CN101845508B - PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA - Google Patents
PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA Download PDFInfo
- Publication number
- CN101845508B CN101845508B CN2010102029701A CN201010202970A CN101845508B CN 101845508 B CN101845508 B CN 101845508B CN 2010102029701 A CN2010102029701 A CN 2010102029701A CN 201010202970 A CN201010202970 A CN 201010202970A CN 101845508 B CN101845508 B CN 101845508B
- Authority
- CN
- China
- Prior art keywords
- dna
- leopard
- pcr
- tiger
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a PCR detection primer, a kit and a detection method for tiger-derived and leopard-derived DNA, and establishes the detection primer, the kit and the detection method of ordinary PCR detection to the tiger-derived and leopard-derived DNA. The sequence of the primer is SEQ ID NO.1 and SEQ ID NO.2; and based on the primer sequence, the invention discloses the ordinary PCR detection kit and the corresponding detection method for the tiger-derived and leopard-derived DNA comprising the primer. The primer of the invention has strong specificity, and the detection kit and the method are simple and convenient, and has accurate result and very high specificity and sensitivity.
Description
Technical field
The present invention relates to the gene tester of brave leopard.The PCR detection method of especially brave leopard gene and wherein related Auele Specific Primer and related kit.
Background technology
Tiger, leopard all are the animals under the cat family Panthera.Tiger is the maximum felid of the bodily form in the world; Existing 5 brave subspecies comprise northeastern tiger (Panthera tigris altaica), Su Mendala tiger (P.t.sumatrae), South China tiger (P.t.amoyensis), seal Zhi Hu (P.t.corbetti) and bangladesh tiger (P.t.tigris).At present, the quantity of wild tiger is very rare within Chinese territory.
Leopard volume in four kinds of big cats (its excess-three kind is lion, tiger, panther puma) of Panthera is minimum.Leopard bright-colored has many spots and flavous fur, so have another name called leopard or flower leopard.
Can sustainable development for the wildlife trade, various countries have formulated corresponding wild protection of animal rules, forbid catching and killing and trade of animals on the brink of extinction.Signed in 1975 in the world " CITS (CITES) ", China added this pact in 1981.Although the member states of pact has reached 160. illegal hunting of wildlife and wildlife smuggling activity are still very rampant all over the world. continue threatening the existence of wildlife.Some nationalitys that brave leopard, organ or goods had a conventional requirement have obtained new economic level through development recently; Make them have enough financial resources to obtain leather, organ and the goods thereof of true love; This demand has greatly stimulated the illegal trading of felid, and the difficulty of international supervision, law enforcement lets protection strength seem too pale.
In wildlife evidence obtaining process, its product has lost identifiable morphological specificity after processing treatment in some cases, makes the evaluation work of brave leopard goods very difficult.This shows; In order more effectively to strengthen the protection work of brave leopard class; Set up a kind of high, the practical method of accuracy that can carry out specific detection to tiger, leopard DNA; From molecular level, the suspicious sample that comes from tiger, leopard (for example food, medicine, fur etc.) being carried out the specific detection evaluation, all is very to be badly in need of with necessary.
In this research through screening tiger, leopard and other animal at the synthetic special primer of the base difference of mitochondrial cytochrome b (Cyt b) gene fragment, detect through pcr amplification, reached specific detection and identified purpose brave, leopard DNA.A kind of sensitivity, special, easy, quick, the tiger of good stability, leopard DNA detection method have been set up thus, for customs's anti-smuggling, protection of animal etc. provide a detection platform fast and effectively.
Summary of the invention
The object of the invention promptly is to provide convenience, fast, the PCR detection method of detection by quantitative tiger, leopard DNA, and the employed test kit that comprises specific primer sequence in detecting delicately.
For realizing above-mentioned purpose, the present invention at first provides the PCR of brave source property, leopard source property DNA to detect primer, and they are:
Primer sequence:
Forward primer (SEQ ID NO.1): 5 ' GAATATACTATGGCTCCTACAC 3 ',
Reverse primer (SEQ ID NO.2): 5 ' GGTTGGCGGGGATGTAGTTA 3 '.
