with PCR product mark fluorescent, carry out purifying, calculating labeling effciency, quantitative then, quantitatively, obtain the C7 probe, lucifuge ,-20 ℃ of storages.
(4) C7 probe checking: use human proper splitting lymphocyte in mid-term to drip sheet and carry out the probe checking.
Embodiment preferred according to the present invention, the pcr amplification primer sequence of design is respectively upstream primer 5 '-AGCGATTTGAGGACAATTGC-3 ' and downstream primer 5 '-CCACCTGAAAATGCCACAGC-3 '.
Embodiment preferred according to the present invention, in cloned plasmids preparation process and the C7 probe preparation process pcr amplification condition be into: 95 ℃ 5 minutes; (94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 45 seconds) * 40 circulations; 72 ℃ 10 minutes.
Embodiment preferred according to the present invention, purifying can use commercially available DNA purification kit in the C7 probe preparation process, the MinElute PCR Purification Kit of preferred Qiagen company.
Embodiment preferred according to the present invention, concentration method is that ethanol sedimentation concentrates in the C7 probe preparation process.
Embodiment preferred according to the present invention, the PCR product quantitatively is the absorbancy that will measure respectively after the dilution of PCR product under 260nm and the 280nm in the C7 probe preparation process, calculates production concentration.
Embodiment preferred according to the present invention, the PCR product carries out the commercially available dna marker test kit of fluorescent mark use, the ARES of preferred Invitrogen company in the C7 probe preparation process
TMDNA Labeling Kit.
Embodiment preferred according to the present invention, the fluorescein of C7 probe mark comprises activatory fluorescence dye and/or fluorescein-labeled dUTP, and preferred Alexa Fluor series, Spectrum dUTP.
Another object of the present invention is to utilize human chromosome 7 enumeration probe to prepare a kind of human chromosome 7 enumeration test kit.
In order to realize the present invention, we have adopted following technical scheme:
(1) sample process and film-making: all types of samples are handled according to in-situ hybridization method.
(2) hybridization: preparing hybrid liquid mainly comprises label probe and hybridization buffer.Carry out 8～16 hours hybridization under the suitable temp, then with suitable washing lotion flush away not in conjunction with last and probe non-specific combination; The DAPI counterstain is redyed.
(3) observe fluorescent signal by the corresponding filter block of fluorescent microscope, No. 7 karyomit(e)s are counted.
Test kit based on above technical scheme invention comprises: 1) hybridization solution, DAPI counterstain and 2) separate and the concentrated packing box of packing these reagent bottles or pipe.
According to a preferred embodiment of the invention, by hybridization buffer, fluorescently-labeled C7 probe, unlabelled competitive DNA and H
2O is mixed with hybridization solution, and wherein using the amount of C7 probe in everyone part hybridization solution is 40～60ng, and hybridization buffer is 7ul, and unlabelled competitive DNA is 1.5ug, uses H
2O mends to 10ul.
According to a preferred embodiment of the invention, the component of hybridization buffer comprises deionized formamide, SSC, and T 500, wherein deionized formamide concentration is 50%～70%, T 500 concentration is 0.1g/ml.
According to a preferred embodiment of the invention, wherein DAPI counterstain compound method is that 50～250ng DAPI is dissolved in the anti-liquid (10mg/ml Ursol D/PBS, glycerine mixed solution) that fades of 1ml.
Utilize test kit of the present invention, according to the fluorescence in-situ hybridization method of routine to mid-term of people and interval cell carry out chromosome counting No. 7.
The present invention compared with prior art has following advantage:
(1) can count accurately and rapidly and good reproducibility as a result No. 7 karyomit(e)s of people;
(2) need not to carry out cell cultures and the high-quality Metaphase Chromosome sheet of preparation, can be used for mid-term or No. 7 chromosome countings of interval cell, operate simple relatively;
(3) by being prepared into test kit, can be implemented in the application in fields such as oncobiology, cytogenetics, antenatal diagnosis, understand getting in touch of No. 7 karyomit(e) and tumour generation etc.
