CN101831449B - Method for knocking out torulopsis glabrata mitochondrion gene - Google Patents

Method for knocking out torulopsis glabrata mitochondrion gene Download PDF

Info

Publication number
CN101831449B
CN101831449B CN2010101356091A CN201010135609A CN101831449B CN 101831449 B CN101831449 B CN 101831449B CN 2010101356091 A CN2010101356091 A CN 2010101356091A CN 201010135609 A CN201010135609 A CN 201010135609A CN 101831449 B CN101831449 B CN 101831449B
Authority
CN
China
Prior art keywords
gene
torulopsis glabrata
arg8m
flat board
mitochondrion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2010101356091A
Other languages
Chinese (zh)
Other versions
CN101831449A (en
Inventor
刘立明
周景文
陈坚
堵国成
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN2010101356091A priority Critical patent/CN101831449B/en
Publication of CN101831449A publication Critical patent/CN101831449A/en
Application granted granted Critical
Publication of CN101831449B publication Critical patent/CN101831449B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for knocking out a torulopsis glabrata mitochondrion gene and belongs to the technical field of genetic engineering. In the invention, a homologous recombination fragment having the flanking sequences of an acetyl-ornithine transaminase gene (ARG 8m) and a mitochondrion gene to be knocked out is obtained by mainly using a long terminal primer, a torulopsis glabrata mitochondrion is transferred by a gene gun, and heterogeneity of the mitochondrion is eliminated by anaerobic culture to obtain a transformant which only has the gene on the modified mitochondrion. The torulopsis glabrata obtained by the invention is easy to identify and protect; the knocking method represents a novel approach and method for the genetic engineering modification of diploid of polyploidy yeasts; and the knocking method is simple and efficient, can retain the original characteristics of the yeasts, and can knock out the mitochondrion gene within 5 to 7 days.

