CN101845442B - Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof - Google Patents
Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof Download PDFInfo
- Publication number
- CN101845442B CN101845442B CN2010101610961A CN201010161096A CN101845442B CN 101845442 B CN101845442 B CN 101845442B CN 2010101610961 A CN2010101610961 A CN 2010101610961A CN 201010161096 A CN201010161096 A CN 201010161096A CN 101845442 B CN101845442 B CN 101845442B
- Authority
- CN
- China
- Prior art keywords
- hil
- silkworm
- human interleukin
- gene
- pfastbac
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of gene engineering, in particular to a method for preparing human interleukin 28A by a silkworm bioreactor. Recombined silkworm Bombyx mori recombinant baculovirus with a human interleukin 28A (hIL-28A) gene is obtained by an gene engineering method and is used for inoculating silkworm larvae or pupae, so that the human interleukin 28A is expressed with high efficiency in the silkworm larvae or pupae. Because the invention uses the silkworm bioreactor to produce the recombinant human interleukin 28A (hIL-28A), silkworms can be edible or medicinal, the silkworm larvae and pupae expressing the hIL-28A can be directly freeze-dried, and an expression product does not need to be purified and can be directly used as an oral medicine, so that the invention has the advantages of simple preparation process, low cost, convenient use of the oral medicine and the like and can also reduce some side effects of an injection medicament form.
Description
Technical field
The present invention relates to the genetically engineered field, be specifically related to a kind of method and pharmaceutical applications thereof that utilizes preparing human interleukin 28 A by silkworm bioreactor.
Background technology
Ro 24-7472/000 (interleukin) 28A (hIL-28A) is a kind of novel interferon lambda (IFN-λ), with the function class of I interferoid (IFN) seemingly, have antiviral, antiproliferative and immunomodulatory isoreactivity.People nature interleukin is through stimulating lymphoblast and human leukocytes respectively, the preparation and getting of purifying then.The Interferon, rabbit that is only produced by lymphoblastoid of existing market supply is the mixture of natural many hypotypes.Clinical usefulness mainly be recombination preparation, formulation mainly contains pulvis and aqua, no oral dosage form uses to be drug administration by injection.
Silkworm baculovirus expression vector system (Bombyx mori baculovirus expressionvector system) is an eukaryotic expression system, existing many genes successful expression in this system.With this system expression alien gene in silkworm, expression level is high, the product biological activity is good.
At present, do not see the report that utilizes silkworm baculovirus expression vector system expressing human interleukin-(interleukin) 28A, and about the report of Ro 24-7472/000 (interleukin) 28A oral prepns.
Summary of the invention
The object of the invention provides a kind of method of utilizing preparing human interleukin 28 A by silkworm bioreactor.
For achieving the above object; The technical scheme that the present invention adopts is: a kind of method of utilizing preparing human interleukin 28 A by silkworm bioreactor; Obtain the silkworm Bombyx mori baculovirus that has human interleukin 28 A (hIL-28A) gene of reorganization through gene engineering method; And, make human interleukin 28 A in silkworm larva or pupa, obtain to efficiently express with this virus inoculation silkworm larva or pupa.Larva that efficiently expresses human interleukin 28 A or silkworm chrysalis are prepared into oral prepns, show to have remarkable antitumor effect through animal experiment.
In the technique scheme, the preparation method of the silkworm Bombyx mori recombinant baculovirus that has human interleukin 28 A (hIL-28A) gene of said reorganization is:
(1) according to the cDNA sequence of the disclosed hIL-28A of GenBank (the GenBank accession number: BC113583), the encoding sequence of synthetic hIL-28A gene, the clone advances the T-carrier, obtains the pUC-hIL-28A plasmid;
(2) reclaim the hIL-28A gene fragment with BamH I/EcoR I double digestion digestion pUC-hIL-28A plasmid; PFastBac-Dual reclaims the pFastBac-Dual fragment with BamH I/EcoR I double digestion digestion donor plasmid; The hIL-28A gene fragment is inserted between the BamH I and EcoR I of pFastBac-Dual, the baculovirus polyhedrin body gene promoter downstream that hIL-28A is cloned in the pFastBac-Dual carrier into obtain the pFastBac-Dual-hIL-28A recombinant plasmid;
Wherein, plasmid pFastBac-Dual is the product of American I nvitrogen company, and its product is called PFASTBAC-DUAL EXP VECTOR; The pFastBac-Dual carrier belongs to Bac-to-Bac (Bacteria to Baculovirus) expression system,
(3) with pFastBac-Dual-hIL-28A recombinant plasmid transformed intestinal bacteria BmDH10Bac competent cell; Coat on the LB agar culture plate that contains tsiklomitsin, kantlex, qingfengmeisu qiong, IPTG, X-gal; The picking white colony is cultivated, and extracts reorganization Bacmid genome Bacmid-hIL-28A DNA;
(4) with Bacmid-hIL-28A DNA by liposome-mediated transfection silkworm cultured cell BmN, get supernatant behind the culturing cell, obtain recombinant baculovirus BmNPV-hIL-28A.