Description of drawings
Fig. 1 shows people's gene group pcr amplification product electrophoresis result.Purpose product 340bp.
Fig. 2 shows No. 7 chromosome counting results of human proper splitting lymphocyte in mid-term.
Embodiment
The following example is intended to illustrate rather than limit the present invention.
Embodiment 1: the preparation method of human chromosome 7 enumeration probe
(1) design of primers and synthetic: zone pcr amplification primer thing design of No. 7 karyomit(e) kinetochores of people and checking
Primer is to being respectively, and F:5 '-AGCGATTTGAGGACAATTGC-3 ' and R:5 '-CCACCTGAAAATGCCACAGC-3 ' is synthesized by Da.The preparation reaction system:
10×Buffer?????????????????5ul
MgCl
2(25mmol/L)????????????2ul
Human gene group DNA (5pg/ul) 2ul
F(10umol/L)????????????????2ul
R(10umol/L)????????????????2ul
d3TPs(10mmol/L)????????????1ul
dTTP(1mmol/L)??????????????2ul
aa-dUTP(1mmol/L)???????????16ul
TaKaRa
Hot?Start?Version(5U/ul)???????0.5ul
H
2O????????????????????????17.5ul
Cumulative volume is 50ul.Use ABI9700PCR instrument or similar reaction kit, loop parameter is set is: 95 ℃ 5 minutes; (94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 45 seconds) * 40 circulations; 72 ℃ 10 minutes.
After reaction finished, the agarose gel electrophoresis of getting 5ul product 2% detected, and the result has bright band (referring to accompanying drawing 1) about 300bp.
(2) cloned plasmids preparation
Purpose product behind the purifying is connected with carrier pMD18-T, prepares and comprise the segmental cloned plasmids pMD18-T-C7 of purpose.
(3) C7 probe preparation
C7F1 clone cultivates, DNA extraction: according to " molecular cloning experiment guide " described classical way, be added with the intestinal bacteria bacterial classification that adds cloned plasmids pMD18-T-C7 in the LB substratum of penbritin, shake bacterium in 37 ℃ of shaking tables and spend the night; Use TaKaRaMiniBEST Plasmid Purification Kit Ver.2.0 or similar reagents box, the working method of Yao Qiuing is carried out the plasmid DNA extraction to specifications.Calculate OD260/OD280, requirement result calculates plasmid DNA concentration between 1.6～2.2.
C7 amplification: to comprise the segmental plasmid pMD18-T-C7DNA of purpose is template, loop parameter is set is: 95 ℃ 5 minutes; (94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 45 seconds) * 40 circulations; 72 ℃ 10 minutes.
10×Buffer????????????????????????5ul
MgCl
2(25mmol/L)???????????????????2ul
PMD18-T-C7 plasmid DNA (5pg/ul) 2ul
F(10umol/L)???????????????????????2ul
R(10umol/L)???????????????????????2ul
d3TPs(10mmol/L)???????????????????1ul
dTTP(1mmol/L)?????????????????????2ul
aa-dUTP(1mmol/L)??????????????????16ul
TaKaRa
Hot?Start?Version(5U/ul)????0.5ul
H
2O?????????????????????17.5ul
Cumulative volume is 50ul.
By PCR reaction amido modified dUTP is incorporated in the purpose product, then through the PCR product purification, concentrate, quantitative after, dilute and be 1ug/ul; Pacific Blue mark adopts the ARES of Invitrogen
TMComposition D (composition: sodium bicarbonate aqueous solution) among the Alexa Fluor 488DNALabeling Kit, and independent Pacific Blue (20ug/ul) dyestuff, require to carry out probe mark to specifications, thereby the activatory fluorescein can react with amido modified dUTP the product mark fluorescent, operates under the environment of dry lucifuge as far as possible.Described to specifications method adopts the MinElute PCR Purification Kit test kit of Qiagen to carry out purifying.Measure 260 and the absorption peak at 416nm place respectively, (660000 * OD416)/(OD260 * 46000) calculate the fluorescent mark rates, require mark rate in 1～9/100 base scope to adopt formula.Calculate fluorescent probe concentration, lucifuge ,-20 ℃ of storages by concentration and probe concentration (ng/ul)=OD260 * 50.
