CN1670215A - Method for preparing transgenic bombyx mori and its application in pharmacy - Google Patents
Method for preparing transgenic bombyx mori and its application in pharmacy Download PDFInfo
- Publication number
- CN1670215A CN1670215A CNA2005100377598A CN200510037759A CN1670215A CN 1670215 A CN1670215 A CN 1670215A CN A2005100377598 A CNA2005100377598 A CN A2005100377598A CN 200510037759 A CN200510037759 A CN 200510037759A CN 1670215 A CN1670215 A CN 1670215A
- Authority
- CN
- China
- Prior art keywords
- gene
- bombyx mori
- silkworm
- hgm
- transgenic bombyx
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
This invention discloses a method for preparing trans-gene cultivated silkworm with human granulocyte, namely macrophage colony stimulating factor, characterized by the following steps: a, through gene engineering operation, cloning human granulocyte under the control of cultivated silkworm's karyotype polyhedrosis virogene promoter into a carrier with reporting gene based on piggyBAC factor; b, constructing and recombining trans-gene carrier; c, at the presence of subsidiary particles, attaining silkworm with reporting gene by spermium conducting method, and testing out human granulocyte, breeding to silkworms.
Description
Technical field
The method that the present invention relates to the preparation method of transgenic bombyx mori in the genetically engineered field and utilize the transgenic bombyx mori production polypeptide drug that obtains.
Background technology
People's granulocyte-macrophage colony stimutaing factor (hGM-CSF) is a kind of important hematopoietic cell growth factor, propagation for granulocyte, scavenger cell, function after differentiation and the maturation all has special stimulation ability, and for the immunological competence that improves body, antitumor, and control autoimmune disease etc. also plays an important role.It is mainly used in leukopenia that cancer chemotherapy causes, bone marrow transplantation, myelodysplastic syndrome, aplastic anemia and as the adjuvant therapy medicaments of acquired immune deficiency syndrome (AIDS).
At present,, mainly adopt escherichia expression system or expression system etc. for the development research of the genomic medicine of hGM-CSF, but expression system, expression amount is low, and has the special carbohydrate branch of yeast; And escherichia expression system does not have the post-treatment modification to expression product, and the natural sex of expression product is poor, complex process, and the cost height, and the medicine that obtains can only use as injection.Be directed to this, Chinese invention patent CN1110563C discloses a kind of method with preparing medicine for growing leukocyte by Chinese silkworm production gene engineering, it adopts silkworm larva, pupa, moth is bio-reactor, the hGM-CSF gene is carried out point mutation, being connected the back with the silkworm baculovirus carrier recombinates in bombyx mori cell with the wild-type silkworm baculovirus, acquisition has the recombinant silkworm baculovirus of this gene, by artificial inoculation mode infected silkworm larva, pupa or moth, thus the expression of realization hGM-CSF.This mode can prepare oral pharmaceutical, but its complex process, recombinant virus need be by vaccination ways infected silkworm under the artificial skin, the work of treatment amount is big, simultaneously, there is the possibility of residual recombinant baculovirus in the product of acquisition, has the risk that is difficult to predict.
The piggyBAC factor claims IFP2 again, is to use transposon more widely at present, has been proved in various insects and can have brought into play transposition, can be by swivel base and with the foreign gene recombination and integration in the insect genes group.Up to the present, still useless this method obtains to change report and the patent of hGM-CSF gene silkworm.
Summary of the invention
The object of the invention provides the method that a kind of preparation has the transgenic bombyx mori of hGM-CSF gene, with the problem of avoiding adopting baculovirus vector to bring.
Further aim of the present invention provides the preparation method of the medicine of the granulocyte-macrophage colony stimutaing factor that contains the people, to simplify technology, reduces preparation cost.
For achieving the above object, the technical solution used in the present invention is: a kind of preparation has the method for the transgenic bombyx mori of hGM-CSF gene, by genetically engineered operation the carrier that has reporter gene based on the transposon piggyBAC factor is advanced in the hGM-CSF gene clone under the control of Bombyx mori nuclear polyhydrosis virus (BmNPV) IE-1 gene promoter, make up the reorganization transgene carrier, under the helper plasmid effect, obtain to have the silkworm of reporter gene with semen transformation, and detecting the hGM-CSF gene, described transgenic bombyx mori kind is made in breeding.
Reporter gene described in the above-mentioned technical scheme can be green fluorescence protein gene, also can be red fluorescent protein gene or neomycin gene.
