CN101845509B - PCR detection primer of Panthera leo DNA, kit and detection method thereof - Google Patents
PCR detection primer of Panthera leo DNA, kit and detection method thereof Download PDFInfo
- Publication number
- CN101845509B CN101845509B CN2010102030183A CN201010203018A CN101845509B CN 101845509 B CN101845509 B CN 101845509B CN 2010102030183 A CN2010102030183 A CN 2010102030183A CN 201010203018 A CN201010203018 A CN 201010203018A CN 101845509 B CN101845509 B CN 101845509B
- Authority
- CN
- China
- Prior art keywords
- dna
- lion
- pcr
- detection
- real
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a PCR detection primer of Panthera leo DNA, a kit and a detection method thereof, and respectively establishes the PCR detection primer of the Panthera leo DNA, the kit and the detection method thereof by real-time fluorescence PCR detection and common PCR detection, wherein, primer sequences comprise SEQ ID No. 1 and SEQ ID No.2. The invention further discloses the real-time fluorescence PCR assay kit of the Panthera leo DNA containing the primer and the corresponding detection method thereof, the common PCR assay kit and the corresponding detection method thereof. The invention has strong specificity of the primer, simple and convenient detection kit and method with easy use, accurate results, high specificity and high sensitivity.
Description
Technical field
The present invention relates to the gene tester of lion.Especially the real-time fluorescence PCR detection method of lion gene reaches wherein related Auele Specific Primer and related kit.
Background technology
The zoophagous animal that exists at present on the earth probably has 11 sections, is exactly felid and there are characteristics also most important most.Lion is commonly called as lion, is exactly the big cat of a kind of existence in Africa and Asia.Lion belongs to Mammalia (Mammalia), Carnivora (Carnivora), cat family (Felidae), Panthera (Panthera), lion kind (P.leo).13-14 subspecies are arranged approximately: northeast the Congo lion (P.l.azandica) in the lion kind; Angola lion (P.l.bleyenberghi); Europe lion (P.l.europaea); The Congo lion (P.l.hollisteri); Transvaal lion (P.l.krugeri); Ba Bali lion (P.l.leo); Spot lion (P.l.maculatus); Marseille lion (P.l.massaicus); Open general lion (P.l.melanochaita); East Africa lion (P.l.nubica); Asia lion (P.l.persica); Senegal lion (P.l.senegalensis); Somalia lion (P.l.someliensis); Noise made in coughing or vomiting Harry lion (P.l.verneyi).This wherein European lion, Ba Bali lion, spot lion, opens the disappearance on earth of five subspecies such as general lion, noise made in coughing or vomiting Harry lion, and remaining most subspecies are all lived in the Africa (Bauer et al, 2008) that Saha draws south, desert.
Big cat as other is the same, and maximum danger is exactly human hunting concerning lion.Because human kills in a large number, five subspecies in Europe And Africa continent are become extinct, and the Asia lion then is close to destruction." illegal transaction of wildlife has almost only lagged behind drug trade ".In order to protect precious endangered species, most of country in the world all forbids catching and killing of wildlife and trade through legal means.Yet, because huge economic interests drive, still there is the people neck or nothing to carry out the smuggling and the trade of precious endangered species correlated product, the somebody utilizes imitation to adulterate and seeks exorbitant profit.So have a kind of method to identify the material of lion source property, like food, medicine, fur etc.
An advanced application in the wildlife evidence obtaining is carried out work through DNA analysis exactly.Using at present commonplace in the world is the PCR detection method, but detected result only depends on the stripe size on the gel to judge, if the product band a little less than, be difficult to obtain result accurately through naked eyes; And domestic research for this field does not almost appear in the newspapers.This research is adopted SYBR Green I real-time fluorescence PCR to detect and is identified the lion goods; Through SYBR Green I fluorescence intensity in the detection reaction system; Reach the purpose that detects PCR product amplification amount; Improved the sensitivity that PCR detects greatly, had simultaneously in real time, advantage efficiently, the effective ways of rapid detection evaluation lion goods are provided for customs, the Animal or Plant Quarantine and protection of animal tissue.