Description

A kind of method of knocking out torulopsis glabrata mitochondrion gene
Technical field
The invention belongs to the microbiological genetic engineering field, be specifically related to a kind of torulopsis glabrata and knockout technique thereof of chondriogen disappearance.
Background technology
Torulopsis glabrata is a kind of haploid yeast, does not have the syngenesis stage.Torulopsis glabrata is widely used in the production of pyruvic acid and α-Tong Wuersuan.Some Torulopsis glabrata strain is clinically opportunistic pathogen still.The genetically engineered research of torulopsis glabrata also is in the starting stage at present.The most frequently used genetic marker is to finish the complementary nutrient defect type mark in yeast.
The molecular biological mechanism of present domestic research torulopsis glabrata is less, still is in the preliminary stage of research.Screening torulopsis glabrata auxotrophic strain is to one of its important foundation work of furtheing investigate.
Summary of the invention
Technical problem to be solved by this invention provides a kind of acetylornithine aminotransferase gene (ARG8m), torulopsis glabrata that chondriogen is knocked out of containing.
Described torulopsis glabrata ATP6 gene is knocked out.
Described torulopsis glabrata ATP8 gene is knocked out.
Described torulopsis glabrata ATP9 gene is knocked out.
Another technical problem to be solved by this invention provides the method for gene on a kind of knocking out torulopsis glabrata mitochondrion.
For solving the problems of the technologies described above, technical scheme of the present invention is:
Transform arginine defective type torulopsis glabrata with the fragment that has goal gene, cultivate enrichment by anaerobism and obtain the torulopsis glabrata that chondriogen lacks with screening.
Described target gene fragment is meant that the goal gene left side and the right are respectively left end and the right-hand member of waiting to knock out gene, and acetylornithine aminotransferase gene (ARG8m) is contained in the centre of target gene fragment.
Particle bombardment is adopted in described conversion, and parameter is that carrier is the bronze of 0.6um, and distance is 6cm, adopts the rupture disk of 1100psi, and vacuum tightness is 29.5MPa.
Described torulopsis glabrata is a competent cell.
It is as follows to knock out on the plastosome concrete steps of gene:
(1) according to acetylornithine aminotransferase gene (ARG8m) and wait to knock out the primer that gene order design amplification contains homologous fragment and ARG8m gene, introduce BamHI (ggatcc) restriction enzyme site respectively at 5 ' and 3 ' end, with the carrier that carries the ARG8m gene is that template is carried out pcr amplification, obtain containing and remain the fragment of mutator gene homologous sequence and ARG8m gene, the preferred pDS24 of described carrier (Steele, etc.Proc.Natl.Acad.Sci., 1996,93,5253-5257.);
(2) the PCR product pUC19 plasmid that same enzyme is cut after the BamHI enzyme is cut connects, and obtains one and contains and remain mutator gene and knock out the plasmid of frame;
(3) the gained plasmid is transformed torulopsis glabrata arginine deficient strain with particle gun;
(4) single bacterium colony is put into the liquid-based basal culture medium through behind the subclone, uses the nitrogen exhausted air, and the sealing back is got the suitable dilution of culture and coated on minimum medium (MM) flat board in 30 ℃ of cultivation 24h;
(5) picking list bacterium colony is xeroxed respectively to YPD and YPG flat board, on the YPG flat board, occur and on the YPD flat board, do not grow, extract genome to identify, can obtain the torulopsis glabrata that chondriogen knocks out.
The advantage that the present invention has: the torulopsis glabrata that (1) the present invention obtains is a plastosome homogeneity type bacterial strain, solve the problem that contains a plurality of not homogeneity molded lines plastochondrias in the yeast cell usually, will greatly promote the research of follow-up metabolic engineering and microbial physiology; Chondriogen has disappearance, is easy to identification and protection; (2) knockout technique of the present invention provides a kind of new approaches and methods for amphiploid or polyploid zymic are genetic engineering modified; (3) knockout technique of the present invention is simple, efficient, keeps the zymic primary characteristic constant, the knocking out of the chondriogen that can realize in 5-7 days.
Description of drawings:
The growing state of Fig. 1 Mitochondrial DNA homoplasmon transformant on YPD and YPG
The homogeneous PCR checking of Fig. 2 mtDNA transformant
(a) primer PCR site synoptic diagram; (b) the PCR product of primer ARG8m-F/R; M:1kb DNALadder; 1: wild type strain; 2: starting strain; The 3:ATP8 knock-out bacterial strain; The 4:ATP6 knock-out bacterial strain; The 5:ATP9 knock-out bacterial strain; 6:pDS24 (positive control); (c) the PCR product .M:1kb DNA Ladder of ATP869-F/R; 1: wild type strain; 2: starting strain; The 3:ATP8 knock-out bacterial strain; The 4:ATP6 knock-out bacterial strain; The 5:ATP9 knock-out bacterial strain.
Embodiment:
The knockout technique of embodiment 1 torulopsis glabrata chromogene ATP6
1. contain the acquisition of the segmental pUC-atp6::ARG8m plasmid of purpose
Right with primer:
Con-ATP6-F：
5’GCggatccAATATTATTTATTATATAATAATATTAATTTTAATAAGTTATAATATATATTTATAAAGT ATGACACATTTAGAAAGAAG?3’
Con-ATP6-R：
5’GCGggatccTATTAATAATAATTAATTAAAGAATATTATAATATAATTAATTTATTTGTATTATATAAA TTAAGCATATACAGCTTCG?3’
What amplification obtained being used to knocking out ATP6 from the plasmid pDS24 that contains the ARG8m gene knocks out frame Δ atp6::ARG8m.Since 5 ' end, be respectively restriction enzyme site protection base (capitalization), BamHI restriction enzyme site (lowercase), and the homologous sequence of ATP6 homologous fragment (capitalization) and ARG8m (underscore) in the primer.
The PCR condition is: 95 ℃, and 3min; 95 ℃, 50s; 55 ℃, 60s; 72 ℃, 1min} circulates 30 times; 72 ℃, 15min;-20 ℃ of preservations.The PCR product inserts pUC 19 plasmids of cutting through same enzyme after cutting through the BamHI enzyme, obtains a plasmid that contains ATP6 gene knockout frame, called after pUC-atp6::ARG8m, sequence verification.
2. particle gun transforms
1) choose single colony inoculation in 5mL YPD substratum, 30 ℃ of incubated overnight are to saturated;
2) 0.1% be seeded in the 100mL YPD substratum, cultivate 24h for 30 ℃, cell density is about 1 * 10 9Cell/mL;
3) the culture branch is filled in the aseptic centrifuge tube of two 50mL precoolings, the centrifugal supernatant that goes of 5000rpm, 5min;
4) resuspended with the 1molL-1 sorbyl alcohol of an amount of (about 2mL) precooling, make final bacteria suspension OD600=200;
5) coat on the MM by every part 100 μ L, directly transform;
6) plasmid that will be dissolved in 2 μ g in the 2 μ L deionized waters is attached on the bronze particle, and coats brokenly on the rupture disk, is used for particle gun and transforms; The parameter that transforms is: carrier is the bronze of 0.6 μ m, and distance is 6cm, adopts the rupture disk of 1100psi, and vacuum tightness is 29.5MPa;
7) after conversion finishes, flat board is placed 30 ℃ of cultivations, occur until single bacterium colony.
3. the torulopsis glabrata chondriogen knocks out the acquisition of homoplasmon
1) single bacterium colony is put into the liquid-based basal culture medium through behind the subclone, uses the nitrogen exhausted air, and the sealing back is got the suitable dilution of culture and coated on the minimum medium flat board in 30 ℃ of cultivation 24h;
2) picking list bacterium colony is xeroxed respectively to YPD and YPG flat board, on the YPG flat board, occur and on the YPG flat board, do not grow, be the mitochondrial homozygote that only contains after the conversion.
4. plastosome knocks out the checking of homoplasmon
Right with primer:
ATP869-F：5’cactattggtggtatgacag3’
ATP869-R:5 ' GTGTTGGCACATCATTACTA3 ' carries out bacterium colony PCR checking to the bacterial strain that is obtained, and the results are shown in Figure 1.Transformant is inoculated in respectively with the bacterial classification that sets out and carries out the substratum checking on YPD and the YPG substratum, the results are shown in Figure 2.
5. relevant substratum:
YPD substratum: yeast extract 10gL -1, Tryptones 2.0gL -1, glucose 20gL -1
YPG substratum: yeast extract 10gL -1, Tryptones 2.0gL -1, glycerine 20gL -1
Minimum medium (MM): glucose 20gL -1, KH 2PO 41.0gL -1, MgSO 47H 2O 0.5gL -1, (NH 4) 2SO 410gL -1, uridylic 80mgL -1
Corresponding YPD, the MM flat board all adds 20gL -1Agar powder.
The knockout technique of embodiment 2 torulopsis glabrata chromogene ATP8
1. contain the acquisition of the segmental pUC-atp8::ARG8m plasmid of purpose
Right with primer:
Con-ATP8-F：
5’GCggatccATAATAATTTATTTATTATTAATGTTGTATTTATATTAAATATATAAAAAATATATAAAT ATGACACATTTAGAAAGAAG?3’
Con-ATP8-R：
5’GCGggatccATAATTATATATTATTAATTATATTATATTATAATTATATATTATTATTATTAATTATAT TTAAGCATATACAGCTTCG?3’
What amplification obtained being used to knocking out ATP6 from the plasmid pDS24 that contains the ARG8m gene knocks out frame Δ atp6::ARG8m.Since 5 ' end, be respectively restriction enzyme site protection base (capitalization), BamHI restriction enzyme site (lowercase), and the homologous sequence of ATP8 homologous fragment (capitalization) and ARG8m (glissade) in the primer.
The PCR condition is: 95 ℃, and 3min; 95 ℃, 50s; 55 ℃, 60s; 72 ℃, 1min} circulates 30 times; 72 ℃, 15min;-20 ℃ of preservations.The PCR product inserts the pUC19 plasmid of cutting through same enzyme after cutting through the BamHI enzyme, obtains a plasmid that contains ATP8 gene knockout frame, called after pUC-atp8::ARG8m, sequence verification.
2. particle gun transforms
1) choose single colony inoculation in 5mL YPD substratum, 30 ℃ of incubated overnight are to saturated;
2) 0.1% be seeded in the 100mL YPD substratum, cultivate 24h for 30 ℃, cell density is about 1 * 10 9Cell/mL;
3) the culture branch is filled in the aseptic centrifuge tube of two 50mL precoolings, the centrifugal supernatant that goes of 5000rpm, 5min;
4) use the 1molL of (about 2mL) precooling in right amount -1Sorbyl alcohol is resuspended, makes final bacteria suspension OD 600=200;
5) coat on the minimum medium by every part 100 μ L, directly transform;