For realizing further aim of the present invention, the technical scheme that adopts is, a kind of preparation method of medicine of the granulocyte-macrophage colony stimutaing factor that contains the people adopts larva, pupa or the moth of the transgenic bombyx mori that technique scheme obtains to make medicine after lyophilize.It is remarkable that the short white corpuscle of animal experiment proof generates drug effect.
Perhaps, a kind of preparation method of medicine of the granulocyte-macrophage colony stimutaing factor that contains the people carries out the silkworm egg breeding with the transgenic bombyx mori that obtains in the technique scheme, makes medicine by larva, pupa or the moth of the silkworm that obtains through lyophilize.
Because the technique scheme utilization, the present invention compared with prior art has following advantage:
1. the present invention can obtain to have the transgenic bombyx mori of human granulocyte-macrophage colony stimulating factor gene by adopting the piggyBAC transposon, show that through animal experiment the human granulocyte-macrophage colony stimulating factor of expressing with transgenic bombyx mori is prepared into oral preparations clear and definite drug effect.The method that the transgenic bombyx mori of relevant expression granulocyte-macrophage colony stimutaing factor gene and transgenic bombyx mori are prepared into oral preparations is an initiative.
2. the present invention is owing to adopt transgenic bombyx mori to prepare medicine, and it is residual not have baculovirus in the medicine of acquisition, the biological safety height.
3. the transgenic bombyx mori of the present invention's acquisition can carry out breeding and propagation, raise the same with common silkworm, and when being used for pharmacy, preparation technology is simple, and cost is low.
Embodiment
Below in conjunction with embodiment the present invention is further described:
Embodiment one: the preparation of transgenic bombyx mori
Technical operating procedure is as follows:
1. the preparation of the total mRNA of cell of people's T-lymphoid cell line
People's T-lymphoid cell line cell 100mg adds liquid nitrogen and grinds, and adds GIBCO BRL company and produces Trozol RNA extracting solution 1mL, shake adding 500 μ L chloroforms after 10 minutes gently, at room temperature placed centrifugal 10 minutes of 12000rpm 10 minutes, get supernatant, add 100% cold ethanol of 2 times of supernatant volumes, behind the mixing, centrifugal 10 minutes of 12000rpm, abandon supernatant, the ThermoScript II and the 4dNTPs that add by routine carry out reverse transcription, 37 ℃, 1 hour, obtain by mRNA reverse transcription synthetic cDNA.
2. the cDNA gene of granulocyte-macrophage colony stimutaing factor preparation
With the cDNA that the 1st step obtained, the upstream and downstream primer 5 ' CGGATATCATGTGGCTGCAGAGCCTGC3 ' and the 5 ' GGGTACCTCACTCCTGGACTGGCTCCC3 ' that add the granulocyte-macrophage colony stimutaing factor gene carry out pcr amplification, the high-fidelity Taq enzyme of Bao Ling Man, reaction conditions is 94 ℃ of pre-sex change, 5 minutes, 94 ℃ of denaturation temperatures, 45 seconds, 45 ℃ of renaturation temperature, 45 seconds, elongating temperature was 72 ℃, 45 seconds, circulate 30 times, last 72 ℃ were extended 10 minutes.Obtaining length is the cDNA gene fragment of the granulocyte-macrophage colony stimutaing factor of 450bp.
3. make up pBluescript II SK (+) recombinant plasmid that has the cDNA gene
The PCR product is reclaimed through low melting point glue, add 1mL supersaturation phenol (pH8.0), 65 ℃ of effects 10 minutes, centrifugal 10 minutes of 12000rpm gets supernatant, and extracting is once again with supersaturation phenol.Get and reset and add the equal-volume chloroform: primary isoamyl alcohol (24: 1), mixed centrifugal 10 minutes of 12000rpm 5 minutes, get supernatant, adding 2 times of volumes does not have water-cooled ethanol, mixes, put-20 ℃, used 12000rpm after 2 hours more centrifugal 10 minutes, abandon supernatant, wash precipitation with 70% ethanol, centrifugal 1 minute of 12000rpm abandons supernatant, seasoning, precipitate the dissolving of 20 μ L TE damping fluids, it is standby that the hGM-CSF gene of this purifying places-20 ℃ of refrigerators to preserve.
Respectively the hGM-CSF gene of purifying is cut, is connected with the KpnI enzyme with EcoRV with pBluescript II SK (+) plasmid (Stratagene company product), the T4 dna ligase is a GIBCO BRL company product, and condition of contact is 16 ℃, 12 hours.Connect product transformed into escherichia coli TG1 bacterial strain, cultivate screening by blue hickie and obtain recombinant conversion, the short run plasmid extracts (referring to " molecular cloning ", 1989, Science Press) plasmid DNA is cut evaluation with EcoRV and KpnI enzyme, has the fragment of a treaty 450bp to be cloned, successfully cloned the hGM-CSF gene through the order-checking proof, the recombinant plasmid that is obtained is referred to as pSK-GMCSF.