Summary of the invention
The object of the invention promptly is to provide convenience, fast, the real-time fluorescence PCR detection method of detection by quantitative lion DNA, and the employed test kit that comprises specific primer sequence in detecting delicately.
For realizing above-mentioned purpose, the present invention at first provides the real-time fluorescent PCR testing primer of lion DNA, and they are:
Primer sequence:
Forward primer (SEQ ID NO.1): 5 ' CAAACCTGAATGGTACTTCCTA 3 ',
Reverse primer (SEQ ID NO.2): 5 ' AGATGGGTATTAGGATTAGAAGA 3 '.
On this basis; The present invention also provides the real-time fluorescence PCR assay kit of lion DNA; Described test kit comprises detection solution, contains SYBR Premix Ex Taq (2 *), forward primer 10 μ M, reverse primer 10 μ M, Rox Dye II (50 *) in this detection solution; Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
The present invention further provides the PCR detection method of utilizing the mentioned reagent box to detect lion DNA, and this method is used the mentioned reagent box, comprises the steps:
1. extract testing sample DNA, obtain template DNA solution;
2. reaction system: get the template DNA solution that 1. 2 μ l steps make; Add SYBR Premix Ex Taq (2 *) 10 μ l, forward primer 0.4 μ l, reverse primer 0.4 μ l, Rox Dye II (50 *) 0.4 μ l in the mentioned reagent box; Add sterilization ultrapure water 6.8 μ l again, make TV 20 μ l; Above each component is added in the 0.2mL real-time fluorescence PCR reaction tubes 5000r/min, centrifugal 10s;
3. step reaction system is 2. carried out the real-time fluorescence PCR detection by following condition:
95 ℃/3s, once circulation; 95 ℃/5s, 66 ℃/34s, 40 circulations;
When annealing, each round-robin collects fluorescence, after detection finishes, according to the amplification curve result of determination.
Reliable detection identifies that the reaction system of lion metal products is based upon suitable gene fragment and selects, and the essential species specificity of selected gene is strong, but variability is smaller in species.In order to select the gene fragment of a suitable evaluation lion, we used European Molecular Bioglogy Laboratory DB (gene databanks, EMBL), data between more abundant kind.In some candidate gene fragments, selected mitochondrial cytochrome b (Cyt b) gene fragment.The result of data comparison on the internet shows that it is right that this fragment gene sequence has enough specificitys can satisfy the primer that designs species specificity.Mitochondrial cytochrome b (Cyt b) gene fragment has very high variability in vertebrates.The present invention designed is used for the primer of qualitative detection lion source material; Specific SYBR Green I real-time fluorescence PCR amplification curve in lion blood, lion meat sample, can occur, amplification curve not occur in the reaction of other 14 kinds of non-lion source property samples (tiger, leopard, bear, ox, sheep, horse, pig, dog, rabbit, donkey, deer) SYBR Green I real-time fluorescence PCR.
SYBR Green I real-time fluorescence PCR detection method is to use comparatively general a kind of method for quick in recent years.It combines emitting characteristics to indicate the increase of amplified production through SYBR Green I optical dye with double chain DNA molecule, need not to design in addition fluorescent probe (Qiao Lijuan etc., 2009).Handiness, versatility height are its advantages, but mean that also specificity is low, because optical dye can combine with any double-stranded DNA, so dna primer dimer or other non-specific amplification products can produce quantitative result and disturb (causing low Ct value).The specificity and the repeatability of reaction have also been reduced simultaneously.Therefore this research is optimized from aspects such as design of primers and purifying template, PCR programdesigns.In pcr amplification, template amount and annealing temperature are bigger to PCR specific amplification influence, grope so in this test template amount and annealing temperature are established gradient respectively.Under equal conditions select lower template amount, higher annealing temperature as far as possible, optimized the PCR reaction, improved primer specificity, overcome the low shortcoming of SYBR Green I specificity.