In the technique scheme; Adopt the method for said silkworm Bombyx mori recombinant baculovirus inoculation silkworm larva or pupa to be: BmN increases with recombinant baculovirus BmNPV-hIL-28A infected silkworm culturing cell, adopt recombinant baculovirus BmNPV-hIL-28A after the amplification be seeded to five age silkworm larva or pupa.Further, get the hemolymph of silkworm after 5 days or pupa, analyzing and testing hIL-28A expression level, the result shows that the amount of reorganization hIL-28A in every milliliter of hemolymph reaches 33 μ g.
Another object of the present invention is that a kind of preparation method who contains the human interleukin 28 A medicine is provided; For realizing this purpose; The technical scheme that adopts does; A kind of preparation method who contains the human interleukin 28 A medicine adopts silkworm larva or the pupa of the infection recombinant silkworm baculovirus of technique scheme acquisition after lyophilize, to process oral drug preparation; Show to have remarkable antitumor effect through animal experiment.
Because the technique scheme utilization, the present invention compared with prior art has advantage:
1. owing to adopt the pFastBac-Dual carrier to carry out the transfection of hIL-28A gene among the present invention; For other carriers; Simplified screening process greatly: the pFastBac-Dual carrier belongs to Bac-to-Bac (Bacteria to Baculovirus) expression system, compares with traditional BEVS (Baculovirus expressionvector system) to have three advantages: (1) has been shortened recombinant virus and has been made up the required time.The tradition recombinant virus makes up, and the consummate personnel of method and technology also need 6-9 time-of-week even longer time.Just can successfully make up in the 7-9 of system days and make up Bac-to-Bac; (2) can screen according to bacterial plaque indigo plant, white colour, not need the plaque analysis to come purification of Recombinant virus, swivel base and purifying rate are high, and the purifying rate reaches 100%; (3) evaluation of recombinant virus and the time of purifying have been shortened; Host cells infected or larva can obtain a large amount of exogenous gene expression products.
2. because the present invention produces recombination human interleukin 28A (hIL-28A) with silkworm biological reactor; But the edible medicine of silkworm is expressed silkworm larva and the directly lyophilize of pupa of hIL-28A, and expression product need not purifying; Can directly use as oral pharmaceutical; Therefore have that preparation technology is simple, cost is low, advantages such as convenient uses of oral pharmaceutical, some that can reduce injection type simultaneously often have heating, tired discomfort, are off one's feed, the spinoff of oligoleukocythemia and fluctuation of blood pressure etc.
3. the oral antitumor drug of income earner's interleukin 28 A of the present invention (hIL-28A) has clear and definite curative effect through animal experiment proof, and human interleukin 28 A (hIL-28A) oral antitumor be initiative.
