CN101824469A - Method for amplifying ITS break sequence in Bactrocera dorsalis rDNA by nesting PCR - Google Patents

Abstract

The invention discloses the amplification of ITS break sequence in Bactrocera dorsalis rDNA by nesting PCR, comprising the following steps: amplifying the specific ITS fragment of the Bactrocera dorsalis rDNA by designing a nesting specific primer; using the specific ITS fragment of the amplified Bactrocera dorsalis rDNA to accurately and quickly identify actrocera dorsalis flyblow in fruit, and determining the difference of the amplification Bactrocera dorsalis flyblow and relative species by sequences. The method has reliable result, can quickly detect the existence of Bactrocera dorsalis flyblow in fruit and determines the species evolutionary relationship through sequence analysis.

Description

The method of ITS break sequence among the nested PCR amplification citrus fruit fly rDNA

Technical field

The invention belongs to biological dna technique, the method for ITS break sequence among particularly a kind of nested PCR amplification citrus fruit fly rDNA.

Background technology

Citrus fruit fly (Bactrocera dorsalis (Hendel)) is the quarantine insect that material impact was produced and the export trade was formed to a kind of direct harm fruits and vegetables, originate in the torrid zone, Asia or subtropical zone, now having become the dangerous fruits and vegetables insect of South East Asia, the Indian subcontinent and Hawaiian Islands one band, is one of main object of China's Plant Quarantine.In the port quarantine evaluation work of citrus fruit fly, mainly be characterized as foundation at present with the adult formalness, and larva often or the ovum that intercept and capture at the port, way is it to be carried out indoor feeding obtain to identify behind the adult again usually.

Along with molecular biological develop rapidly, polymerase chain reaction (PCR) technology, nucleic acid sequence analysis technology equimolecular technology are used widely in fields such as taxonomy, systematics, genetics, ecology and subject.With molecular biology is laboratory facilities, and the insect molecular systematics that the research classification of insect is identified, monoid genetic construction, phylogeny and molecular evolution are main contents is one of new branch of science in recent years.Though above-mentioned technology is applied in quarantine venereal disease evils such as plant inspection quarantine virus, fungi and nematode detect, the evaluation that is used to quarantine property insect is then relative less with differentiation.Search finds that the U.S., New Zealand, Australia etc. have registered the gene order of relevant citrus fruit fly in succession in recent years on NCBI, and (2000) such as U.S. Davis have registered no fruit gene (fruitless gene) the BTB sequence of Hawaii citrus fruit fly; New Zealand Armstrong (1997) has measured the ITS1 partial sequence of two strains of this worm, complete sequence and the ITS2 partial sequence of rRNA5.8S; The mtDNA that (1997) such as the Hoeben of University of Queensland have measured the Tabiti strain encircles the complete sequence in district and the partial sequence of ribosomal gene 18S.It is less that China's utilization Protocols in Molecular Biology is inquired into the research report that the citrus fruit fly kind is identified, population breaks up.In order to confirm epidemic situation quickly and accurately and to protect fruits and vegetables production.The Molecular Identification research of carrying out citrus fruit fly is very important.

Summary of the invention

Technical problem to be solved by this invention is: the method that ITS break sequence among a kind of nested PCR amplification citrus fruit fly rDNA is provided.The molecular diagnosis method that can be used for bactrocera dorsalis ovum in the rapid detection fruit.Can confirm epidemic situation quickly and accurately and protect fruits and vegetables production.

Patent application of the present invention mainly is the PCR primer fragment dna sequence dna of application protection design, and PCR fragment dna sequence dna.

Technical scheme of the present invention is:

ITS break sequence method among a kind of nested PCR amplification citrus fruit fly rDNA:

(1) test materials and method:

(1.1) for test agent and worm source

Oranges and tangerines are pruned diameter 3-4 centimetre, and the crust that thickness is 2 millimeters is put into incubator, and female to the citrus fruit fly of adult, male each one of the laboratory rearing of learning from else's experience is put into incubator, treats that female worm lays eggs, and gets oranges and tangerines and extracts total genomic dna;

(1.2) extracting genome DNA (CTAB method)