The another kind of regular-PCR detection kit of lion DNA; It is characterized in that comprising in this test kit a kind of detection solution, contain 10 * PCR damping fluid, 10 μ mol/L forward primers, 10 μ mol/L reverse primers, 10m mol/L dNTP, 5U/ μ L Taq archaeal dna polymerase in this detection solution;
Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
Use the regular-PCR detection kit to detect the regular-PCR detection method of lion DNA, comprise the steps:
1. extract testing sample DNA, obtain template DNA solution;
2. reaction system: get the template DNA solution that 1. 1 μ l step makes, add the solution 6.2 μ l in the mentioned reagent box, add sterilization ultrapure water to TV 25 μ l again; Above each component is added in the 0.2mL real-time fluorescence PCR reaction tubes mixing, 5000r/min, centrifugal 10s;
3. step reaction system is 2. carried out the regular-PCR detection by following condition:
Sex change in advance: 94 ℃, 3min;
Get into circulation: 94 ℃ of sex change 60s, 66 ℃ of annealing 60s, 72 ℃ are extended 60s, 35 circulations;
Stop extending: 72 ℃, 7min;
Preserve reaction product for 4 ℃.
4. step reaction product is 3. carried out electrophoresis, according to the electrophoretic band size result of determination of reaction product.
The present invention adopts the PCR detection technique, and DNA identifies to lion.The present invention adopts SYBR Green I real-time fluorescence PCR detection method and regular-PCR detection method to identify the lion goods respectively.SYBR Green I real-time fluorescence PCR detection method reaches the purpose that detects PCR product amplification amount through SYBR Green I fluorescence intensity in the detection reaction system, has improved the sensitivity that PCR detects greatly, has simultaneously in real time, advantage efficiently; The regular-PCR detection method except that having high specific, susceptibility, has more practicality because of it has the characteristics simple and easy to do, quick, that cost is low etc.These two kinds of methods are that customs, the Animal or Plant Quarantine and protection of animal tissue provide rapid detection to identify the effective way of lion goods.
Description of drawings
Fig. 1 lion derived component SYBR Green I real-time fluorescence PCR detection specificity amplification curve;
Fig. 2 lion derived component SYBR Green I real-time fluorescence PCR melting curve;
Fig. 3 lion derived component SYBR Green I real-time fluorescence PCR detection sensitivity amplification curve;
Fig. 4 lion derived component regular-PCR detection specificity amplification;
Lion derived component PCR detection specificity amplification in Fig. 5 hair;
Fig. 6 lion derived component PCR detection sensitivity amplification.
Embodiment
Be specific embodiment of the present invention below, it is further described the foundation and the application thereof of technical scheme of the present invention, but does not limit content of the present invention in any form.
If no specified otherwise; This part is tested samples such as used Asia lion blood, Asia lion meat, East Africa lion blood, northeastern tiger blood, a seal brave blood, bangladesh tiger blood, leopard blood, snow leopard blood, black bear blood and is provided by forest animal garden, Dalian, and samples such as bovine bone powder, goat bone powder, Os Sus domestica powder, donkey bone meal, rabbit bone meal, deer bone powder, horse bone meal, dog bone meal are the national standard sample; Above-mentioned blood class test sample adopts Blood Genome DNA Extraction Kit test kit to carry out the extraction of genomic dna, available from precious biotechnology (Dalian) ltd, article No. D9081; Other tissue class and the animal derived plant feed genome DNA extracting reagent kit of bone meal class samples using extract, available from TIANGEN Biotech (Beijing) Co., Ltd., and article No. DP323-03; Supercentrifuge centrifuge 5804 (Eppendorf company, Germany), real-time fluorescence PCR amplification appearance (ABI 7500 Real-Time PCR System; The U.S.), regular-PCR appearance, (PE24000; The U.S.); Nucleic acid-protein analyser (Beckman DU640), and thermostatic drying chamber (SANYO mov-213F, Japan).