Description of drawings
Fig. 1 is that the PCR of recombinant virus Bacmid-EGFP-hIL-28A among the embodiment one identifies figure, wherein, and M. standard DNA molecular mass; 1. the PCR product of recombinant virus (pUC/M13 primer); 2. the PCR product of recombinant virus (M13-1 and IL-28A2 primer); 3. the PCR product of recombinant virus (M13-2 and IL-28A1 primer); 4. the PCR product of wild virus (pUC/M13 primer);
Fig. 2 is the elisa assay figure of silkworm chrysalis hemolymph among the embodiment one, and wherein 1-6 is respectively and infects 1-6 days silkworm pupa of recombinant baculovirus;
Fig. 3 is influence the as a result figure of the dried silkworm chrysalis meal of the oral hIL-28A of containing among the embodiment four to A549 transplanted tumor PCNA and vegf expression level, and wherein ABC is respectively the PCNA expression of negative control group, drug group and the positive controls of A549; DEF is respectively the vegf expression of negative control group, drug group and the positive controls of A549;
Fig. 4 is influence the as a result figure of the dried silkworm chrysalis meal of the oral hIL-28A of containing among the embodiment five to HL60 transplanted tumor PCNA and vegf expression level, and wherein ABC is respectively the PCNA expression of negative control group, drug group and the positive controls of HL60; DEF is respectively the vegf expression of negative control group, drug group and the positive controls of HL60.
Embodiment
Below in conjunction with accompanying drawing and embodiment the present invention is further described:
Embodiment one: express the preparation of hIL-28A silkworm larva
According to the cDNA sequence of the disclosed hIL-28A of GenBank (the GenBank accession number: BC113583), the encoding sequence of synthetic hIL-28A gene, the clone advances the T-carrier, obtains the pUC-hIL-28A plasmid.
2. design and synthesize primer to IL-28A-1 (TA
GGATCCATGAAACTAGACATGAC, underscore are BamH I site) and IL-28A-2 (TT
GAATTCAGACACACAGGTCCCCACTG, underscore are EcoR I site).With the pUC-hIL-28A plasmid is template; With BamH I/EcoR I double digestion; Reclaim the hIL-28A fragment; Be connected acquisition pFastBac-Dual-hIL28A plasmid with the donor plasmid pFastBac-Dual that cuts with same enzyme (invitrogen company); This plasmid transformation escherichia coli BmDH10Bac competent cell is coated on the LB agar culture plate that contains tsiklomitsin (10 μ g/ml), kantlex (50 μ g/ml), qingfengmeisu qiong (7 μ g/ml), IPTG (40 μ g/ml), X-gal (100 μ g/ml).The picking white colony is cultivated, and extracts reorganization Bacmid genomic dna, uses pUC/M13 primer (M13-1:GTTTTCCCAGTCACGAC respectively; M13-2:CAGGAAACAGCTATGAC) and IL-28A primer (IL-28A-1 and IL-28A-2) reorganization Bacmid made up PCR identify.
Qualification result is referring to Fig. 1: the purpose band that can from reorganization Bacmid DNA, amplify 3.92kb with the M13 primer; The size of the PCR product that IL-28A-1 and pUC/M13-2 primer amplification go out is about 1150bp; The size of the PCR product that M13-1 and IL-28A-2 primer amplification go out is about 2776bp; The molecular weight of each specificity product conforms to the size of expectation; Explain that the IL-28A gene is recombinated on request and advance Bacmid DNA, the reorganization Bacmid called after Bacmid-hIL-28A that is obtained.
3.Bacmid-hIL-28A DNA (2 μ g) joins mixing among the 98 μ lTC-100 (no foetal calf serum); Other gets 10 μ l liposomes and joins mixing among the 90 μ l TC-100 (no foetal calf serum); Again the former is added drop-wise to mixing among the latter and places TC-100 (the no foetal calf serum that is added drop-wise to 800 μ l after 30 minutes; GIBCOBRL company) mixing in, transfection BmN cell.Cultivated 3～4 days for 27 ℃, collect the culturing cell supernatant of virus infection, obtain recombinant virus BmNPV-hIL-28A.
4. get BmNPV-hIL-28A with the insect needle libation at an ancient wedding ceremony and infect 4 days culture supernatant of BmN culturing cell, inoculate and play silkworm 5 ages, normally raise about 25 ℃, after 5 days, silkworm blood takes a morsel.Measure the hIL-28A expression level with IL-28A ELISA test kit (USCN and LIFE TECHNOLOGY company), the result reaches 33 μ g referring to the amount of reorganization hIL-28A in every milliliter of hemolymph of Fig. 2.Collect the silkworm of virus inoculation after 5 days ,-20 ℃ of preservations.
Embodiment two: express the preparation of hIL-28A silkworm pupa
1. the recombinant virus BmNPV-hIL-28A that adopts embodiment one step 3 to obtain infects the BmN culturing cell, collecting cell culture supernatant after 4 days.