On this basis; The present invention also provides the PCR detection kit of brave source property, leopard source property DNA; Described test kit comprises detection solution, contains 10 * PCR damping fluid, 10 μ mol/L forward primers, 10 μ mol/L reverse primers, 10mmol/L dNTP, 5U/ μ L Taq archaeal dna polymerase in this detection solution; Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
The present invention further provides the PCR detection method of utilizing the mentioned reagent box to detect brave source property, leopard source property DNA, and this method is used the mentioned reagent box, comprises the steps:
1. extract testing sample DNA, obtain template DNA solution;
2. reaction system: get the template DNA solution that 1. 1 μ l step makes, add the solution 6.2 μ l in the mentioned reagent box, add sterilization ultrapure water to TV 25 μ l again; Above each component is added in the 0.2mL PCR reaction tubes mixing, 5000r/min, centrifugal 10s;
3. step reaction system is 2. carried out the PCR detection by following condition:
Sex change in advance: 94 ℃, 3min;
Get into circulation: 94 ℃ of sex change 60s, 60 ℃ of annealing 60s, 72 ℃ are extended 60s, 35 circulations;
Stop extending: 72 ℃, 7min;
Preserve reaction product for 4 ℃.
4. step reaction product is 3. carried out electrophoresis, according to the electrophoretic band size result of determination of reaction product.
The present invention adopts the PCR detection technique, and the DNA of brave source property, leopard source property goods is identified.The present invention set up carries out the method for specific detection to brave source property, leopard source property DNA, except that having high specific, susceptibility, has more practicality because of it has characteristics such as simple and easy to do, quick, that cost is low.This method is that customs, the Animal or Plant Quarantine and protection of animal tissue provide rapid detection to identify the effective ways of brave goods.
The tiger of crime of illegal selling or presenting cultural relics of private collection, leopard goods possibly all pass through the processing treatment process, thereby cause fracture and the loss of DNA, obviously also can influence the sensitivity of detection.In order to study the influence of the course of processing to detection sensitivity, the brave digested tankage that this experiment adopts processing to toast carries out sensitivity and detects.Present method can detect through the sample after this processing, and detection sensitivity is 10pg/ μ L.
Description of drawings
Fig. 1 tiger, leopard composition PCR specific amplification result;
Fig. 2 tiger derived component PCR sensitivity detects amplification;
Fig. 3 leopard derived component PCR sensitivity detects amplification.
Embodiment
Be specific embodiment of the present invention below, it is further described the foundation and the application thereof of technical scheme of the present invention, but does not limit content of the present invention in any form.
If no specified otherwise, this part are tested samples such as used northeastern tiger blood, northeastern tiger meat, a seal brave blood, bangladesh tiger blood, Asia lion blood, East Africa lion blood, leopard blood, snow leopard blood, black bear blood and are provided by forest animal garden, Dalian; Samples such as bovine bone powder, goat bone powder, Os Sus domestica powder, donkey bone meal, rabbit bone meal, deer bone powder, horse bone meal, dog bone meal are the national standard sample; Above-mentioned blood class test sample adopts Blood Genome DNA Extraction Kit test kit to carry out the extraction of genomic dna, available from precious biotechnology (Dalian) ltd, article No. D9081; Other tissue class and the animal derived plant feed genome DNA extracting reagent kit of bone meal class samples using extract, available from TIANGEN Biotech (Beijing) Co., Ltd., and article No. DP323-03; Regular-PCR appearance (PE24000, the U.S.), supercentrifuge centrifuge 5804 (Eppendorf company, Germany), nucleic acid-protein analyser (Beckman DU640), thermostatic drying chamber (SANYO mov-213F, Japan).
The PCR detection kit of embodiment 1 tiger, leopard DNA and the foundation of detection method
One, the PCR of tiger, leopard DNA detects primer design
According to the difference of tiger, leopard and other multiple felid and Mammals mtDNA cytochrome b gene sequence, and the design of primers principle, the primer sequence that is designed for detection is following:
Forward primer (SEQ ID NO.1): 5 ' GAATATACTATGGCTCCTACAC 3 ',
Reverse primer (SEQ ID NO.2): 5 ' GGTTGGCGGGGATGTAGTTA 3 '.