The real-time fluorescence PCR assay kit of embodiment 1 lion DNA and the foundation of detection method
One, the design of the real-time fluorescent PCR testing primer of Panthera leo DNA
Go up reported sequence and relevant document (Driscoll et al, 2002 of reference according to GenBank; Burger et al, 2004; Dubach et al, 2005), belonging to animal mitochondria cytochrome b (Cyt b) gene design Auele Specific Primer to lion, the primer sequence that is designed for detection is following:
Forward primer (SEQ ID NO.1): 5 ' CAAACCTGAATGGTACTTCCTA 3 ',
Reverse primer (SEQ ID NO.2): 5 ' AGATGGGTATTAGGATTAGAAGA 3 '.
Two, the structure of the real-time fluorescence PCR assay kit of Panthera leo DNA
On the right basis of the above-mentioned Auele Specific Primer that obtains; Be designed for the test kit of the real-time fluorescence PCR detection of lion DNA; Test kit comprises detection solution, contains SYBR Premix Ex Taq (2 *), forward primer 10 μ M, reverse primer 10 μ M, Rox Dye II (50 *) in this detection solution; Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
Three, the foundation of the real-time fluorescence PCR detection method of lion DNA
1, the preparation of DNA sample
The DNA sample preparation methods of present embodiment is specially with reference to " DNA and RNA basic experiment technology " (the Wood chief editor breathes out in Science Press, A.J., and Sheng Xiaoyu etc. translate):
(1) specimen preparation:
Lion meat sample: take by weighing the muscle tissue of about 100g lion, chopping is spent the night in 120 ℃ of bakings, is ground into powder with tissue grinder.
Blood sample: 2% EDTA Disodium (EDTA) anti-freezing of every milliliter of blood sample adding 2mg is for use.
Bone meal sample: can directly be used for DNA extraction
(2) DNA extraction: adopt the test kit extraction method to prepare testing sample DNA genome
Blood class test sample adopts Blood Genome DNA Extraction Kit test kit to carry out the extraction of genomic dna, available from precious biotechnology (Dalian) ltd, article No. D9081.Other tissue class and the animal derived plant feed genome DNA extracting reagent kit of bone meal class samples using extract, available from TIANGEN Biotech (Beijing) Co., Ltd., and article No. DP323-03.
2, PCR reaction
Get 2ul testing sample dna solution, add the solution 11.2 μ l of the test kit of the real-time fluorescence PCR detection that is used for lion DNA, add sterilization ultrapure water to TV 20 μ l again; Above each component is added in the 0.2mL real-time fluorescence PCR reaction tubes 5000r/min, centrifugal 10s; Carry out pcr amplification by following parameter then:
95 ℃/3s, 1 circulation; 95 ℃/5s, 66 ℃/34s, 40 circulations;
When annealing, each round-robin collects fluorescence, after detection finishes, according to the amplification curve result of determination.
3, the result judges
Blank: no fluorescence amplification phenomenon, no melting curve crest;
Negative control: no fluorescence amplification phenomenon, no melting curve crest; Negative findings shows that sample does not detect the lion derived component.
Positive control: fluorescence amplification phenomenon is arranged, the melting curve crest is arranged; Positive findings shows that sample detects the lion derived component.
Otherwise it is invalid that experiment is regarded as;
The real-time fluorescence PCR detection method specificity experiment of embodiment 2 lion DNA
Adopt detection kit that contains Auele Specific Primer and the detection method of embodiment 1 to detect lion DNA sample.Detect other animal DNA samples such as bear, ox simultaneously.Specificity with to method is assessed.