2. get the cells and supernatant of step 1 with the insect needle libation at an ancient wedding ceremony, the silkworm pupa before the percutaneous puncture-inoculation compound eye is painted, protection is after 5 days about 25 ℃, and silkworm blood takes a morsel.Measure the hIL-28A expression level with IL-28A ELISA test kit (USCN and LIFETECHNOLOGY company), the amount of reorganization hIL-28A reaches 33 μ g in every milliliter of hemolymph.Collect the silkworm pupa of virus inoculation after 5 days ,-20 ℃ of preservations.
Embodiment three: express the preparation of hIL-28A silkworm pupa lyophilized powder
1. get the silkworm chrysalis 5kg of embodiment two steps 2, ice bath homogenate adds 0.7% saline water 20kg, and mixing is removed thick impurity with filtered through gauze.
2. the filtrating lyophilize becomes the pulvis raw material, and ELISA measures and to show in every gram lyophilized powder and contain 8.5mghIL-28A.
Embodiment four: the oral inhibition ability that contains human interleukin 28 A silkworm pupa powder to the A549 transplanted tumor of nude mice
1.RPMI1640 it is good to growth conditions that nutrient solution is cultivated the A549 cell, (cell concn is 5 * 10 to get the 0.2ml cell suspension
6/ ml); Subcutaneous vaccination is in BALB/C-nu 6-8 nude mice (body weight 20 ± 2g in age in week; Suzhou Beierda Biopharmaceutical Technology Co., Ltd.) nude mice subcutaneous transplantation knurl model is set up according to " oncotherapy enhanced sensitivity medicine " (Shanghai scientific and technical literature press, 2002) in right oxter.Inoculate 18 nude mices altogether.
2. after inoculating 3 days, nude mice is divided into 3 groups at random, 6 every group: i.e. normal control group (model group) contains hIL-28A pupa powder group and endoxan (available from Chinese Hengrui Medicine Co., Ltd., Jiangsu Prov.; Authentication code: country's medicine is H32020857 accurately) positive controls.
3. normal control group every day irritating the normal pupa powder of stomach amount to nude mice is 1500mg/kg; Contain hIL-28A pupa powder with 1 * PBS (pH7.4) dissolving, irritate stomach to nude mice every day and be equivalent to IL-28A 12.7mg/kg; It is 25mg/kg that endoxan every day is irritated the stomach amount to nude mice; The continuous irrigation stomach detects antitumor relevant index after 30 days; The result is referring to Fig. 3: containing the oral inhibiting rate to the A549 transplanted tumor of human interleukin 28 A silkworm pupa powder is 40.98%; The positive cell rate of PCNA in the tumor tissues (PCNA) and VEGF (VEGF) is respectively 27.6% and 17.4%; And the endoxan group is respectively 38.4% and 42.6%, and the normal control group is respectively 44.6% and 59.3%.The oral apoptosis degree that contains human interleukin 28 A silkworm pupa powder group, endoxan group and normal control group is respectively 35%, 27%, 17%, shows that the oral human interleukin 28 A silkworm pupa powder that contains has clear and definite restraining effect to the propagation of A549 transplanted tumor.
Embodiment five: the oral inhibition ability that contains human interleukin 28 A silkworm pupa powder to the HL60 transplanted tumor of nude mice
1.RPMI1640 it is good to growth conditions that nutrient solution is cultivated the HL60 cell, (cell concn is 5 * 10 to get the 0.2ml cell suspension
6/ ml); Subcutaneous vaccination is in BALB/C-nu 6-8 nude mice (body weight 20 ± 2g in age in week; Suzhou Beierda Biopharmaceutical Technology Co., Ltd.) nude mice subcutaneous transplantation knurl model is set up according to " oncotherapy enhanced sensitivity medicine " (Shanghai scientific and technical literature press, 2002) in right oxter.Inoculate 18 nude mices altogether.
2. after inoculating 3 days, nude mice is divided into 3 groups at random, 6 every group: i.e. normal control group (model group) contains hIL-28A pupa powder group and endoxan (available from Chinese Hengrui Medicine Co., Ltd., Jiangsu Prov.; Authentication code: country's medicine is H32020857 accurately) positive controls.