6) plasmid that will be dissolved in 2 μ g in the 2 μ L deionized waters is attached on the bronze particle, and coats brokenly on the rupture disk, is used for particle gun and transforms; The parameter that transforms is: carrier is the bronze of 0.6um, and distance is 6cm, adopts the rupture disk of 1100psi, and vacuum tightness is 29.5MPa;
7) after conversion finishes, flat board is placed 30 ℃ of cultivations, occur until single bacterium colony.
3. the torulopsis glabrata chondriogen knocks out the acquisition of homoplasmon
1) single bacterium colony is put into the liquid-based basal culture medium through behind the subclone, uses the nitrogen exhausted air, and the sealing back is got the suitable dilution of culture and coated on the minimum medium flat board in 30 ℃ of cultivation 24h;
2) picking list bacterium colony is xeroxed respectively to YPD and YPG flat board, on the YPG flat board, occur and on the YPG flat board, do not grow, be the mitochondrial homozygote that only contains after the conversion.
4. plastosome knocks out the checking of homoplasmon
Right with primer:
ATP869-F：5’cactattggtggtatgacag3’
ATP869-R:5 ' GTGTTGGCACATCATTACTA3 ' carries out bacterium colony PCR checking, and transformant is inoculated in respectively with the bacterial classification that sets out and carries out the substratum checking on YPD and the YPG substratum, the results are shown in Figure 2.
5. relevant substratum:
YPD substratum: yeast extract 10gL -1, Tryptones 2.0gL -1, glucose 20gL -1
YPG substratum: yeast extract 10gL -1, Tryptones 2.0gL -1, glycerine 20gL -1
Minimum medium (MM): glucose 20gL -1, KH 2PO 41.0gL -1, MgSO 47H 2O 0.5gL -1, (NH 4) 2SO 410gL -1, uridylic 80mgL -1
Corresponding YPD, the MM flat board all adds 20gL -1Agar powder.
The knockout technique of embodiment 3 torulopsis glabrata chromogene ATP9
1. contain the acquisition of the segmental pUC-atp9::ARG8m plasmid of purpose
Right with primer:
Con-ATP9-F：
5’GCggatccATATATATATATATATTAATTATTTAAATATATAATAAAGATTATAAAAAATATAATATT ATGACACATTTAGAAAGAAG?3’
Con-ATP9-R：
5’GCGggatccAAATATTTATTTATTAAGAATATTATAATATTACTATATTAATAGTAAACATTATTATTA TTAAGCATATACAGCTTCG?3’
What amplification obtained being used to knocking out ATP6 from the plasmid pDS24 that contains the ARG8m gene knocks out frame Δ atp9::ARG8m.Since 5 ' end, be respectively restriction enzyme site protection base (capitalization), BamHI restriction enzyme site (lowercase), and the homologous sequence of ATP9 homologous fragment (capitalization) and ARG8m (glissade) in the primer.
The PCR condition is: 95 ℃, and 3min; 95 ℃, 50s; 55 ℃, 60s; 72 ℃, 1min} circulates 30 times; 72 ℃, 15min;-20 ℃ of preservations.The PCR product inserts the pUC19 plasmid of cutting through same enzyme after cutting through the BamHI enzyme, obtains a plasmid that contains ATP9 gene knockout frame, called after pUC-atp9::ARG8m, sequence verification.
2. particle gun transforms
1) choose single colony inoculation in 5mL YPD substratum, 30 ℃ of incubated overnight are to saturated;
2) 0.1% be seeded in the 100mL YPD substratum, cultivate 24h for 30 ℃, cell density is about 1 * 10 9Cell/mL;
3) the culture branch is filled in the aseptic centrifuge tube of two 50mL precoolings, the centrifugal supernatant that goes of 5000rpm, 5min;
4) use the 1molL of (about 2mL) precooling in right amount -1Sorbyl alcohol is resuspended, makes final bacteria suspension OD 600=200;
5) coat on the minimum medium by every part 100 μ L, directly transform;
6) plasmid that will be dissolved in 2 μ g in the 2 μ L deionized waters is attached on the bronze particle, and coats brokenly on the rupture disk, is used for particle gun and transforms; The parameter that transforms is: carrier is the bronze of 0.6um, and distance is 6cm, adopts the rupture disk of 1100psi, and vacuum tightness is 29.5MPa;
7) after conversion finishes, flat board is placed 30 ℃ of cultivations, occur until single bacterium colony.
3. the torulopsis glabrata chondriogen knocks out the acquisition of homoplasmon
1) single bacterium colony is put into the liquid-based basal culture medium through behind the subclone, uses the nitrogen exhausted air, and the sealing back is got the suitable dilution of culture and coated on the minimum medium flat board in 30 ℃ of cultivation 24h;
2) picking list bacterium colony is xeroxed respectively to YPD and YPG flat board, on the YPG flat board, occur and on the YPG flat board, do not grow, be the mitochondrial homozygote that only contains after the conversion.
4. plastosome knocks out the checking of homoplasmon
Right with primer:
ATP869-F：5’cactattggtggtatgacag3’
ATP869-R:5 ' GTGTTGGCACATCATTACTA3 ' carries out bacterium colony PCR checking to the bacterial strain that is obtained, and transformant is inoculated in respectively with the bacterial classification that sets out and carries out the substratum checking on YPD and the YPG substratum, the results are shown in Figure 2.
5. relevant substratum:
YPD substratum: yeast extract 10gL -1, Tryptones 2.0gL -1, glucose 20gL -1
YPG substratum: yeast extract 10gL -1, Tryptones 2.0gL -1, glycerine 20gL -1
Minimum medium (MM): glucose 20gL -1, KH 2PO 41.0gL -1, MgSO 47H 2O 0.5gL -1, (NH 4) 2SO 410gL -1, uridylic 80mgL -1
Corresponding YPD, the MM flat board all adds 20gL -1Agar powder.