The DNA of 17 kinds of listed blood, tissue and bone meal class sample carries out SYBR Green I real-time fluorescence PCR and detects.The SYBR Green I real-time fluorescence PCR amplification curve of lion specific specificity detected result is as shown in Figure 1, and melting curve is as shown in Figure 2, among Fig. 1, Fig. 2: 1. Asia lion meat, 2. Asia lion blood, 3. East Africa lion blood; 4. northeastern tiger blood 5. prints brave blood, 6. bangladesh tiger blood, 7. leopard blood, 8. snow leopard blood; 9. black bear blood, 10. bovine bone powder, 11. sheep bone meal, 12. Os Sus domestica powders, 13. donkey bone meal; 14. rabbit bone meal, 15. deer bone powders, 16. horse bone meal, 17. dog bone meal, 18. water.Test-results shows; The blood of Asia lion subspecies and muscle tissue dna sample in the lion kind; The blood DNA sample of East Africa lion subspecies specific real-time amplification curve all occurs through the amplification of SYBR Green I real-time fluorescence PCR after 19 circulations, average melting temperature (Tm) is at 84 ± 0.2 ℃.And 6 kinds of blood DNA samples of tiger, leopard, bear; Real-time amplification curve does not all appear in the detected result of 8 kinds of Mammals bone meal dna samples such as ox, sheep, horse, pig, dog, rabbit, donkey, deer and the contrast of blank water in 40 circulations; Do not occur the crest of melting curve yet, all can be judged as negative findings.The above results shows: the SYBR Green I real-time fluorescence PCR primer of this test design can detect and discriminating lion derived component by specific amplification, has excellent specificity.
The real-time fluorescence PCR detection method sensitivity experiment of embodiment 3 lion DNA
Lion digested tankage and beef bone meal series per-cent (100%, 10%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0%) mixture carry out the extraction of mixture genomic dna according to embodiment 1 bone meal DNA extraction method.This serial mixture D NA is used to carry out the detection sensitivity analysis.Make an experiment according to SYBR Green I real-time fluorescence PCR amplification condition among the embodiment 1, the result is as shown in Figure 3, among Fig. 3: 1.100% lion digested tankage, 2.10% lion digested tankage, 3.1% lion digested tankage, 4.0.5% lion digested tankage, 5.0.1% lion digested tankage, 6.0.05% lion digested tankage.
Test-results shows that amplification condition provided by the invention can be to amplify specific SYBR Green I real-time fluorescence PCR amplification curve in 100% lion digested tankage, 10% lion digested tankage, 1% lion digested tankage, 0.5% lion digested tankage, the 0.1% lion digested tankage at content.The above results shows: the SYBR Green I real-time fluorescence PCR primer of this test design can detect the lion derived component of 0.1% content in the bone meal.
The regular-PCR detection kit of embodiment 4 lion DNA and the foundation of detection method
One, the regular-PCR of Panthera leo DNA detects primer design: with embodiment 1.
Two, the structure of the regular-PCR detection kit of Panthera leo DNA
On the right basis of the above-mentioned Auele Specific Primer that obtains; Be designed for the test kit of the regular-PCR detection of lion DNA; Test kit comprises detection solution, contains 10 * PCR damping fluid, 10 μ mol/L forward primers, 10 μ mol/L reverse primers, 10 μ mol/L dNTP, 5U/ μ L Taq archaeal dna polymerase in this detection solution; Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
Three, the foundation of the regular-PCR detection method of lion DNA
1, the preparation of DNA sample
The DNA sample preparation methods of present embodiment is specially with reference to " DNA and RNA basic experiment technology " (the Wood chief editor breathes out in Science Press, A.J., and Sheng Xiaoyu etc. translate):
(1) specimen preparation:
Lion meat sample: take by weighing the muscle tissue of about 100g lion, chopping is spent the night in 120 ℃ of bakings, is ground into powder with tissue grinder.
Blood sample: it is for use that blood sample adds 2% EDTA Disodium (EDTA) anti-freezing.
Bone meal sample: can directly be used for the extraction of DNA.
(2) DNA extraction
Blood class test sample adopts Blood Genome DNA Extraction Kit test kit to carry out the extraction of genomic dna, available from precious biotechnology (Dalian) ltd, article No. D9081.Other tissue class and the animal derived plant feed genome DNA extracting reagent kit of bone meal class samples using extract, available from TIANGEN Biotech (Beijing) Co., Ltd., and article No. DP323-03.