3. normal control group every day irritating the normal pupa powder of stomach amount to nude mice is 1500mg/kg; Contain hIL-28A pupa powder with 1 * PBS (pH7.4) dissolving, irritate stomach to nude mice every day and be equivalent to IL-28A 12.7mg/kg; It is 25mg/kg that endoxan every day is irritated the stomach amount to nude mice; The continuous irrigation stomach detects antitumor relevant index after 30 days; The result is referring to Fig. 4: containing the oral inhibiting rate to the HL60 transplanted tumor of human interleukin 28 A silkworm pupa powder is 44.6%; The positive cell rate of PCNA in the tumor tissues (PCNA) and VEGF (VEGF) is respectively 42.8% and 39.2%; And the endoxan group is respectively 51.4% and 68.4%, and the normal control group is respectively 67% and 70.3%; The oral apoptosis degree that contains human interleukin 28 A silkworm pupa powder group, endoxan group and normal control group is respectively 58%, 46%, 23%, shows that the oral human interleukin 28 A silkworm pupa powder that contains has clear and definite restraining effect to the propagation of HL60 transplanted tumor.
Claims (4)
1. the method for a preparing human interleukin 28 A by silkworm bioreactor; It is characterized in that; Obtain the silkworm Bombyx mori recombinant baculovirus of the band human interleukin 28 A gene of reorganization through gene engineering method; And, human interleukin 28 A is acquired in silkworm larva or pupa efficiently express with this virus inoculation silkworm larva or pupa.
2. preparation method according to claim 1 is characterized in that, the preparation method of the silkworm Bombyx mori recombinant baculovirus of the band human interleukin 28 A gene of said reorganization is:
(1) according to the cDNA sequence of the disclosed hIL-28A of GenBank (the GenBank accession number: BC113583), the encoding sequence of synthetic hIL-28A gene, the clone advances the T-carrier, obtains the pUC-hIL-28A plasmid;
(2) reclaim the hIL-28A gene fragment with BamH I/EcoR I double digestion digestion pUC-hIL-28A plasmid; PFastBac-Dual reclaims the pFastBac-Dual fragment with BamH I/EcoR I double digestion digestion donor plasmid; The hIL-28A gene fragment is inserted between the BamH I and EcoR I of pFastBac-Dual, the baculovirus polyhedrin body gene promoter downstream that hIL-28A is cloned in the pFastBac-Dual carrier into obtain the pFastBac-Dual-hIL-28A recombinant plasmid;
(3) with pFastBac-Dual-hIL-28A recombinant plasmid transformed intestinal bacteria BmDH10Bac competent cell; Coat on the LB agar culture plate that contains tsiklomitsin, kantlex, qingfengmeisu qiong, IPTG, X-gal; The picking white colony is cultivated, and extracts reorganization Bacmid genome Bacmid-hIL-28A DNA;
(4) with Bacmid-hIL-28A DNA by liposome-mediated transfection silkworm cultured cell BmN, get supernatant behind the culturing cell, obtain recombinant baculovirus BmNPV-hIL-28A.
3. preparation method according to claim 1; It is characterized in that; Adopt the method for said silkworm Bombyxmori recombinant baculovirus inoculation silkworm larva or pupa to be: BmN increases with recombinant baculovirus BmNPV-hIL-28A infected silkworm culturing cell, adopt recombinant baculovirus BmNPV-hIL-28A after the amplification be seeded to five age silkworm larva or pupa.
