CN101838690A - Method for fast detecting Alexandrium mimutum Halim by using loop-mediated isothermal amplification technology - Google Patents
Method for fast detecting Alexandrium mimutum Halim by using loop-mediated isothermal amplification technology Download PDFInfo
- Publication number
- CN101838690A CN101838690A CN201010102114A CN201010102114A CN101838690A CN 101838690 A CN101838690 A CN 101838690A CN 201010102114 A CN201010102114 A CN 201010102114A CN 201010102114 A CN201010102114 A CN 201010102114A CN 101838690 A CN101838690 A CN 101838690A
- Authority
- CN
- China
- Prior art keywords
- reaction
- lamp
- loop
- mediated isothermal
- fast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for fast detecting Alexandrium mimutum Halim by using a loop-mediated isothermal amplification technology, comprising the following steps of: firstly, extraction of genome DNA of red tide algae; secondly, 4 LAMP amplification primers: Am-B3:CTTTGTGAGCTGTGGTGG, Am-B3:TTCTTCATCATCAATTGAGCTAA, Am-FIP:CAGCAGCATGAAAGCGCTTGGTTCTTCATCATTTGCTCGTG and Am-BIP:CGTTTGTCCTGTGACTGACTC-GACATTCATTGCAAAAACACATT; thirdly, an LAMP amplification reaction system; and fourthly, detection of an LAMP amplification product. The LAMP detection method has the advantages of simple and fast operation, lower requirement to an instrument, strong specificity, high amplification efficiency, simple result determination and the like and is suitable for fast identification and detection to the Alexandrium mimutum Halim.
Description
Technical field
The invention belongs to the dna molecular detection range of Alexandrium mimutum Halim by using, particularly relate to a kind of method of loop-mediated isothermal amplification technology rapid detection Alexandrium mimutum Halim by using.
Background technology
Alexandrium mimutum Halim by using (Alexandrium minutum) is the multiple red tide algae in Chinese marine site, can produce the paralytic shellfish poison, causes a lot of red tides in recent years.At present, the method for utilizing molecular biology method to detect little algae is day by day ripe, and these methods have solved some algae classification and evaluation problem that is difficult to distinguish from form from molecular level.(Polymerase Chain Reaction, PCR) since the technological invention, this technology just is applied to numerous areas since the polymerase chain reaction.Many scholars come algae is identified by some gene fragment amplification of little algae, for example pass through rrna rDNA sequential analysis, and the pcr amplification and the order-checking of rrna transcribed spacer (ITS) are identified the kind of microalgae thereby finish.Fluorescence in situ hybridization also is the detection means that little in recent years algae is identified, some scholar utilizes large ribosomal subunit (LSU) and ITS to distinguish sub-probe some red tide microalgae is identified, and is high but this technology requires probe.It also is that little in recent years algae detects a direction that real-time fluorescence quantitative PCR detects, and this method is very sensitive, and need 1～2 hour detection time, but required laboratory apparatus (quantitative real time PCR Instrument) and reagent cost an arm and a leg.Aforesaid method is because effects limit such as experiment condition can not be applied to on-the-spot the detection.
2000, Japan scholar Notomi etc. has developed a kind of constant temperature nucleic acid amplification method of novelty, be loop-mediated isothermal amplification reaction (Loop-mediated isothermal amplification, LAMP), be characterized in 4 kinds of special primers of 6 zone design at target gene, utilize strand displacement archaeal dna polymerase (Bst DNA polymerase) to be incubated dozens of minutes down, can finish nucleic acid amplification reaction in isothermal condition (about 65 ℃).This reaction does not need processes such as the thermally denature of template, long-time temperature cycle, loaded down with trivial details electrophoresis, ultraviolet visualization, and the result judges simply, both can utilize the magnesium pyrophosphate precipitation that produces in instrument detecting or the visual inspection amplification process to judge, and also can adopt the colour-change of visual inspection reaction solution to judge rapidly.
This technology has been widely applied to the pathogenic bacteria context of detection, obtains ideal and detects effect.But up to now, Shang Weijian is applied to Alexandrium mimutum Halim by using with this technology and detects the pertinent literature report of differentiating.
Summary of the invention
Technical problem to be solved by this invention provides a kind of method of loop-mediated isothermal amplification technology rapid detection Alexandrium mimutum Halim by using, this method has quick, less demanding to instrument, high specificity simple to operate, amplification efficiency height, result and judges advantages such as simple, is fit to Alexandrium mimutum Halim by using Rapid identification and on-the-spot the detection.