2, PCR reaction
Get 2ul testing sample dna solution, add the solution 6.2 μ l of the test kit of the regular-PCR detection that is used for lion DNA, add sterilization ultrapure water to TV 25 μ l again; Above each component is added in the 0.2mL real-time fluorescence PCR reaction tubes 5000r/min, centrifugal 10s; Carry out pcr amplification by following parameter then:
Sex change in advance: 94 ℃, 3min;
Get into circulation: 94 ℃ of sex change 60s, 66 ℃ of annealing 60s, 72 ℃ are extended 60s, 35 circulations;
Stop extending: 72 ℃, 7min;
Preserve reaction product for 4 ℃.
3, the result judges
With 100bp marker is contrast, and it is positive the specific amplification band to occur at target fragment size place, does not have the specific amplification band negative.
The regular-PCR detection method of embodiment 5 lion DNA is to the specificity experiment of DNA in muscle and the blood sample
Adopt detection kit that contains Auele Specific Primer and the detection method of embodiment 4 to detect lion DNA sample.Detect other animal DNA samples such as bear, ox simultaneously, assess with the specificity to method, the result is as shown in Figure 4, among Fig. 4: M.100bp marker 1. Asia lion meat, 2. Asia lion blood, 3. Asia lion hair; 4. East Africa lion blood, 5. northeastern tiger blood, 6. seal brave blood, 7. bangladesh tiger blood, 8. leopard blood, 9. snow leopard blood; 10. black bear blood, 11. bovine bone powders, 12. sheep bone meal, 13. Os Sus domestica powders, 14. donkey bone meal; 15. rabbit bone meal, 16. deer bone powders, 17. horse bone meal, 18. dog bone meal, 19. water.
Test-results shows, the blood of Asia lion subspecies, muscle tissue and hair dna sample in the lion kind, and the blood DNA sample of East Africa lion subspecies obtains positive amplified production through pcr amplification.And 6 kinds of blood DNA samples of tiger, leopard, bear, the detected result of 8 kinds of Mammals bone meal dna samples such as ox, sheep, horse, pig, dog, rabbit, donkey, deer and the contrast of blank water is negative findings.The above results shows: primer that the present invention designs is the specificity amplification primer of lion DNA, and the DNA that comes from Different Individual and different tissues is had same expanding effect.
The regular-PCR detection method of embodiment 6 lion DNA is to the specificity experiment of DNA in the hair shaft
Asia lion, northeastern tiger, leopard, the Persian cat hair that comes off is carried out DNA extraction and amplification, and experimental result is as shown in Figure 5, among Fig. 5: M.100bp marker 1. northeastern tiger hairs, 2. leopard hair, 3. Persian cat hair, 4. Asia lion hair.Fig. 5 shows that only specific amplified band appears in Asia lion sample, and the hair detection result of northeastern tiger, leopard and Persian cat is all negative.The provable primer of The above results is only special to lion.
The regular-PCR detection method sensitivity experiment of embodiment 7 lion DNA
Lion digested tankage and beef bone meal series per-cent (100%, 10%, 1%, 0.5%, 0.1%) mixture with preparation carry out the extraction of mixture genomic dna according to the bone meal DNA extraction method among the embodiment 4.This serial mixture D NA is used to carry out the detection sensitivity analysis.The pcr amplification condition that provides according to embodiment 4 makes an experiment, and the result is as shown in Figure 6, among Fig. 6: marker 1. H M.100bp
2O, 2. 100% lion digested tankage, 3. 10% lion digested tankage, 4. 1% lion digested tankage, 5. 0.5% lion digested tankage, 6. 0.1% lion digested tankage.
Test-results shows, uses the amplification condition among the embodiment 4, can be to amplify specific pcr amplification band in 100% lion digested tankage, 10% lion digested tankage, 1% lion digested tankage, the 0.5% lion digested tankage at content.The above results shows: the specific PCR primer of this test design can detect the lion derived component of 0.5% content in the bone meal.