4. make up the recombinant plasmid that has Bombyx mori nuclear polyhydrosis virus IE-1 gene promoter and hGM-CSF gene
DNA with Bombyx mori nuclear polyhydrosis virus is a template, with the Auele Specific Primer of IE-1 gene promoter to (5 ' TTCGAATTCGATTTGCAGTTCGGGAC3 ', 5 ' GCGGATATCAGTCGTTTGGTTGTTCA3 ') carries out pcr amplification, PCR product EcoRI, behind the EcoRV double digestion, be cloned in pBluescriptII SK (+) carrier, acquisition has the carrier pSK-IE1 of Bombyx mori nuclear polyhydrosis virus IE-1 gene promoter, this carrier EcoRI, behind the EcoRV double digestion, low melting point glue reclaims IE-1 promoter fragment (about 550bp) (method is with the 3rd step), and the clone advances the EcoRI of pSK-GMCSF, the EcoRV site, obtain recombinant plasmid, the recombinant plasmid that is obtained is referred to as pSK-IE-GMCSF, enzyme is cut and is identified definite hGM-CSF gene under the direct control of nuclear polyhedrosis virus IE-1 gene promoter, and the plasmid size is about 4kb.
5. make up the PigA3GFP reorganization transgene carrier plasmid that has IE-1 gene promoter and hGM-CSF gene
Use EcoRI, KpnI cuts out the IE-hGM-CSF fragment from pSK-IE-GMCSF, low melting point glue reclaims, the clone advances the PigA3GFP plasmid (referring to Cary, L.C.et al.Transposon mutagenesisof baculoviruses:analysis of Trichoplusia ni transposon IFP2 insertionswithin the FP-locus of nuclear polyhedrosis viruses.Virology, 1989, EcoRI 172:156-69), the KpnI site, obtain the reorganization transgene carrier, the recombinant vectors that obtains is referred to as PigA3GFP[IE-GMCSF], the carrier size is about 9kb.A large amount of plasmid DNA preparations (method is referring to " molecular cloning ", 1989, Science Press) obtain this plasmid DNA, and concentration is 2 μ g/ μ L, and-20 ℃ of refrigerators are preserved standby.
6. semen transformation obtains to have the transgenic bombyx mori of reporter gene GFP
Cultivated silkworm breed variety is a cyanines pine kind, and normal raising is to changing moth.
With PigA3GFP[IE-GMCSF] and helper plasmid (referring to Tamura Toshiki.et al.Germlinetransformation of the silkworm Bombyx mori L.using a piggyBac transposon-derived vector.Nature Biotechnology, 2000,18:81-84) by mixing (melting concn 2 μ g/ μ L) in 1: 1, only inject virgin moth mating capsule with the kapillary glass needle with 1.5～2.0 μ L/, normal mating, portable fluorescent lamp combined with fluorescent inverted microscope detect time generation (G
0) silkworm larva, keep silkworm (transgenic bombyx mori) with obvious fluorescence demonstration, carry out hGM-CSF gene test and conventional silkworm breeding.
7. the hGM-CSF gene PCR of transgenic bombyx mori detects
The take a morsel hemolymph (about 20 μ L hemolymphs/every) of fluorescence silkworm of acupuncture, add 500 μ L TE damping fluids (pH8.0), add 500 μ L supersaturation phenol (pH8.0) effect 10 minutes, centrifugal 10 minutes of 12000rpm gets supernatant, use the supersaturation phenol extraction more once, add chloroform: primary isoamyl alcohol (24: 1) effect 10 minutes, centrifugal 10 minutes of 12000rpm gets and resets and add 2 times of volumes and do not have water-cooled ethanol, mix, put-20 ℃, used 12000rpm after 2 hours more centrifugal 10 minutes, abandon supernatant, wash precipitation with 70% ethanol, centrifugal 1 minute of 12000rpm abandons supernatant, seasoning, precipitation obtains the total DNA of domestic silkworm gene group with the dissolving of 10 μ L TE damping fluids.
Extracting the total DNA of silkworm hemolymph as template, carry out the PCR detection with the Auele Specific Primer of hGM-CSF, establish the negative contrast of normal silkworm simultaneously, the positive contrast of pSK-GMCSF plasmid DNA.PCR primer and condition are with above-mentioned the 2nd step, and wherein the Taq enzyme is a Dalian TaKaRa company product.PCR detects demonstration, at G
0, G
1, G
2, G
3The equivalent hGM-CSF specific fragment that all can amplify about 450bp, negative control do not have this fragment and produce, and show that the hGM-CSF gene has entered the domestic silkworm gene group, and genetic stability.