(4) C7 probe checking
Use human proper splitting lymphocyte in mid-term to drip sheet and carry out the probe checking, comprise mid-term or interphase chromosome DNA, during fluorescence in situ hybridization, chromosomal DNA shows as discernible karyomit(e) or nucleus on the form.
Embodiment 2: the preparation of human chromosome 7 enumeration test kit
With 10 person-portions/box is example.
(1) hybridization solution preparation
The C7 probe dilution that takes a morsel becomes 40ng/ul, according to the form below preparing hybrid liquid:
(2) DAPI counterstain preparation
The anti-liquid that fades: the necessary lucifuge of substantial length of operation, the Ursol D of 10mg is dissolved among the PBS of 1ml, adds 9ml glycerine, shakes mixing repeatedly, and regulating pH is 9.0 ,-20 ℃ of storages.Whole solution should be for colourless or slightly faint yellow, if present yellow or the orange abandoned well that then needs is prepared again.
With deionized water preparation 1mg/ml DAPI storage liquid.
The DAPI solution (1mg/ml) of getting 2.5ul is dissolved in the anti-liquid that fades of 1ml, shakes mixing under the lucifuge condition repeatedly ,-20 ℃ of airtight preservations of lucifuge.
(3) finished product assembling
| The component title | Specification | Quantity |
| Hybridization solution (containing centromeric probe No. 7) | The 100ul/ pipe | 1 pipe |
| The DAPI counterstain | The 100ul/ pipe | 1 pipe |
| Specification sheets | 1 part |
Embodiment 3: the using method of human chromosome 7 enumeration test kit
With human proper splitting lymphocyte in mid-term is example.
(1) human peripheral is cultivated and Chromosome Preparation
Blood sampling: behind the wetting injection needle tube of heparin (0.2ml), conventional extracting vein blood 1～2ml rotates syringe mixing heparin.Inoculation (aseptic technique in Bechtop): (the RPMI-1640 5ml that contains 20% serum pH7.2), adds whole blood 0.25～0.30ml (No. 7 syringe needle 13～15), PHA 5mg, covers tight plug, shakes up gently in each culturing bottle.Cultivate: culturing bottle is placed in 37 ℃ of constant incubators cultivates 72h.Stop cultivating preceding 2～4h, add 1～2 of 0.01% colchicine solution (100 μ g/ml) (No. 7 syringe needles), making final concentration is 0.2 μ g/ml nutrient solution.After shaking up gently, put back to incubator and continue to cultivate 2～4h.Results: the hemocyte after will cultivating is collected in the centrifuge tube, the centrifugal 8min of 1000r/min after the balance, supernatant discarded.
(2) sample preparation
Hypotonic: as in centrifuge tube, to add 37 ℃ of 0.075mol/LKCl solution to 8ml, blow and beat the mixing cell gently, place 37 ℃ of water bath incubation 15min with suction pipe.Pre-fix: in centrifuge tube, drip the methyl alcohol-Glacial acetic acid stationary liquid 1～2ml of new preparation, blow and beat the centrifugal 8min of 1000r/min behind the mixing, supernatant discarded gently with suction pipe.Fixing: the stationary liquid that adds new preparation is to 8ml, and room temperature leaves standstill 30min.The centrifugal 8min of 3000r/min, supernatant discarded.Can repeat again to fix 1 time.Film-making: according to what of sedimentation cell, (0.5～1ml), cell suspension is made in piping and druming gently to add the proper amount of fresh stationary liquid.Draw the small amounts of cells suspension with dropper, drip to slide glass microscopy.