Claims (5)
1. the real-time fluorescent PCR testing primer of Panthera leo DNA is characterized in that:
Primer sequence:
Forward primer (SEQ ID NO.1): 5 ' CAAACCTGAATGGTACTTCCTA 3 ',
Reverse primer (SEQ ID NO.2): 5 ' AGATGGGTATTAGGATTAGAAGA 3 '.
2. the real-time fluorescence PCR assay kit of Panthera leo DNA is characterized in that comprising in this test kit a kind of detection solution, contains SYBR Premix Ex Taq (2 *), forward primer 10 μ M, reverse primer 10 μ M, Rox Dye II (50 *) in this detection solution;
Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
3. the real-time fluorescence PCR detection method of Panthera leo DNA is characterized in that using the described test kit of claim 2, comprises the steps:
1. extract testing sample DNA, obtain template DNA solution;
2. reaction system: get the template DNA solution that 1. 2 μ l steps make, add the solution 11.2 μ l in the mentioned reagent box, add sterilization ultrapure water to TV 20 μ l again; Above each component is added in the 0.2mL real-time fluorescence PCR reaction tubes 5000r/min, centrifugal 10s;
3. step reaction system is 2. carried out the real-time fluorescence PCR detection by following condition:
95 ℃/3s, 1 circulation; 95 ℃/5s, 66 ℃/34s, 40 circulations;
When annealing, each round-robin collects fluorescence, after detection finishes, according to the amplification curve result of determination.
4. the regular-PCR detection kit of Panthera leo DNA; It is characterized in that comprising in this test kit a kind of detection solution, contain 10 * PCR damping fluid, 10 μ mol/L forward primers, 10 μ mol/L reverse primers, 10m mol/L dNTP, 5U/ μ L Taq archaeal dna polymerase in this detection solution;
Wherein, described forward primer sequence is SEQ ID NO.1, and the reverse primer sequence is SEQ ID NO.2.
5. the regular-PCR detection method of Panthera leo DNA is characterized in that using the described test kit of claim 4, comprises the steps:
1. extract testing sample DNA, obtain template DNA solution;
2. reaction system: get the template DNA solution that 1. 1 μ l step makes, add the solution 6.2 μ l in the said test kit of claim 4, add sterilization ultrapure water to TV 25 μ l again; Above each component is added in the 0.2mL PCR reaction tubes mixing, 5000r/min, centrifugal 10s;
3. step reaction system is 2. carried out the regular-PCR detection by following condition:
Sex change in advance: 94 ℃, 3min;
Get into circulation: 94 ℃ of sex change 60s, 66 ℃ of annealing 60s, 72 ℃ are extended 60s, 35 circulations;
Stop extending: 72 ℃, 7min;
Preserve reaction product for 4 ℃;
4. step reaction product is 3. carried out electrophoresis, according to the electrophoretic band size result of determination of reaction product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102030183A CN101845509B (en) | 2010-06-12 | 2010-06-12 | PCR detection primer of Panthera leo DNA, kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102030183A CN101845509B (en) | 2010-06-12 | 2010-06-12 | PCR detection primer of Panthera leo DNA, kit and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101845509A CN101845509A (en) | 2010-09-29 |
| CN101845509B true CN101845509B (en) | 2012-05-02 |
Family
ID=42770327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102030183A Expired - Fee Related CN101845509B (en) | 2010-06-12 | 2010-06-12 | PCR detection primer of Panthera leo DNA, kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101845509B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160616B (en) * | 2013-03-11 | 2014-10-15 | 中国农业科学院兰州兽医研究所 | Swine vesicular disease assay kit |
| CN108570493A (en) * | 2017-03-10 | 2018-09-25 | 东北林业大学 | The method that sonde method qPCR carries out lion Species specific identification |
| CN114057552A (en) * | 2021-11-22 | 2022-02-18 | 黑龙江冠卓检测科技有限公司 | Preparation method of cannabidiol standard substance for detection |
-
2010
- 2010-06-12 CN CN2010102030183A patent/CN101845509B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| 华育平等.《用PCR方法对虎DNA进行特异性检测》.《野生动物》.2002,(第1期),全文. * |