Embodiment two: have the breeding of the transgenic bombyx mori of hGM-CSF gene
G
0For fluorescence silkworm and normal silkworm (cyanines pine) post-coitum on behalf of G
1Generation, G
1Raised (down together) separately after generation, same moth circle was hatched, use portable fluorescent lamp combined with fluorescent inverted microscope to detect G
1For silkworm larva, detect (adopt the 7th step of embodiment 1, down with) in conjunction with PCR, existing obvious fluorescence is shown, again can PCR detect the G of the same moth circle hatching back raising of hGM-CSF gene
1For the transgenic bombyx mori cross-breeding, obtain G
2Generation, with above from G
1In generation, obtain G
2The method in generation is with G
2Be prepared as G for breeding
3In generation, is to G
2, G
3In generation, carried out fluoroscopic examination and PCR detection equally, keeps from G
2In generation, is to G
3The isolating G of proterties does not take place in generation
3Generation.To the G that keeps
3The same moth circle silkworm egg in generation is divided into two groups, and one group standby, normally raises for one group, and carries out list to hybridization with normal silkworm (cyanines pine), if when the filial generation of same moth circle silkworm egg proterties does not all take place is separated, assert that it is transgenic bombyx mori that this moth is enclosed silkworm egg.Conventional standby group of raising this moth circle silkworm egg, thus the cultivated silkworm breed variety of the isolating commentaries on classics of proterties hGM-CSF gene does not take place in acquisition.
Embodiment three: preparation of oral type capsule glue and biological activity test
Collect the larva or the silkworm chrysalis of the cultivated silkworm breed variety that changes the hGM-CSF gene, after homogenate, remove thick impurity with filtered through gauze, lyophilize becomes the pulvis raw material, and raw material powder is added the ratio dissolving of water 1L in every kg, through 18000rpm centrifugal 1 hour, get supernatant, become smart raw material powder again after lyophilize, raw material powder incapsulates, and makes the oral type capsule.The oral type capsule proves that through mouse animal experiment obviously short white corpuscle nucleus formation is arranged.
Claims (3)
1. method for preparing the transgenic bombyx mori that has human granulocyte-macrophage colony stimulating factor gene (hGM-CSF), it is characterized in that: the carrier that has reporter gene based on the transposon piggyBAC factor is advanced in the hGM-CSF gene clone under by the genetically engineered operation IE-1 gene promoter of Bombyx mori nuclear polyhydrosis virus (BmNPV) being controlled, make up the reorganization transgene carrier, under the helper plasmid effect, obtain to have the silkworm of reporter gene with semen transformation, detect the hGM-CSF gene, described transgenic bombyx mori is made in breeding.
2. the preparation method of the medicine of a granulocyte-macrophage colony stimutaing factor that contains the people is characterized in that: adopt larva, pupa or the moth of the transgenic bombyx mori that claim 1 obtains to make medicine after lyophilize.
3. the preparation method of the medicine of a granulocyte-macrophage colony stimutaing factor that contains the people, it is characterized in that: the transgenic bombyx mori that claim 1 is obtained carries out the silkworm egg breeding, and larva, pupa or the moth of the silkworm that obtains are made medicine through lyophilize.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100377598A CN1320120C (en) | 2005-01-31 | 2005-01-31 | Method for preparing transgenic bombyx mori and its application in pharmacy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100377598A CN1320120C (en) | 2005-01-31 | 2005-01-31 | Method for preparing transgenic bombyx mori and its application in pharmacy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1670215A true CN1670215A (en) | 2005-09-21 |
| CN1320120C CN1320120C (en) | 2007-06-06 |
Family
ID=35041651
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100377598A Expired - Fee Related CN1320120C (en) | 2005-01-31 | 2005-01-31 | Method for preparing transgenic bombyx mori and its application in pharmacy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1320120C (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101195834B (en) * | 2007-12-21 | 2010-06-02 | 西南大学 | Early pickling transgene method for cultivated silkworm diapause breed variety |
| CN101845442A (en) * | 2010-04-23 | 2010-09-29 | 苏州大学 | Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof |
| CN101177692B (en) * | 2007-12-05 | 2010-10-13 | 浙江大学 | Method for developing transgenic domestic silkworm by using A3 promotor defect piggyBac transposon |