Claims (8)

1. the method for a knocking out torulopsis glabrata ATP synthase gene, it is characterized in that being respectively left end and the right-hand member of waiting to knock out gene with the left side and the right, the centre is that the fragment of acetylornithine aminotransferase ARG8m encoding gene transforms arginine defective type torulopsis glabrata, cultivates enrichment by anaerobism and obtains the torulopsis glabrata that chondriogen lacks with screening.
2. the described method of claim 1 is characterized in that described conversion employing particle bombardment, and parameter is that carrier is the bronze of 0.6um, and distance is 6cm, adopts the rupture disk of 1100psi, and vacuum tightness is 29.5MPa.
3. claim 1 or 2 described methods is characterized in that described torulopsis glabrata is a competent cell.
4. claim 1 or 2 described methods is characterized in that comprising the steps:
(1) according to acetylornithine aminotransferase gene (ARG8m) and treat that mutator gene sequences Design amplification two ends are to treat mutator gene left and right sides sequence, middlely be the primer of ARG8m gene, introduce BamHI (ggatcc) restriction enzyme site respectively at 5 ' and 3 ' end, with the carrier that carries the ARG8m gene is that template is carried out pcr amplification, obtains containing remaining the fragment of mutator gene homologous sequence and ARG8m gene;
(2) the pUC19 plasmid cut with same enzyme after the BamHI enzyme is cut of PCR product is connected, and obtains one and contains and remain mutator gene and knock out the plasmid of frame;
(3) the gained plasmid is transformed torulopsis glabrata arginine deficient strain with particle gun;
(4) single bacterium colony is put into the liquid-based basal culture medium through behind the subclone, uses the nitrogen exhausted air, and the sealing back is got the suitable dilution of culture and coated on minimum medium (MM) flat board in 30 ℃ of cultivation 24h;
(5) picking list bacterium colony is xeroxed respectively to YPD and YPG flat board, on the YPG flat board, occur and on the YPD flat board, do not grow, extracting genome carries out PCR and identifies, can obtain the torulopsis glabrata that chondriogen knocks out.
5. a torulopsis glabrata that obtains according to the described method of claim 1 is characterized in that described torulopsis glabrata contains acetylornithine aminotransferase gene (ARG8m), and goal gene is knocked out on the plastosome.
6. the described torulopsis glabrata of claim 6 is characterized in that described torulopsis glabrata ATP6 gene is knocked out.
7. the described torulopsis glabrata of claim 6 is characterized in that described torulopsis glabrata ATP8 gene is knocked out.
8. the described torulopsis glabrata of claim 6 is characterized in that described torulopsis glabrata ATP9 gene is knocked out.
CN2010101356091A 2010-03-30 2010-03-30 Method for knocking out torulopsis glabrata mitochondrion gene Expired - Fee Related CN101831449B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2010101356091A CN101831449B (en) 2010-03-30 2010-03-30 Method for knocking out torulopsis glabrata mitochondrion gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2010101356091A CN101831449B (en) 2010-03-30 2010-03-30 Method for knocking out torulopsis glabrata mitochondrion gene