| 华育平等.《虎物种特异性鉴定的PCR方法研究》.《兽类学报》.2004,第24卷(第2期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101845509A (en) | 2010-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fajardo et al. | A review of current PCR-based methodologies for the authentication of meats from game animal species | |
| Karabasanavar et al. | A highly specific PCR assay for identification of raw and heat treated mutton (Ovis aries) | |
| Mane et al. | Detection of adulteration of meat and meat products with buffalo meat employing polymerase chain reaction assay | |
| KR101209786B1 (en) | PCR or real-time PCR primers for identification of animal species, the kit comprising the primers, and the method for identifying animal species using the primers or kits | |
| CN101845508B (en) | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA | |
| CN103361422A (en) | Multiplex-PCR rapid detection method for identification of adulterated meat and products thereof | |
| CN107058498B (en) | Triple real-time fluorescence PCR method for detecting bovine, ovine and porcine derived components | |
| CN104946790A (en) | PCR method for tracking source identification of origin components of eight kinds of animals | |
| Espiñeira et al. | Detection and identification of anisakids in seafood by fragment length polymorphism analysis and PCR–RFLP of ITS-1 region | |
| Hsieh et al. | Detection of undeclared animal by‐products in commercial canine canned foods: Comparative analyses by ELISA and PCR‐RFLP coupled with slab gel electrophoresis or capillary gel electrophoresis | |
| Liu et al. | A multiplex PCR assay mediated by universal primers for the detection of adulterated meat in mutton | |
| KR101802034B1 (en) | Method and kit for identifying species of squids using real-time PCR | |
| CN107988427A (en) | Prawn hepatopancreatic parvovirus（HPV）RAA constant temperature fluorescence detection method and reagent | |
| CN101845509B (en) | PCR detection primer of Panthera leo DNA, kit and detection method thereof | |
| Nuraini et al. | The use of cytochrome b gene as a specific marker of the rat meat (Rattus norvegicus) on meat and meat products | |
| CN102242220B (en) | Polymerase chain reaction (PCR) primer pair for identifying or assisting in identifying duck tissues and/or organs and application of PCR primer pair | |
| CN102643912A (en) | Amplification primer for detecting mink derived ingredients | |
| CN100485045C (en) | Method and kit for detecting pine wood nematode, and special-purpose primer and probe for same | |
| JP6413122B2 (en) | Mushroom identification method and identification kit | |
| CN102417930B (en) | Loop-mediated isothermal amplification-based nucleic acid test method for Riemerella anatipestifer | |
| CN104962650A (en) | PCR method and kit for synchronously identifying animal-derived ingredients | |
| CN101519682B (en) | Method for detecting cat source components in food and fodder and kit | |
| CN107557453A (en) | Primer, probe, kit and its application based on RPA technology for detection pig derived components | |
| CN107604050A (en) | Primer, probe, kit and its application based on RPA technology for detection duck derived components | |
| CN105779642A (en) | Real-time fluorescent PCR primer, probe, kit and detection method for identifying component of promicrops lanceolatus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: CAO JIJUAN YU KE Free format text: FORMER OWNER: CAO JIJUAN Effective date: 20141225 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xu Junyi Inventor after: Cao Jijuan Inventor after: Yu Ke Inventor before: Xu Junyi Inventor before: Cao Jijuan |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 116000 DALIAN, LIAONING PROVINCE TO: 116001 DALIAN, LIAONING PROVINCE Free format text: CORRECT: INVENTOR; FROM: XU JUNYI CAO JIJUAN TO: XU JUNYI CAO JIJUAN YU KE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20141225 Address after: 116001 No. 60 Changjiang East Road, Zhongshan District, Liaoning, Dalian Patentee after: Xu Junyi Patentee after: Cao Jijuan Patentee after: Yu Ke Address before: 116000 No. 39 Renmin Road, Zhongshan District, Liaoning, Dalian Patentee before: Xu Junyi Patentee before: Cao Jijuan |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120502 Termination date: 20150612 |
|
| EXPY | Termination of patent right or utility model |