(3) film-making
Get clean slide, get 3ul behind the re-suspended cell respectively, 10ul and 30ul suspension are added drop-wise to the different positions on the slide glass, note not overlapping; Dry under the room temperature; Observe trizonal cell density with 20 * object lens under phase microscope, the record cell is obviously not overlapping, and quantity is in added cell suspension amount more than 100～200; If cell density and number are suitable, other gets a clean slide glass, drips an amount of cell suspension; If the zone that drips the 30ul suspension still cell number very little, other gets the 30ul suspension and repeats to drip to this zone, dries, and observes; If still cell number is too many in the zone of dropping 3ul suspension, with fresh stationary liquid diluting cells suspension, repeating step drips sheet to be observed.
(4) slide ethanol is aging
Hot platform is heated to 95 degree; Take out cover glass, dry standby; One is folded into 4～8 layers of gauze of quadrate, soaks into dehydrated alcohol; On the hybridization zone of slide glass, respectively drip the dehydrated alcohol of 160ul; Cover the cover glass of 24 * 24mm gently, gently compress; Slide glass is placed on the hot platform of 95 degree preheatings, cover the gauze (covering slide glass fully) that has soaked into dehydrated alcohol, cover previously prepd square cover (covering slide glass fully) again, timing 2 minutes; From hot platform removing caps, gauze, take off slide glass, remove cover glass gently, continue pre-treatment step.
(5) slide pre-treatment
Slide is put into 1 * PBS of 37 ± 1 ℃ and was hatched 5 minutes, and digestion is 15 minutes in the pepsin solution; 1 * PBS room temperature washing 3 minutes; 1% Paraformaldehyde 96/PBS room temperature is fixed 10 minutes; 1 * PBS room temperature washing 3 minutes; 70%, 85%, 100% gradient ethanol dehydration is each 3 minutes; Room temperature is dried slide; Continue crossover process.
(6) the same time variation of sample and probe
From test kit, take out hybridization solution, the concussion mixing, instantaneous centrifugal; The hybridization solution that adds 8ul is to the hybridization zone, and covered is gently pressed and made the hybridization solution uniform distribution rapidly, avoids producing bubble; Rubber cement covers the edge that cover glass contacts with slide glass fully along cover glass edge mounting; Sex change is 2 minutes 30 seconds on 78 ± 1 ℃ the hot platform; Slide is put into the hybridizing box of preheating, lucifuge, 37 ± 1 ℃ of overnight incubation (about 16 hours); Continue the post-hybridization washing step.
(7) post-hybridization washing and redying
General washing methods (recommending to use): take out the hybridizing box of overnight incubation, carefully remove rubber cement and cover glass; 50% methane amide/2 * SSC that slide is put into 37 ± 1 ℃ washed 15 minutes; Put it in the staining jar of 2 * SSC, 37 ± 1 ℃ were washed 15 minutes again; Put it in the staining jar that fills 0.1%NP40/2 * SSC, 37 ± 1 ℃ were washed 5 minutes again; Room temperature 70%, 85%, 100% gradient ethanol dewatered each 3 minutes successively; Dry the dark place.
Fast washing method: take out the hybridizing box of overnight incubation, carefully remove rubber cement and cover glass; Slide is put into 0.3%NP40/0.4 * SSC of 73 ± 1 ℃, washed 2 minutes; Put it among 0.1%NP40/2 * SSC room temperature washing 2 minutes again; Room temperature 70%, 85%, 100% gradient ethanol dewatered each 3 minutes successively; Dry the dark place.
Redye: drip 10ul DAPI to the slide glass target area, covered, the light pressure avoids producing bubble, in the dark deposits, and waits to observe.
(8) interpretation of result
Under Olympus BX60 fluorescent microscope, observe division that DAPI redyes respectively mutually and the fluorescent signal of hybridization with WU, AQUA filter group, use the CCD photographic recording.Under 40 * object lens, seek counting under 100 * object lens; Adjust suitable focal length, signal and background are had clear and definite notion; Signaling point is because of being positioned at cell; When there is fluorescent signal point in the extracellular, note with cell in signaling point distinguish, preferably can avoid this zone and count; Adjust focal length, find signaling point in the different levels of examining; Total cellular score and No. 7 chromosome numbers that record is observed.