Publications (2)

Publication Number Publication Date
CN101831449A CN101831449A (en) 2010-09-15
CN101831449B true CN101831449B (en) 2011-12-21

Family

ID=42715668

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2010101356091A Expired - Fee Related CN101831449B (en) 2010-03-30 2010-03-30 Method for knocking out torulopsis glabrata mitochondrion gene

Country Status (1)

Country Link
CN (1) CN101831449B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101240250A (en) * 2008-03-07 2008-08-13 江南大学 Method for constructing non-resistance mark auxotroph torulopsis glabrata

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2900660B1 (en) * 2006-05-03 2008-07-11 Univ Victor Segalen Bordeaux 2 YEAST MODELING OF MITOCHONDRIAL ATP6 GENE MUTATIONS RESPONSIBLE FOR NARP SYNDROME IN HUMANS AND ITS APPLICATIONS FOR DRUG SCREENING

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101240250A (en) * 2008-03-07 2008-08-13 江南大学 Method for constructing non-resistance mark auxotroph torulopsis glabrata

Also Published As

Publication number Publication date
CN101831449A (en) 2010-09-15

Similar Documents

Publication Publication Date Title
CN105543270A (en) Double resistance CRISPR/Cas9 carrier and application
CN104498374A (en) Verticillium dahlia delta VdKu70 defective mutant strain and application thereof
CN105368866A (en) Application of improved ATMT (Agrobacterium Tumefaciens-Mediated Transformation) to construction of trichoderma atroviride T23 deltaCrel
CN111057654B (en) Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof
CN109136254A (en) A kind of seamless gene knockout method of efficient saccharomyces cerevisiae and its application
CN107043730A (en) Engineering strain, Preparation method and use for producing the formamide of azophenlyene 1
Wang et al. Use of CRISPR‐Cas tools to engineer Trichoderma species
CN105368732A (en) Industrial saccharomyces cerevisiae strain capable of producing xylitol and construction method of industrial saccharomyces cerevisiae strain
WO2019214347A1 (en) Genetic screening method for negative regulatory factor of streptomyces biosynthesis gene cluster
CN109666690B (en) Method for over-expressing non-trace trichoderma fungus gene
CN105802952A (en) Method for protecting lentinus edodes strain through uracil auxotroph
CN104561080A (en) Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof
CN101831449B (en) Method for knocking out torulopsis glabrata mitochondrion gene
CN105200078A (en) Aspergillus niger gene knockout method
CN103710274A (en) Genetically engineered bacterium for increasing yield of extracellular pyruvic acid and application thereof
CN101240250A (en) Method for constructing non-resistance mark auxotroph torulopsis glabrata
CN105255936A (en) Method for establishing salinispora arenlocola CNS-205 gene genetic manipulation system
CN112626103B (en) Yarrowia lipolytica engineering bacterium for producing limonene and application
CN103667274A (en) Hansenula polymorpha genetic operation strategy and application thereof
CN105177036A (en) Application of small RNA gene miR396b in improvement of crop yield
CN102174558A (en) Method for increasing output of antibacterial peptides of bacillus subtilis through knockout (i)abrB(/i) genes
CN102120966A (en) Construction and application of URA3 defective P. pastoris X-33 strain
CN105505971A (en) Method for improving yield of butanol produced by escherichia coli
CN103088434B (en) Construction method and application of Pichia stipitis large-fragment DNA (deoxyribonucleic acid) genome library
CN104974943A (en) Knockout mutant strain of verticillium dahliae thiamine transporter gene and application of knockout mutant strain

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20111221

Termination date: 20180330

CF01 Termination of patent right due to non-payment of annual fee