A kind of loop-mediated isothermal amplification technology of the present invention is examined the method for Alexandrium mimutum Halim by using fast, comprising:
(1) extracting genome DNA of red tide algae
(2) LAMP amplimer
| Primer Primer | Sequence Sequence (5 '-3 ') |
| ??Am-F3 | ?CTTTGTGAGCTGTGGTGG |
| ??Am-B3 | ?TTCTTCATCATCAATTGAGCTAA |
| ??Am-FIP(F1c+F2) | ?CAGCAGCATGAAAGCGCTTG-GTTCTTCATCATTTGCTCGTG |
| ??Am-BIP(B1c+B2) | ?CGTTTGTCCTGTGACTGACTC-GACATTCATTGCAAAAACACATT |
(3) LAMP amplification reaction system
(4) detection of LAMP amplified production.
LAMP amplification reaction system agents useful for same in the described step (3) is: 2.5uL 10 * buffer (including the MgSO4 of 2mM), the final concentration of 2 inner primer Am-FIP and Am-BIP is 1.6 μ M, the final concentration of two outer primer Am-F3 and Am-B3 is 0.2 μ M, comprise 6mM MgSO4 in addition, 0.6mM dNTP, 0.6M Betaine (Sigma-Aldrich), 8U Bst archaeal dna polymerase, 1uL dna profiling (50ng);
The condition of the LAMP amplification reaction system in the described step (3) is: 65 ℃ of temperature of reaction, and reaction times 60min keeps the 3min termination reaction in 85 ℃ at last;
LAMP amplified production in the described step (4) detects, and can see a large amount of white precipitates generations in the reaction tubes and then be positive; Or add 2 μ L, 100 * SYBR Green I in reaction tubes, and reaction tubes presents green positive, and color is constant negative in the reaction tubes.
Beneficial effect
LAMP detection method of the present invention has advantages such as fast (can finish detections in 1 hour) simple to operate,, high specificity less demanding to instrument, amplification efficiency height, result judge simply, be fit to Alexandrium mimutum Halim by using Rapid identification and detection are expected to be applied to red tide field quick detection field.
Description of drawings
Fig. 1 detects electrophorogram for Alexandrium mimutum Halim by using LAMP;
Fig. 2 detects SYBR Green I colored graph for Alexandrium mimutum Halim by using LAMP;
Wherein, 1.2. two strain Alexandrium mimutum Halim by using, 3. chain Alexander algae, 4. heterosigma akashiwo, 5. Ka Shi anterior canal algae, 6. Riamb's Prorocentrum micans, 7. Chaetoceros, 8. prorocentrum minimum, the 9. different cap algae of ring-type.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
The design of Alexandrium mimutum Halim by using LAMP amplimer
(1) extracting genome DNA of Alexandrium mimutum Halim by using
The Alexandrium mimutum Halim by using enchylema branch that is cultured to logarithmic phase is filled to the 2ml centrifuge tube, centrifugal, outwell supernatant, add 600 μ L extracting solution (100mmol/L Tris-Hcl, 100mmol/L EDTA, 1.4mol/L NaCl, 2%CTAB, 2% beta-mercaptoethanol), 65 ℃ of water-bath 1h.Add equal-volume PCI extract (volume ratio, phenol: chloroform: primary isoamyl alcohol=25: 24: 1), mixing, centrifugal 10min under 4 ℃, 12500rpm condition.Shift supernatant liquor to new centrifuge tube, adding RNase is 1 μ g/mL to final concentration, 37 ℃ of placement 30min.PCI repeats extracting once, and 4 ℃, the centrifugal 10min of 12500rpm.Water is transferred in the new centrifuge tube, adds 2 times of volume dehydrated alcohols, places 8-12min under the room temperature, staticly settles DNA.At 4 ℃, 12500rpm, centrifugal 20min.Abandon supernatant liquor, 70% washing with alcohol DNA precipitation.DNA is dissolved in sterilized water, and is stand-by.