The oranges and tangerines outer skin portion of pruning is cut out long and wide to be 0.5 centimetre, thick 0.2 centimetre square, to be used for extracting genome DNA; The extraction of DNA and quality determining method are with reference to the molecular cloning handbook; The DNA sample is put in-20 ℃ of refrigerators and preserves; Specific as follows: vegetable material liquid nitrogen freezing (the about 0.05g of each eppendorf pipe)--frotton is smashed (fast) to pieces, add 500ul 2%CTAB then, mixing, more than 65 ℃ of insulation 30min, middle attention is shaken, add chloroform: primary isoamyl alcohol (24: 1) 500ul shakes mixing, 12000rpm, 10min is centrifugal, gets supernatant, add isopyknic Virahol, place more than the 30min for-20 ℃; 10000rpm once more, 5min is centrifugal, abandons supernatant, wash once with 70% ethanol, 10000rpm, 5min is centrifugal, abandons supernatant, thoroughly dries, and adds 30ul TE dissolving genomic dna;

(1.3) design of primers

Design of primers goes up disclosed citrus fruit fly rDNA gene order, first round PCR primer, forward primer PF-1:5 ' TGACCTAAGACATGCGCAGCTT 3 ' with reference to NCBI; Reverse primer PR-1:5 ' GGGACTTAAGGTCTAGGTCACA 3 ';

First round PCR product D NA sequence:

tgacct?aagacatgcg?cagcttgcaa?atgtttgggt

ttaaaattac?aatttattga?aagatgtgtt?ggaattttat?tttaaaaatt?tgttataaat

attattatta?ttattctttc?aataaattaa?aaactcttga?ctttgaatca?aaaaacacaa

aaaattttta?ctctaagcgg?tggatcactc?ggctcatgca?tcgatgaaga?acgcagcaaa

ctgtgcgtca?tcgtgtgaac?tgcaggacac?atgaacatcg?acattttgaa?cgcatattgc

ggtccatgct?gttatgtact?ttaattaatt?ttaaagtgct?gcttggacta?catatggttg

agggttgtaa?gactatggct?aaattagttg?cttattcttt?tagttaatta?aaagaattta

agcatatggt?atattattgg?attgtatttt?ccaatccata?atattaatag?cataaaaaga

aatatataca?atatattctt?gaatacctca?tatttgaacg?aaattttata?ataaatgaga

atcttagtat?tcccaaaata?aaaaaaaaat?ttcaatatta?tttaaaatat?atttaaataa

atacattacg?aggacagtct?agcataaaat?atattcatat?tgtgacctag?accttaagtc

cc

Second takes turns the PCR primer, forward primer PF-2:5 ' tctaagcggtggatcact 3 '; Reverse primer PR-2:5 ' tgctagactgtcctcgta 3 '; Primer is synthetic synthetic by Shanghai Ying Jun Bioisystech Co., Ltd;

Second takes turns PCR product D NA sequence:

tctaagcgg?tggatcactc?ggctcatgca?tcgatgaaga?acgcagcaaa

ctgtgcgtca?tcgtgtgaac?tgcaggacac?atgaacatcg?acattttgaa?cgcatattgc

ggtccatgct?gttatgtact?ttaattaatt?ttaaagtgct?gcttggacta?catatggttg

agggttgtaa?gactatggct?aaattagttg?cttattcttt?tagttaatta?aaagaattta

agcatatggt?atattattgg?attgtatttt?ccaatccata?atattaatag?cataaaaaga

aatatataca?atatattctt?gaatacctca?tatttgaacg?aaattttata?ataaatgaga

atcttagtat?tcccaaaata?aaaaaaaaat?ttcaatatta?tttaaaatat?atttaaataa

atacattacg?aggacagtct?agca

(1.4) optimization of PCR reaction system and reaction conditions

The amplification volume of PCR reaction is 20 μ L, comprises 1 * PCR damping fluid, 2mmol/L Mg ²⁺, 0.2mmol/L dNTP, each 0.2 μ mol/L of forward and reverse primer, 1U Taq enzyme Takara, template DNA 20～40ng; The pcr amplification general conditions is 94 ℃ of pre-sex change 2min, moves 30 circulations altogether; Each circulation comprises: 95 ℃ of sex change 30s, and 55 ℃ of annealing 30s, 72 ℃ are extended 30s, circulate for the last time back 72 ℃ to extend 5min; Sample carries out the purpose fragment amplification on Biosystem Gene Amp PCR System 9700 instruments; The PCR product is the electrophoresis detection expanding effect on 1% agar gel;