Two, the structure of the PCR detection kit of tiger, leopard DNA
Obtaining on the right basis of above-mentioned Auele Specific Primer; Be designed for the test kit of the PCR detection of tiger, leopard DNA, contain 10 * PCR damping fluid, 10 μ mol/L forward primers, 10 μ mol/L reverse primers, 10mmol/L dNTP, 5U/ μ L Taq archaeal dna polymerase in this detection solution; Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
Three, the foundation of the PCR detection method of tiger, leopard DNA
1, the preparation of DNA sample
The DNA sample preparation methods of present embodiment is specially with reference to " DNA and RNA basic experiment technology " (the Wood chief editor breathes out in Science Press, A.J., and Sheng Xiaoyu etc. translate):
(1) specimen preparation
Tiger meat sample: take by weighing the muscle tissue of about 100g tiger, chopping is spent the night in 120 ℃ of bakings, is ground into powder with tissue grinder.
Blood sample: 2% EDTA Disodium (EDTA) anti-freezing of every milliliter of blood sample adding 2mg is for use.
Bone meal sample: can directly be used for the extraction of DNA.
(2) DNA extraction: adopt the test kit extraction method to prepare testing sample DNA genome
Blood class test sample adopts Blood Genome DNA Extraction Kit test kit to carry out the extraction of genomic dna, available from precious biotechnology (Dalian) ltd, article No. D9081.Other tissue class and the animal derived plant feed genome DNA extracting reagent kit of bone meal class samples using extract, available from TIANGEN Biotech (Beijing) Co., Ltd., and article No. DP323-03.
For the blood, tissue and the bone meal dna sample that extract, adopt its concentration of UV spectrophotometer measuring and purity.
2, PCR reaction
Get 1ul testing sample dna solution, add the solution 6.2 μ l in the mentioned reagent box, add sterilization ultrapure water to TV 25 μ l again; Above each component is added in the 0.2mL PCR reaction tubes mixing, 5000r/min, centrifugal 10s; Carry out pcr amplification by following parameter then:
Sex change in advance: 94 ℃, 3min;
Get into circulation: 94 ℃ of sex change 60s, 60 ℃ of annealing 60s, 72 ℃ are extended 60s, 35 circulations;
Stop extending: 72 ℃, 7min;
Preserve reaction product for 4 ℃.
3, the result judges
With 100bp marker is contrast, and it is positive the specific amplification band to occur at target fragment size place, does not have the specific amplification band negative.
The experiment of embodiment 2 specificitys
Adopt detection kit that contains Auele Specific Primer and the detection method of embodiment 1 to detect brave source property, leopard source property DNA sample.Detect other animal DNA samples such as lion, bear, ox simultaneously, assess with specificity to method.
Detected result: the PCR electrophoretogram of tiger, leopard species specificity detected result is as shown in Figure 1, among Fig. 1: 1.H
2O, 2. northeastern tiger blood, 3. northeastern tiger meat, 4. seal brave blood, 5. bangladesh tiger blood; 6. leopard blood, 7. snow leopard blood, 8. Asia lion blood, 9. East Africa lion blood, 10. black bear blood; 11. bovine bone powder, 12. sheep bone meal, 13. Os Sus domestica powders, 14. donkey bone meal; 15. rabbit bone meal, 16. deer bone powders, 17. horse bone meal, 18. dog bone meal.Test-results shows, blood, the muscle tissue dna sample of northeastern tiger subspecies in tiger, the leopard species, and leopard, snow leopard blood DNA sample obtain positive amplification through pcr amplification in seal brave subspecies, bangladesh tiger subspecies and the leopard kind.And 3 kinds of blood DNA samples of lion, bear, the detected result of 8 kinds of Mammals bone meal dna samples such as ox, sheep, horse, pig, dog, rabbit, donkey, deer and the contrast of blank water is negative findings.The above results shows: test institute's primer that design is a specificity amplification primer brave, leopard DNA, and the DNA that comes from Different Individual and different tissues is had same expanding effect.
For northeastern tiger blood DNA and the leopard blood DNA template extracted, adopt its concentration of UV spectrophotometer measuring and purity.Adjust starting point concentration to 100ng/ μ L with TE solution, and carry out 10 times of gradient dilutions, concentration is respectively: 10ng/ μ L, 1ng/ μ L, 100pg/ μ L, 10pg/ μ L and 1pg/ μ L.The template of different concns is reacted through PCR, confirms the sensitivity of its detection.