(2) acquisition of design of pcr amplification primer and amplification back target gene sequence
With the Alexandrium mimutum Halim by using genomic dna that step (1) is extracted, be that template is carried out pcr amplification with it, (Internal Transcribed Spacer ITS) is the target gene sequence with transcribed spacer in the rDNA transcriptional units;
Amplimer is: LH2:5 ' AGGTGAACCTGCGGAAGGATC3 ';
Dlam：5’CCTGCAGTCGACA(TG)ATGCTTAA(AG)TTCAGC(AG)GG3’；
Correspond respectively to the terminal and 24S rDNA 5 ' stub area of 18S rDNA3 ';
Amplification system: reaction totally is 50 μ L, comprising 5 μ L, 10 * PCR reaction buffer, 4 μ L MgCl
2(25mmol/L), 0.4 μ L TaqDNA polysaccharase (5U/ μ L), 2 μ L dNTP (2.5mml/L), 2 μ L genomic dnas (50 μ g/mL) add ddH
2O supplies volume;
Target gene sequences after the amplification:
TCTAATGTTGCATGACTTTGTGAGCTGTGGTGGGGTTCCTTGGCTTTAGGTTCTTCATCATTTGCTCGTGGGTGGCATGGCTTGCCTCGGCAAGCGCTTTCATGCTGCTGTGCGTTTGTCCTGTGACTGACTCTTTACCATTTTGTTGTTTACTTGTATCCATTGTGTGAAATGTGTTTTTGCAATGAATGTCTTAGCTCAATTGATGATGAAGAATGCAGCAAAATGTGATATGCATTGTGAATTGCAGAATTCCGTGAGCCAATAGATGTTTGAACGTGATTTGCACCTTCGGGATATGCTTGAAGGTGTGCTTGATTCAATGTCAATTATTTTCCAACCTTCCCTTGCTGTGTAGCAATGTTGTGAGCTGTGTGTGTCAATGCTGTAGCATTGGACACCCGCGCTTACGAATGCATTGCAACCTTGCTGTGTCTGCTTAGGTCTAACCTCTGTCACTTGCCTTGGTTGCAATGTGTTTGGGCATGTAGCTGAACAGCGTAAACTTAACATGAAGTGAAGCATGTAAACCCGCTGAATTTAAGCATATGTCGACTGCAGGA；
(3) LAMP amplimer design
The sequence of said determination is carried out finding transcribed spacer ITS1 and ITS2 in the transcriptional units after Blast analyzes, design primer with ITS1 and ITS2 district for target sequence respectively, usefulness Primer Explorer V4 designs primer:
| Primer Primer | Sequence Sequence (5 '-3 ') |
| ??Am-F3 | ?CTTTGTGAGCTGTGGTGG |
| ??Am-B3 | ?TTCTTCATCATCAATTGAGCTAA |
| ??Am-FIP(F1c+F2) | ?CAGCAGCATGAAAGCGCTTG-GTTCTTCATCATTTGCTCGTG |
| ??Am-BIP(B1c+B2) | ?CGTTTGTCCTGTGACTGACTC-GACATTCATTGCAAAAACACATT |
Alexandrium mimutum Halim by using and negative control experiment
(1) extracting genome DNA of red tide algae
The DNA extraction that comprises 8 kinds of algae altogether: 2 strain Alexandrium mimutum Halim by using (Prorocentrum minimum), chain Alexander algae (Alexandrium catenella), heterosigma akashiwo (Heterosigma akashiwo), Ka Shi anterior canal algae (Amphidinium carterae), Riamb's Prorocentrum micans (Prorocentrum lima), Chaetoceros (Chaetoceros sp.), prorocentrum minimum (Prorocentrum minimum), the different cap algae of ring-type (Heterocapsa circularisquama), concrete steps are as follows:
10 kinds of frustule liquid branches that are cultured to logarithmic phase are filled to the 2mL centrifuge tube, centrifugal, outwell supernatant, add 600 μ L extracting solution (100mmol/L Tris-Hcl, 100mmol/L EDTA, 1.4mol/L NaCl, 2%CTAB, 2% beta-mercaptoethanol), 65 ℃ of water-bath 1h.Add equal-volume PCI extract (volume ratio, phenol: chloroform: primary isoamyl alcohol=25: 24: 1), mixing, centrifugal 10min under 4 ℃, 12500rpm condition.Shift supernatant liquor to new centrifuge tube, adding RNase is 1 μ g/mL to final concentration, 37 ℃ of placement 30min.PCI repeats extracting once, and 4 ℃, the centrifugal 10min of 12500rpm.Water is transferred in the new centrifuge tube, adds 2 times of volume dehydrated alcohols, places 8-12min under the room temperature, staticly settles DNA.At 4 ℃, 12500rpm, centrifugal 20min.Abandon supernatant liquor, 70% washing with alcohol DNA precipitation.DNA is dissolved in sterilized water, is used for the LAMP amplification.