(1.5) the PCR product purification reclaims

PCR product QIAquick PCR Purification Germany, QIAGEN test kit purified pcr product;

(1.6) sequencing

After the PCR product was purified, sample presentation directly checked order;

(1.7) dna sequence data is handled and contrast

The sequential file of the dna sequencing that obtains with the DNAstar software editing carries out BLAST on NCBI, contrast close kind and analyze;

(2) result and analysis:

(2.1) sample gene group DNA extraction

With different egg oranges and tangerines sample cut growth and wide 0.5 centimetre, 0.2 centimetre of square of thickness in period, used oranges and tangerines test materials in this test, naked eyes can't tell whether have the trypetid ovum, need under stereoscopic microscope, count the ovum number, by the ovum number sample is divided into 3 grades, S1:(1-10) individual ovum/piece, S2:(10-100) individual ovum/piece, S3:(100-500) individual ovum/piece; Respectively sample is added liquid nitrogen grinding, extract genomic dna; With the testing sample classification, purpose is to survey round pcr contains the citrusfruit of different amount bactrocera dorsalis ovums in evaluation efficient; For the test agent extracting genome DNA is to carry out according to traditional plant material genome DNA extracting method, the DNA sample OD pH-value determination pH that extracts just to the mensuration of citrusfruit tissue gene group dna content and quality, is unable to estimate trypetid ovum genomic dna content and proportion;

(2.2) PCR design of primers

On NCBI, search the 18S rRNA gene fragment of citrus fruit fly, accession number is AF276516, it is the part fragment of an incomplete rDNA gene, size is 1522bp, according to this sequence, has designed two cover PCR primers, first round PCR primer amplification purpose clip size is 637bp, wherein forward primer is positioned at rDNA transcribed spacer ITS-1, and this district is a diversity region, can be in order to distinguish the relation of the sibling species that morphological method is difficult to differentiate; Reverse primer is positioned at rDNA transcribed spacer ITS-2, and same this district also is a district that variation is bigger, can be used for identifying nearly edge relation; Second to take turns PCR primer amplification purpose stripe size be 432bp, and this fragment is comprised in the first round PCR fragment; Its forward primer is positioned at 5.8S rRNA gene inside, and this is a very conservative zone, can be used to differentiate different species; The position of PCR primer in rDNA; Second takes turns the PCR reverse primer is positioned at rDNA transcribed spacer ITS-2.

The PCR method of using is used for Rapid identification fruit bactrocera dorsalis ovum

(1) bactrocera dorsalis ovum in the PCR test sample

At first with the general PCR program purpose fragment in three samples of going to increase, both the pcr amplification condition was 94 ℃ of pre-sex change 2min, moved 30 circulations altogether; Each circulation comprises: 95 ℃ of sex change 30s, and 55 ℃ of annealing 30s, 72 ℃ are extended 30s, circulate for the last time back 72 ℃ to extend 5min; The PCR product is clicked and entered 1% sepharose, electrophoresis detection result; First round PCR product size is 637bp, takes out 100 times of 2 microlitres dilutions from this PCR reaction solution, gets the template of 1 microlitre as next round PCR again from dilute sample, and second takes turns PCR product size is 432bp; The common PCR program can detect the rDNA gene fragment of citrus fruit fly in the citrusfruit, the equal works better of nested PCR primer of this test design; The citrusfruit sample that contains the different quantities bactrocera dorsalis ovum by pcr amplification trypetid rDNA fragment, all obtains very strong purpose band;

(2) PCR program optimization

In view of universal PC R program all amplifies very strong band to the bactrocera dorsalis ovum in 3 groups of fruit samples, we further optimize the PCR program, shorten PCR working time, Rapid identification purpose band to reach; The PCR cycle number is set at 5 (C1), 15 (C2), 25 (C3), the minimum sample S1 of bactrocera dorsalis ovum content is carried out PCR identify; PCR product electrophoresis result, cycle number reduce the influence of PCR product amount very big, identify that based on helping we choose cycle number 15 (C2) is discernible standard value;