(9) result judges
Operate by the treatment process requirement, write down No. 7 chromosome numbers (referring to accompanying drawing 2).The fluorescence in situ hybridization result shows that visible two signaling points are not seen other fluorescent signal on the Metaphase Chromosome; Rarely seen two signaling points are not seen other fluorescent signal in the interphase nuclei.
Above content be in conjunction with concrete preferred implementation to further describing that the present invention did, can not assert that concrete enforcement of the present invention is confined to these explanations.For the general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, can also make some simple deduction or replace, all should be considered as belonging to protection scope of the present invention.
Sequence table
＜110〉Da
＜120〉a kind of preparation method of human chromosome 7 enumeration probe and application thereof
<140>
<141>
<160>2
<210>1
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer as pcr amplification.
<400>1
agcgatttgaggacaattgc
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer as pcr amplification.
<400>2
ccacctgaaaatgccacagc
Claims (6)
1. the preparation method of a human chromosome 7 enumeration probe is characterized in that preparation process comprises:
(1) design of primers: zone pcr amplification primer thing design of No. 7 karyomit(e) kinetochores of people and checking;
(2) cloned plasmids preparation: preparation PCR reaction system is that template is carried out pcr amplification with the people's gene group, and the purpose product behind the purifying is connected with carrier pMD18-T, prepares to comprise the segmental cloned plasmids pMD18-T-C7 of purpose;
(3) C7 probe preparation: can adopt following two kinds of methods to be prepared
Method one: to comprise the segmental plasmid pMD18-T-C7DNA of purpose is template, carries out pcr amplification, by the PCR reaction amido modified dUTP is incorporated in the purpose product, then through PCR product purification, concentrated, quantitative; PCR product behind the purifying is carried out fluorescent mark, purifying, calculating labeling effciency, quantitative, and obtain the C7 probe, lucifuge ,-20 ℃ of storages;
Method two: to comprise the segmental plasmid pMD18-T-C7DNA of purpose is template, uses fluorescein-labeled dUTP directly to carry out pcr amplification, with PCR product mark fluorescent, carry out purifying, calculating labeling effciency, quantitative then, quantitatively, obtain the C7 probe, lucifuge ,-20 ℃ of storages;
(4) C7 probe checking: use human proper splitting lymphocyte in mid-term to drip sheet and carry out the probe checking.
2. according to the method for claim 1, its feature is that also wherein pcr amplification primer sequence is respectively upstream primer 5 '-AGCGATTTGAGGACAATTGC-3 ' and downstream primer 5 '-CCACCTGAAAATGCCACAGC-3 '.
3. according to the method for claim 1, its feature also be in cloned plasmids preparation process and the C7 probe preparation process pcr amplification condition be into: 95 ℃ 5 minutes; (94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 45 seconds) * 40 circulations; 72 ℃ 10 minutes.
4. according to the method for claim 1, its feature is that also wherein the fluorescein of C7 probe mark comprises activatory fluorescence dye and/or fluorescein-labeled dUTP.
5. a human chromosome 7 enumeration test kit comprises: 1) hybridization solution, DAPI counterstain and 2) separate and the concentrated packing box of packing these reagent bottles or pipe, wherein hybridization solution is by hybridization buffer, fluorescently-labeled C7 probe, unlabelled competitive DNA and H
2O is formulated, it is characterized in that using the amount of C7 probe in everyone part hybridization solution is 40～60ng, and hybridization buffer is 7ul, and unlabelled competitive DNA is 1.5ug.