4. a preparation method who contains the medicine of human interleukin 28 A is characterized in that, adopts the said preparing method's gained of claim 1 to infect the silkworm larva or the pupa of recombinant baculovirus, after lyophilize, processes oral drug preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101610961A CN101845442B (en) | 2010-04-23 | 2010-04-23 | Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101610961A CN101845442B (en) | 2010-04-23 | 2010-04-23 | Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101845442A CN101845442A (en) | 2010-09-29 |
| CN101845442B true CN101845442B (en) | 2012-04-04 |
Family
ID=42770261
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101610961A Expired - Fee Related CN101845442B (en) | 2010-04-23 | 2010-04-23 | Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101845442B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102031263B (en) * | 2010-11-24 | 2012-05-23 | 江苏大学 | Method for preparing human DNA polymerase delta by using bombyx mori bioreactor |
| CN102614509B (en) * | 2012-04-19 | 2014-08-20 | 苏州大学 | Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp |
| JPWO2022215742A1 (en) * | 2021-04-09 | 2022-10-13 | ||
| JP7502739B2 (en) | 2022-06-02 | 2024-06-19 | Kaico株式会社 | Oral vaccine composition |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1670215A (en) * | 2005-01-31 | 2005-09-21 | 苏州大学 | Method for preparing transgenic bombyx mori and its application in pharmacy |
| CN101270367A (en) * | 2008-04-30 | 2008-09-24 | 苏州大学 | Construction method for domestic silkworm silk glandulae biological factory and pharmacy use |
-
2010
- 2010-04-23 CN CN2010101610961A patent/CN101845442B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1670215A (en) * | 2005-01-31 | 2005-09-21 | 苏州大学 | Method for preparing transgenic bombyx mori and its application in pharmacy |
| CN101270367A (en) * | 2008-04-30 | 2008-09-24 | 苏州大学 | Construction method for domestic silkworm silk glandulae biological factory and pharmacy use |
Non-Patent Citations (1)
| Title |
|---|
| 魏然等.白介素-3在家蚕细胞核幼虫中的高效表达.《2000中国药学会学术年会论文集》.2000,第1037-1038页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101845442A (en) | 2010-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101845442B (en) | Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof | |
| CN103989713A (en) | Immunopotentiating composition and process for producing same | |
| CN101985605A (en) | Saprolegnia antagonist and application thereof | |
| CN104059927A (en) | Preparation method of newcastle disease glucoprotein virus antigen and product thereof | |
| CN102399279A (en) | Scorpion venom polypeptide for promoting cell proliferation and preparation method and medicinal application thereof | |
| CN1320120C (en) | Method for preparing transgenic bombyx mori and its application in pharmacy | |
| CN102020710B (en) | Novel mutant EN-46 of human epidermal growth factor | |
| CN108948163A (en) | Queensland nut plant alexin and its application | |
| CN1170927C (en) | Method for producing medicine using silkworm expressed numan epidermal growth factor | |
| CN104418945A (en) | Preparation method of peptide and application of peptide in preparation of medicine and feed additive | |
| CN101875688B (en) | Folic acid modification step of method for preparing recombinant tumor specific apoptosis factor and application of products of recombinant tumor specific apoptosis factor | |
| CN113699117A (en) | Application of genetically modified oligodendrocyte progenitor cells in multiple sclerosis | |
| CN1185340C (en) | Method for producing medicine using silkworm expressed human alpha2b interferon | |
| CN103304656B (en) | PaaspinosaDavid antibacterial peptide and application thereof | |
| CN101921820B (en) | Preparation method of recombinant tumor specificity antiapoptotic factors with activity and application of products thereof | |
| CN102433342B (en) | Synthesized duck beta-defensins-2 gene, recombinant plasmid containing gene as well as production methods for recombinant yeast transformant and recombinant duck beta-defensins-2 protein | |
| CN103045631B (en) | Preparation method for oral hypoglycemic recombinant human proinsulin | |
| CN1110563C (en) | Method for preparing medicine for growing leukocyte by Chinese silkworm production gene engineering | |
| CN1185341C (en) | Method for preparing medicine using silkworm expressed human beta interferon | |
| CN102199608A (en) | Efficient expression of pinellia ternate agglutinin (PTA) in bombyx mori reactor | |
| CN109666667A (en) | The chimaeric enzyme antibiotic of killing staphylococcus aureus and its preparation and application | |
| CN103710311A (en) | Cell strain capable of stably secreting and expressing IL-24 recombinant protein, and construction and application thereof | |
| CN113214375B (en) | Antineoplastic stiff silkworm cocoon-dissolving enzyme inhibitor and purification method and application thereof | |
| CN102754562A (en) | Artificial cultivation technology for Cordyceps iaponica | |
| CN1160120C (en) | Method for producing anti-cancer medicine from silkworm |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120404 Termination date: 20150423 |
|
| EXPY | Termination of patent right or utility model |