Make an experiment according to the PCR reaction conditions, northeastern tiger blood DNA detected result is as shown in Figure 2, among Fig. 2: 1.100ng/ μ L tiger blood DNA; 2.10ng/ μ L tiger blood DNA; 3.1ng/ μ L tiger blood DNA, 4.100pg/ μ L tiger blood DNA, 5.10pg/ μ L tiger blood DNA; 6.1pg/ μ L tiger blood DNA, 7.0.1pg/ μ L tiger blood DNA.The test-results demonstration can be at 100ng/ μ L, 10ng/ μ L, and 1ng/ μ L, 100pg/ μ L detects specific pcr amplification band in the 10pg/ μ L northeastern tiger blood DNA template.Leopard blood DNA detected result is as shown in Figure 3, among Fig. 3: 1.100ng/ μ L leopard blood DNA, 2.10ng/ μ L leopard blood DNA, 3.1ng/ μ L leopard blood DNA, 4.100pg/ μ L leopard blood DNA, 5.10pg/ μ L leopard blood DNA.The experimental result demonstration can be at 100ng/ μ L, 10ng/ μ L, and 1ng/ μ L, 100pg/ μ L detects specific pcr amplification band in the 10pg/ μ L leopard blood DNA template.The above results shows: the specific PCR primer of this test design can detect the brave derived component and the leopard derived component of 10pg/ μ L content.
Claims (3)
1. the PCR of brave source property, leopard source property DNA detects primer, it is characterized in that:
Primer sequence:
Forward primer (SEQ ID NO.1): 5 ' GAATATACTATGGCTCCTACAC 3 ',
Reverse primer (SEQ ID NO.2): 5 ' GGTTGGCGGGGATGTAGTTA 3 '.
2. the PCR detection kit of brave source property, leopard source property DNA; It is characterized in that comprising in this test kit a kind of detection solution, contain 10 * PCR damping fluid, 10 μ mol/L forward primers, 10 μ mol/L reverse primers, 10m mol/L dNTP, 5U/ μ L Taq archaeal dna polymerase in this detection solution;
Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
3. the PCR detection method of brave source property, leopard source property DNA is characterized in that using the described test kit of claim 2, comprises the steps:
1. extract testing sample DNA, obtain template DNA solution;
2. reaction system: get the template DNA solution that 1. 1 μ l step makes, add the solution 6.2 μ l in the mentioned reagent box, add sterilization ultrapure water to TV 25 μ l again; Above each component is added in the 0.2mL PCR reaction tubes mixing, 5000r/min, centrifugal 10s;
3. step reaction system is 2. carried out the real-time fluorescence PCR detection by following condition:
Sex change in advance: 94 ℃, 3min;
Get into circulation: 94 ℃ of sex change 60s, 66 ℃ of annealing 60s, 72 ℃ are extended 60s, 35 circulations;
Stop extending: 72 ℃, 7min;
Preserve reaction product for 4 ℃;
4. step reaction product is 3. carried out electrophoresis, according to the electrophoretic band size result of determination of reaction product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102029701A CN101845508B (en) | 2010-06-12 | 2010-06-12 | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102029701A CN101845508B (en) | 2010-06-12 | 2010-06-12 | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101845508A CN101845508A (en) | 2010-09-29 |
| CN101845508B true CN101845508B (en) | 2012-06-20 |
Family
ID=42770326
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102029701A Expired - Fee Related CN101845508B (en) | 2010-06-12 | 2010-06-12 | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101845508B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517391B (en) * | 2011-12-23 | 2013-08-28 | 北京同仁堂股份有限公司 | Method for detecting leopard bone component in mixture and primer applied |
| CN104059979B (en) * | 2014-06-27 | 2015-10-21 | 安徽师范大学 | For the identification of the multiple PCR primer of leopard and method and their application in qualification leopard |
| CN104059978B (en) * | 2014-06-27 | 2016-04-13 | 安徽师范大学 | For the identification of the multiple PCR primer of clouded leopard and method and their application in qualification clouded leopard |
| CN106544433A (en) * | 2016-11-08 | 2017-03-29 | 浙江省检验检疫科学技术研究院 | A kind of real-time fluorescence PCR authentication method and its primer and probe of brave derived component |
| CN108588186A (en) * | 2017-03-10 | 2018-09-28 | 东北林业大学 | Brave Species specific identification method based on sonde method qPCR |
| CN108728434A (en) * | 2018-06-14 | 2018-11-02 | 浙江农林大学 | Rapid identification method for customs |