(3) PCR fragment sequence contrast

Reclaim two-wheeled PCR product the sepharose behind electrophoresis respectively, directly sample presentation order-checking behind the purifying; The sequence comparative analysis finds that second takes turns PCR product GS-F in this test, and clip size is 432bp, its complete sequence and first round PCR product GB-F, and clip size is that the partial sequence of 637bp is identical, and is contained in wherein; Proof second is taken turns the specific amplified fragment that the PCR product is a first round PCR product; The two dna sequence dna contrast can determine that second takes turns the part that PCR product GS-F is first round PCR product GB-F;

The dna sequence dna of PCR product GB-F is carried out analysis of biological information, and PCR product GB-F fragment sequence is crossed over citrus fruit fly rDNA transcribed spacer ITS-1 and ITS-2; Carry out BLAST by the dna sequence dna with GB-F on NCBI, the trypetid ovum and the citrus fruit fly sibship that are detected are nearest, and sequence contrasts the two homology absolutely, therefore can determine that this tests used worm source is citrus fruit fly; The nested PCR primer that the analysis of biological information result has further proved conclusively in this test design can identify the bactrocera dorsalis ovum in the fruit sample accurately and fast.

Effect of the present invention is:

This methods and results is reliable, but rapid detection goes out the existence of bactrocera dorsalis ovum in the fruit, and determines the kind evolutionary relationship of sample through sequential analysis.

Aspect the Molecular Detection of citrus fruit fly, we select to use the rDNA molecular marker gene.The rDNA characteristics are coding region tool high conservatives of mature rna, and transcribed spacer sequence ITS (internal transcribedspacer) district is divided into two sections of ITS-1 and ITS-2 by 5.8SrRNA, and its rate of evolution is than very fast.The transcribed spacer sequence is not owing to be subjected to the influence of selective pressure, and its variation is bigger, and non-coding region has the polymorphism of height, is commonly used to distinguish the difference of the inner Different Individual of sibling species, different population of the same race or same biological group.ITS-1 and ITS-2 mainly are used to study the phylogeny of sibling species or rudimentary taxonomic category at present, are used to differentiate few hair on the neck trypetid sibling species as ITS.ITS uses one of maximum marker gene in the Molecular Phylogeny research, because ITS is of moderate size, the about 1.5kb of total length can provide enough information, is convenient to laboratory operation again; Its sequence is non-conservative in many sibling specieses, helps designing special primer and is used for sequence amplification; ITS based on rDNA also has certain conservative property, and the analytical results of its complete sequence is reliable, and consistent with traditional form deduction basically, at present biological each monoid has accumulated huge gene database in this zone.Therefore, we are by the design nested type Auele Specific Primer citrus fruit fly rDNA specific I TS fragment that increases, and reach accurately, bactrocera dorsalis ovum in the Rapid identification fruit, and determine the differentiation of itself and sibling species by the sequence contrast.

The primer characteristics of this test design are, the forward and reverse primer of first round PCR all designs in rDNA transcribed spacer ITS, can accurately identify the citrus fruit fly sibling species, and second takes turns PCR has given more accurate, reliable foundation and guarantee to detected result.

Description of drawings

Fig. 1 is a citrus fruit fly rDNA gene fragment structure iron

Fig. 2 is that PCR detects bactrocera dorsalis ovum in the citrusfruit

Fig. 3 is that different cycle number PCR detect bactrocera dorsalis ovum in the citrusfruit

Fig. 4 is PCR product GS-F and the contrast of GB-F sequence

Embodiment

The making of ITS break sequence among the one cover nested PCR amplification citrus fruit fly rDNA:

1. test materials and method:

1.1 for test agent and worm source

Oranges and tangerines are pruned diameter 3-4 centimetre, and the crust that thickness is 2 millimeters is put into incubator, and female to the citrus fruit fly of adult, male each one of the laboratory rearing of learning from else's experience is put into incubator, treats that female worm lays eggs, and gets oranges and tangerines and extracts total genomic dna.

1.2 extracting genome DNA (CTAB method)

The oranges and tangerines outer skin portion of pruning is cut out long and wide to be 0.5 centimetre, thick 0.2 centimetre square, to be used for extracting genome DNA.The extraction of DNA and quality determining method are with reference to the molecular cloning handbook.The DNA sample is put in-20 ℃ of refrigerators and preserves.Specific as follows: vegetable material liquid nitrogen freezing (the about 0.05g of each eppendorf pipe) frotton is smashed (fast) to pieces, add 500ul 2%CTAB then, mixing, more than 65 ℃ of insulation 30min, middle attention is shaken, add chloroform: primary isoamyl alcohol (24: 1) 500ul shakes mixing, 12000rpm, 10min is centrifugal, gets supernatant, add isopyknic Virahol, place more than the 30min for-20 ℃.10000rpm once more, 5min is centrifugal, abandons supernatant, wash once with 70% ethanol, 10000rpm, 5min is centrifugal, abandons supernatant, thoroughly dries, and adds 30ul TE dissolving genomic dna.