| CN101503704B (en) * | 2009-03-17 | 2011-01-05 | 西南大学 | Transgenic method for cultivated silkworm diapause variety |
| CN108157304A (en) * | 2017-12-13 | 2018-06-15 | 苏州大学 | A kind of method for improving silkworm digestibility |
| CN114216870A (en) * | 2021-10-29 | 2022-03-22 | 辽宁省蚕业科学研究所 | Screening method and application of tussah breeding material |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1110563C (en) * | 1997-11-05 | 2003-06-04 | 浙江农业大学 | Method for preparing medicine for growing leukocyte by Chinese silkworm production gene engineering |
| CN1362520A (en) * | 2001-01-02 | 2002-08-07 | 成都天友发展有限公司 | Constitution process of blank expression system for transferring spider's dragline protein gene into Bombyx mori |
-
2005
- 2005-01-31 CN CNB2005100377598A patent/CN1320120C/en not_active Expired - Fee Related
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101177692B (en) * | 2007-12-05 | 2010-10-13 | 浙江大学 | Method for developing transgenic domestic silkworm by using A3 promotor defect piggyBac transposon |
| CN101195834B (en) * | 2007-12-21 | 2010-06-02 | 西南大学 | Early pickling transgene method for cultivated silkworm diapause breed variety |
| CN101503704B (en) * | 2009-03-17 | 2011-01-05 | 西南大学 | Transgenic method for cultivated silkworm diapause variety |
| CN101845442A (en) * | 2010-04-23 | 2010-09-29 | 苏州大学 | Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof |
| CN101845442B (en) * | 2010-04-23 | 2012-04-04 | 苏州大学 | Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof |
| CN108157304A (en) * | 2017-12-13 | 2018-06-15 | 苏州大学 | A kind of method for improving silkworm digestibility |
| CN114216870A (en) * | 2021-10-29 | 2022-03-22 | 辽宁省蚕业科学研究所 | Screening method and application of tussah breeding material |
| CN114216870B (en) * | 2021-10-29 | 2023-10-03 | 辽宁省蚕业科学研究所 | Screening method of tussah breeding material and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1320120C (en) | 2007-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1320120C (en) | Method for preparing transgenic bombyx mori and its application in pharmacy | |
| CN103966245B (en) | The method for recombinating hBCHE in transgenic animals production using gene knock-in and nuclear transfer technology | |
| CN108184770B (en) | Drosophila melanogaster RasV12Method for establishing Snail tumor migration model | |
| KR20160012735A (en) | Dyrk1aa mutant zebrafish model for vascular disease and screening method of vascular disease treatment agent using the same | |
| CN101270367A (en) | Construction method for domestic silkworm silk glandulae biological factory and pharmacy use | |
| CN102443543B (en) | Anti-white-spot-syndrome-virus transgenic algae strain as well as preparation method and application thereof | |
| CN1273605C (en) | Protein production system | |
| CN101629186B (en) | Method for producing recombinant scorpion toxin protein by using silkworm as host | |
| CN100371449C (en) | Structural method for improving gene engineering vector of recombinant silkworm nuclear polyhedron virus | |
| CN101845442B (en) | Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof | |
| CN1283803C (en) | Attenuated HSV-1 vector for gene therapy | |
| CN109055386A (en) | Silkworm BmSCP1 gene and its recombinant expression carrier and application | |
| CN1170927C (en) | Method for producing medicine using silkworm expressed numan epidermal growth factor | |
| CN102899331A (en) | Complex duck interferon-alpha gene, and recombinant vector and application thereof | |
| Kaleri et al. | Generation of transgenic chicks using an oviduct-specific expression system | |
| Yang et al. | Molecular characterization and expression profile of MAP2K1ip1/MP1 gene from tiger shrimp, Penaeus monodon | |
| CN1110563C (en) | Method for preparing medicine for growing leukocyte by Chinese silkworm production gene engineering | |
| CN1087746C (en) | Method for preparing medicine using silkworm expressed recombined human erythropoietin | |
| CN101372686B (en) | Infected protein mediated method for producing recombinant baculovirus particle | |
| CN108949598A (en) | Recombinate the engineering bacteria of Fish leukocyte interleukin -2 and its preparation method of product | |
| CN1053700C (en) | Recombination of human macrophage colony stimulating factor by domestic silkworm gene engineering | |
| CN102787073A (en) | Method for constructing transgenic Nosema bombycis | |
| CN1093563C (en) | Breeding grass carp and prawn with disease resistance by transfer disease-resistant correlation gen | |
| CN1891821B (en) | Production method of animal cell with human lysozyme gene | |
| CN100436588C (en) | Blood sugar reducing method of orally taking human insulin-like growth factor-I produced in silkworm bioreactor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070606 Termination date: 20100131 |