6. according to the test kit of claim 5, its feature is that also deionized formamide concentration is 50%～70% in the hybridization buffer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910039408 CN101886102A (en) | 2009-05-12 | 2009-05-12 | Method for preparing human chromosome 7 enumeration probe and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910039408 CN101886102A (en) | 2009-05-12 | 2009-05-12 | Method for preparing human chromosome 7 enumeration probe and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101886102A true CN101886102A (en) | 2010-11-17 |
Family
ID=43072193
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910039408 Pending CN101886102A (en) | 2009-05-12 | 2009-05-12 | Method for preparing human chromosome 7 enumeration probe and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101886102A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131757A (en) * | 2011-11-25 | 2013-06-05 | 中山大学达安基因股份有限公司 | Ovarian cancer individualized treatment detection reagent case and application thereof |
| CN105039505A (en) * | 2015-04-14 | 2015-11-11 | 广州安必平医药科技股份有限公司 | FISH probe for detecting X and Y chromosome abnormality, kit and preparation method thereof |
-
2009
- 2009-05-12 CN CN 200910039408 patent/CN101886102A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131757A (en) * | 2011-11-25 | 2013-06-05 | 中山大学达安基因股份有限公司 | Ovarian cancer individualized treatment detection reagent case and application thereof |
| CN103131757B (en) * | 2011-11-25 | 2015-05-06 | 中山大学达安基因股份有限公司 | Ovarian cancer individualized treatment detection reagent case and application thereof |
| CN105039505A (en) * | 2015-04-14 | 2015-11-11 | 广州安必平医药科技股份有限公司 | FISH probe for detecting X and Y chromosome abnormality, kit and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101886103A (en) | Method for preparing human chromosome 17 enumeration probe and application thereof | |
| CN103409504A (en) | FISH (fluorescence in situ hybridization) probe, kit and detection method for detecting Her2 (human epidermal growth factor receptor 2) gene free from repetitive sequence | |
| CN103409505A (en) | FISH (fluorescence in situ hybridization) probe, kit and detection method for detecting BCR/ABL fusion gene free from repetitive sequence | |
| CN104561361A (en) | HER2 gene amplification detection probe, kit and method | |
| CN106957908A (en) | MiRNA and/or target molecules with aptamer detection method and detection probe | |
| CN101886101A (en) | Method for preparing human chromosome 3 enumeration probe and application thereof | |
| CN104561360A (en) | TOP2A gene abnormality detection probe, kit and method | |
| Fassan et al. | Circulating microRNA expression profiling revealed miR-92a-3p as a novel biomarker of Barrett’s carcinogenesis | |
| CN102517382A (en) | Human chromosome P16 gene detection kit and application thereof | |
| Siciliano et al. | EBV persistence in gastric cancer cases conventionally classified as EBER-ISH negative | |
| CN101886102A (en) | Method for preparing human chromosome 7 enumeration probe and application thereof | |
| CN106636317A (en) | Lung cancer related mciroRNA detection kit | |
| WO2017096714A1 (en) | Circulating tumor cell typing identification kit | |
| CN101886104B (en) | Method for preparing human chromosome P16 gene probe and application thereof | |
| CN104561357A (en) | EGFR gene amplification detection probe, kit and method | |
| CN104561356A (en) | ALK gene rearrangement detection probe, kit and method | |
| CN102260738A (en) | Oligonucleotide gene chip and application of oligonucleotide gene chip to detection of various bacteria | |
| CN102181540A (en) | Method for verifying seed purity of cotton | |
| CN108998576A (en) | For detect the specific primer of spring viremia of carp virus to, probe, detection kit | |
| CN111621570B (en) | CK8 gene expression detection kit | |
| CN108642164A (en) | MiRNA capture probes, separation expand integrated detection method and detection kit | |
| WO2017114005A1 (en) | Terc gene and/or myc gene detection probe, preparation method therefor, and reagent kit | |
| CN102899390A (en) | Small cell lung cancer markers and their detection | |
| Nielsen et al. | Detection of lncRNA by LNA-based in situ hybridization in paraffin-embedded cancer cell spheroids | |
| CN102994631B (en) | Kit for differential diagnosis of liposarcomas and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20101117 |