1.3 design of primers

Design of primers goes up disclosed citrus fruit fly rDNA gene order, first round PCR primer, forward primer PF-1:5 ' TGACCTAAGACATGCGCAGCTT 3 ' with reference to NCBI; Reverse primer PR-1:5 ' GGGACTTAAGGTCTAGGTCACA 3 '.

First round PCR product D NA sequence:

tgacct?aagacatgcg?cagcttgcaa?atgtttgggt

ttaaaattac?aatttattga?aagatgtgtt?ggaattttat?tttaaaaatt?tgttataaat

attattatta?ttattctttc?aataaattaa?aaactcttga?ctttgaatca?aaaaacacaa

aaaattttta?ctctaagcgg?tggatcactc?ggctcatgca?tcgatgaaga?acgcagcaaa

ctgtgcgtca?tcgtgtgaac?tgcaggacac?atgaacatcg?acattttgaa?cgcatattgc

ggtccatgct?gttatgtact?ttaattaatt?ttaaagtgct?gcttggacta?catatggttg

agggttgtaa?gactatggct?aaattagttg?cttattcttt?tagttaatta?aaagaattta

agcatatggt?atattattgg?attgtatttt?ccaatccata?atattaatag?cataaaaaga

aatatataca?atatattctt?gaatacctca?tatttgaacg?aaattttata?ataaatgaga

atcttagtat?tcccaaaata?aaaaaaaaat?ttcaatatta?tttaaaatat?atttaaataa

atacattacg?aggacagtct?agcataaaat?atattcatat?tgtgacctag?accttaagtc

cc

Second takes turns the PCR primer, forward primer PF-2:5 ' tctaagcggtggatcact 3 '; Reverse primer PR-2:5 ' tgctagactgtcctcgta 3 '.Primer is synthetic synthetic by Shanghai Ying Jun Bioisystech Co., Ltd.

Second takes turns PCR product D NA sequence:

tctaagcgg?tggatcactc?ggctcatgca?tcgatgaaga?acgcagcaaa

ctgtgcgtca?tcgtgtgaac?tgcaggacac?atgaacatcg?acattttgaa?cgcatattgc

ggtccatgct?gttatgtact?ttaattaatt?ttaaagtgct?gcttggacta?catatggttg

agggttgtaa?gactatggct?aaattagttg?cttattcttt?tagttaatta?aaagaattta

agcatatggt?atattattgg?attgtatttt?ccaatccata?atattaatag?cataaaaaga

aatatataca?atatattctt?gaatacctca?tatttgaacg?aaattttata?ataaatgaga

atcttagtat?tcccaaaata?aaaaaaaaat?ttcaatatta?tttaaaatat?atttaaataa

atacattacg?aggacagtct?agca

1.4PCR the optimization of reaction system and reaction conditions

The amplification volume of PCR reaction is 20 μ L, comprises 1 * PCR damping fluid, 2mmol/L Mg ²⁺, 0.2mmol/L dNTP, each 0.2 μ mol/L of forward and reverse primer, 1U Taq enzyme (Takara), template DNA 20～40ng.The pcr amplification general conditions is 94 ℃ of pre-sex change 2min, moves 30 circulations altogether.Each circulation comprises: 95 ℃ of sex change 30s, and 55 ℃ of annealing 30s, 72 ℃ are extended 30s, circulate for the last time back 72 ℃ to extend 5min.Sample carries out the purpose fragment amplification on Biosystem Gene Amp PCR System 9700 instruments.The PCR product is the electrophoresis detection expanding effect on 1% agar gel.

1.5PCR product purification reclaims

PCR product QIAquick PCR Purification test kit (Germany, QIAGEN) purified pcr product.Concrete operations are undertaken by the product guide handbook.

1.6 sequencing

After the PCR product was purified, sample presentation directly checked order, and sequencing reaction all carries out in Shanghai Mei Ji Bioisystech Co., Ltd.