(2) LAMP amplimer
| Primer Primer | Sequence Sequence (5 '-3 ') |
| ??Am-F3 | ??CTTTGTGAGCTGTGGTGG |
| ??Am-B3 | ??TTCTTCATCATCAATTGAGCTAA |
| ??Am-FIP(F1c+F2) | ?CAGCAGCATGAAAGCGCTTG-GTTCTTCATCATTTGCTCGTG |
| ??Am-BIP(B1c+B2) | ?CGTTTGTCCTGTGACTGACTC-GACATTCATTGCAAAAACACATT |
(3) LAMP amplification reaction system
The LAMP amplification reaction system is 25uL, comprising: 2.5uL 10 * buffer (including 2mM of MgSO4), and the concentration of 2 inner primer Am-FIP and Am-BIP is 1.6 μ mol/L, the concentration of two outer primer Am-F3 and Am-B3 is 0.2 μ mol/L, 6mmol/L MgSO4,0.6mmol/L dNTP, 0.6mol/L Betaine (Sigma-Aldrich), 8U Bst archaeal dna polymerase, 1uL dna profiling, temperature of reaction are 65 ℃, and the reaction times is 60min, last 85 ℃, the 3min termination reaction;
(4) detection of LAMP amplified production
The affirmation of a.LAMP product specific amplification
Get the reacted LAMP product of 2 μ L in 1.5% agarose gel electrophoresis separation, gel imaging system is observed, and as seen has only two strain Alexandrium mimutum Halim by using the scalariform band to occur, and other little algaes do not have the amplified band (see figure 1);
B. produce white magnesium pyrophosphate precipitation because LAMP reacts, but the naked eyes direct viewing can be seen a large amount of white precipitates in the method and produce in the positive reaction pipe; Or adding 2 μ L, 100 * SYBR Green I in reaction tubes, the positive reaction pipe presents green, and the constant (see figure 2) of color in the negative reaction pipe.
Claims (4)
1. a loop-mediated isothermal amplification technology is examined the method for Alexandrium mimutum Halim by using fast, comprising:
(1) extracting genome DNA of red tide algae
(2) LAMP amplimer
Two outer primers:
Am-F3：CTTTGTGAGCTGTGGTGG；
Am-B3：TTCTTCATCATCAATTGAGCTAA；
Two inner primers:
Am-FIP：CAGCAGCATGAAAGCGCTTG-GTTCTTCATCATTTGCTCGTG；
Am-BIP：CGTTTGTCCTGTGACTGACTC-GACATTCATTGCAAAAACACATT；
(3) LAMP amplification reaction system
(4) detection of LAMP amplified production.
2. a kind of loop-mediated isothermal amplification technology according to claim 1 is examined the method for Alexandrium mimutum Halim by using fast, it is characterized in that: the LAMP amplification reaction system agents useful for same in the described step (3) is: 2.5uL 10 * buffer, the final concentration of two inner primer Am-FIP and Am-BIP is 1.6 μ M, the final concentration of two outer primer Am-F3 and Am-B3 is 0.2 μ M, also comprise 6mM MgSO4 in addition, 0.6mM dNTP, 0.6M Betaine (Sigma-Aldrich), 8U Bst archaeal dna polymerase, the 1uL dna profiling.
3. a kind of loop-mediated isothermal amplification technology according to claim 1 is examined the method for Alexandrium mimutum Halim by using fast, it is characterized in that: the condition of the LAMP amplification reaction system in the described step (3) is: 65 ℃ of temperature of reaction, reaction times 60min keeps the 3min termination reaction in 85 ℃ at last.