-
2010
- 2010-06-12 CN CN2010102029701A patent/CN101845508B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| 华育平等.《虎物种特异性鉴定的PCR方法研究》.《兽类学报》.2004,第24卷(第2期),全文. * |
| 朱军等.《基于ISSR标记技术的金钱豹遗传多样性分析》.《山西大学学报》.2008,第31卷(第2期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101845508A (en) | 2010-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shabani et al. | Halal authenticity of gelatin using species-specific PCR | |
| CN101845508B (en) | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA | |
| CN104046700B (en) | The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin | |
| Mane et al. | Detection of adulteration of meat and meat products with buffalo meat employing polymerase chain reaction assay | |
| CN104946790B (en) | A kind of PCR method for 8 kinds of animal derived materials of identification of tracing to the source | |
| Nguyen et al. | The development of PCR methodology for the identification of species of the tapeworm Moniezia from cattle, goats and sheep in central Vietnam | |
| CN105648046B (en) | Method for identifying sheep, goat, mink, nutria and duck meat at one time | |
| CN104946788A (en) | PCR primer and kit for identifying eight kinds of animal-derived components | |
| CN106967838A (en) | A kind of RPA primers, kit and detection method for detecting duck derived component | |
| CN104928391A (en) | Primer probe combination for identifying four components of canine animal origin, kit and multiple real-time fluorescence PCR (polymerase chain reaction) detection method | |
| CN104404145A (en) | Kit for quickly detecting meat adulteration based on LAMP method | |
| Rea et al. | Species identification in anchovy pastes from the market by PCR-RFLP technique | |
| CN105441547B (en) | For identifying multiple PCR primer and method and the application of Anji Chinese salamander | |
| CN105861652A (en) | Method for detecting and identifying deer species composition | |
| CN102643912A (en) | Amplification primer for detecting mink derived ingredients | |
| CN101845509B (en) | PCR detection primer of Panthera leo DNA, kit and detection method thereof | |
| CN104498593B (en) | Identify or auxiliary identify storage bean weevil primer to and test kit | |
| CN106636411A (en) | Xyleborus sp insect gene barcode detection kit and detection method thereof | |
| CN104962650A (en) | PCR method and kit for synchronously identifying animal-derived ingredients | |
| CN105385699A (en) | cytB specific sequences of four rats in river ports of three gorges area and molecular identification method | |
| CN104263821B (en) | Old animal specimen Species estimation test kit and preparation method | |
| Natonek-Wiśniewska et al. | Evaluation of the suitability of mitochondrial DNA for species identification of microtraces and forensic traces | |
| CN107475433B (en) | Mixed animal species identification method and primer | |
| CN104611456A (en) | Specific primer for detecting species components of blue foxes and application thereof | |
| CN105969839A (en) | Taqman-LNA multiplex quantitative PCR method for simultaneously detecting cattle and pig-derived ingredient in meat and meat product, primer probe and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: CAO JIJUAN YU KE Free format text: FORMER OWNER: CAO JIJUAN Effective date: 20141225 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xu Junyi Inventor after: Cao Jijuan Inventor after: Yu Ke Inventor before: Xu Junyi Inventor before: Cao Jijuan |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 116000 DALIAN, LIAONING PROVINCE TO: 116001 DALIAN, LIAONING PROVINCE Free format text: CORRECT: INVENTOR; FROM: XU JUNYI CAO JIJUAN TO: XU JUNYI CAO JIJUAN YU KE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20141225 Address after: 116001 No. 60 Changjiang East Road, Zhongshan District, Liaoning, Dalian Patentee after: Xu Junyi Patentee after: Cao Jijuan Patentee after: Yu Ke Address before: 116000 No. 39 Renmin Road, Zhongshan District, Liaoning, Dalian Patentee before: Xu Junyi Patentee before: Cao Jijuan |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120620 Termination date: 20150612 |
|
| EXPY | Termination of patent right or utility model |