4. a kind of loop-mediated isothermal amplification technology according to claim 1 is examined the method for Alexandrium mimutum Halim by using fast, it is characterized in that: the LAMP amplified production in the described step (4) detects, the scalariform band appears in the visible positive reaction of electrophoresis detection, negative reaction does not have the appearance of band, has a large amount of white precipitates to produce in the visible positive reaction pipe of visual inspection; Or add 2 μ L100 * SYBR Green I in reaction tubes, and reaction tubes presents green positive, and color is constant negative in the reaction tubes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101021149A CN101838690B (en) | 2010-01-28 | 2010-01-28 | Method for fast detecting Alexandrium mimutum Halim by using loop-mediated isothermal amplification technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101021149A CN101838690B (en) | 2010-01-28 | 2010-01-28 | Method for fast detecting Alexandrium mimutum Halim by using loop-mediated isothermal amplification technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101838690A true CN101838690A (en) | 2010-09-22 |
| CN101838690B CN101838690B (en) | 2012-06-20 |
Family
ID=42742365
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101021149A Expired - Fee Related CN101838690B (en) | 2010-01-28 | 2010-01-28 | Method for fast detecting Alexandrium mimutum Halim by using loop-mediated isothermal amplification technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101838690B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154483A (en) * | 2011-02-15 | 2011-08-17 | 中国农业科学院兰州兽医研究所 | Detection kit for diagnosing babesia caballi and preparation and use methods |
| CN103045752A (en) * | 2013-01-21 | 2013-04-17 | 哈尔滨工业大学（威海） | Preparation and application method of membrane classification chip capable of simultaneously detecting various red-tide algae |
| CN115961084A (en) * | 2023-01-10 | 2023-04-14 | 中国海洋大学 | Rapid chromogenic detection method for phaeodactylum acutangulatum |
-
2010
- 2010-01-28 CN CN2010101021149A patent/CN101838690B/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154483A (en) * | 2011-02-15 | 2011-08-17 | 中国农业科学院兰州兽医研究所 | Detection kit for diagnosing babesia caballi and preparation and use methods |
| CN102154483B (en) * | 2011-02-15 | 2013-08-28 | 中国农业科学院兰州兽医研究所 | Detection kit for diagnosing babesia caballi and preparation and use methods |
| CN103045752A (en) * | 2013-01-21 | 2013-04-17 | 哈尔滨工业大学（威海） | Preparation and application method of membrane classification chip capable of simultaneously detecting various red-tide algae |
| CN103045752B (en) * | 2013-01-21 | 2014-12-24 | 哈尔滨工业大学（威海） | Preparation and application method of membrane classification chip capable of simultaneously detecting various red-tide algae |
| CN115961084A (en) * | 2023-01-10 | 2023-04-14 | 中国海洋大学 | Rapid chromogenic detection method for phaeodactylum acutangulatum |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101838690B (en) | 2012-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101638685B (en) | Method for amplifying target nucleic acid sequence by using cross primer and kit for amplifying target nucleic acid sequence and application thereof | |
| CN101880711A (en) | Nucleic acid screening method of staphylococcus aureus, salmonella, shigella and listeria monocytogenes | |
| CN104480202B (en) | A kind of Fructus Luffae reference gene and application thereof | |
| CN107338314B (en) | Closed-tube visual eel-derived aeromonas hydrophila loop-mediated isothermal amplification detection method | |
| CN101838690B (en) | Method for fast detecting Alexandrium mimutum Halim by using loop-mediated isothermal amplification technology | |
| CN102010910A (en) | Loop-mediated isothermal amplification technology-based plasmodium genus and species nucleic acid screening method | |
| CN104694620A (en) | LAMP (loop-mediated isothermal amplification) and primer set adopted molecular detection method of a variety of microorganisms | |
| CN101492741A (en) | Method for quantitative detection of mycoplasma hyopneumoniae | |
| CN101348835B (en) | Reagent kit for detecting vibrio vulnificus by loop-mediated isothermal amplification technology | |
| CN101942506B (en) | Method for rapidly detecting prorocentrum minimum by adopting LAMP (Loop-Mediated Isothermal Amplification) technology | |
| CN104762396A (en) | Histoplasma infection molecular diagnosis kit based on loop-mediated isothermal amplification (LAMP) technique principles and application thereof | |
| CN102816870B (en) | Primer and kit for detecting coxsackievirus A6 type RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid | |
| CN104004835A (en) | Multiplex PCR detection method of rabbit skin fungi | |
| CN101736079B (en) | Method for detecting karenia mikimotoi through loop-mediated isothermal amplification | |
| CN103409499A (en) | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella | |
| CN102676678B (en) | PCR (Polymerase Chain Reaction) primer group for distinguishing five types of shellfish bait microalgae | |
| CN101838697B (en) | Method for fast detecting Kerina breve by using loop-mediated isothermal amplification technology | |
| CN101942507B (en) | Method for rapidly detecting chain alexandrum by adopting LAMP (Loop-Mediated Isothermal Amplification) technology | |
| CN102312010B (en) | Rapid detection primers, kit and detection method for C.parapsilosis with loop-mediated isothermal amplification | |
| CN101235411A (en) | Kit for detecting guinea pig aeromonas by utilizing Loop-mediated isothermal amplification technique | |
| CN101792802B (en) | SRY (Sex-determining Region of Y-chromosome) specificity TaqMan probe primer pair and real-time fluorescent SRY gene detective reagent kit | |
| CN110819734B (en) | Apple tree rot fungus LAMP amplification primer and apple tree rot disease detection kit | |
| CN103160616B (en) | Swine vesicular disease assay kit | |
| CN103045763A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) detection method of novel duck tembusu virus | |
| CN102220424A (en) | Rapid detection method for enterococcus, detection primer group and detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120620 Termination date: 20150128 |
|
| EXPY | Termination of patent right or utility model |