1.7DNA sequence data is handled and contrast

The sequential file of the dna sequencing that obtains with the DNAstar software editing carries out BLAST on NCBI, contrast close kind and analyze.

2. result and analysis:

2.1 sample gene group DNA extraction

With different egg oranges and tangerines sample cut growth and wide 0.5 centimetre, 0.2 centimetre of square of thickness in period, used oranges and tangerines test materials in this test, naked eyes can't tell whether have the trypetid ovum, need under stereoscopic microscope, count the ovum number, by the ovum number sample is divided into 3 grades, S1:(1-10) individual ovum/piece, S2:(10-100) individual ovum/piece, S3:(100-500) individual ovum/piece.Respectively sample is added liquid nitrogen grinding, extract genomic dna.With the testing sample classification, purpose is to survey round pcr contains the citrusfruit of different amount bactrocera dorsalis ovums in evaluation efficient.For the test agent extracting genome DNA is to carry out according to traditional plant material genome DNA extracting method, the DNA sample OD pH-value determination pH that extracts just to the mensuration of citrusfruit tissue gene group dna content and quality, is unable to estimate trypetid ovum genomic dna content and proportion.

2.2PCR design of primers

On NCBI, search the 18S rRNA gene fragment of citrus fruit fly, accession number is AF276516, it is the part fragment of an incomplete rDNA gene, size is 1522bp, according to this sequence, has designed two cover PCR primers, first round PCR primer amplification purpose clip size is 637bp, wherein forward primer is positioned at rDNA transcribed spacer ITS-1, and this district is a diversity region, can be in order to distinguish the relation of the sibling species that morphological method is difficult to differentiate.Reverse primer is positioned at rDNA transcribed spacer ITS-2, and same this district also is a district that variation is bigger, can be used for identifying nearly edge relation.Second to take turns PCR primer amplification purpose stripe size be 432bp, and this fragment is comprised in the first round PCR fragment.Its forward primer is positioned at 5.8S rRNA gene inside, and this is a very conservative zone, can be used to differentiate different species.The position of PCR primer in rDNA seen shown in Figure 1.Second takes turns the PCR reverse primer is positioned at rDNA transcribed spacer ITS-2.The primer characteristics of this test design are, the forward and reverse primer of first round PCR all designs in rDNA transcribed spacer ITS, can accurately identify the citrus fruit fly sibling species, and second takes turns PCR has given more accurate, reliable foundation and guarantee to detected result.

With reference to figure 1. citrus fruit fly rDNA gene fragment structure iron

Figure1.The?construction?of?rDNA?of?Bactrocera?dorsalis(Hendel)

2.3PCR bactrocera dorsalis ovum in the test sample

At first with the general PCR program purpose fragment in three samples of going to increase, both the pcr amplification condition was 94 ℃ of pre-sex change 2min, moved 30 circulations altogether.Each circulation comprises: 95 ℃ of sex change 30s, and 55 ℃ of annealing 30s, 72 ℃ are extended 30s, circulate for the last time back 72 ℃ to extend 5min.The PCR product is clicked and entered 1% sepharose, and electrophoresis detection the results are shown in Figure 2.First round PCR product size is 637bp, takes out 100 times of 2 microlitres dilutions from this PCR reaction solution, gets the template of 1 microlitre as next round PCR again from dilute sample, and second takes turns PCR product size is 432bp.As can be seen from Figure 12, the common PCR program can detect the rDNA gene fragment of citrus fruit fly in the citrusfruit, the equal works better of nested PCR primer of this test design.As can see from Figure 2, contain the citrusfruit sample of different bactrocera dorsalis ovums,, all obtain very strong purpose band by pcr amplification trypetid rDNA fragment.

Detect bactrocera dorsalis ovum in the citrusfruit with reference to figure 2.PCR

Figure2.Identification?of?eggs?of?Bactrocera?dorsalis(Hendel)withPCR

2.4PCR program optimization

In view of universal PC R program all amplifies very strong band to the bactrocera dorsalis ovum in 3 groups of fruit samples, we further optimize the PCR program, shorten PCR working time, Rapid identification purpose band to reach.The PCR cycle number is set at 5 (C1), 15 (C2), 25 (C3), the minimum sample S1 of bactrocera dorsalis ovum content is carried out PCR identify.PCR product electrophoresis result is seen Fig. 3.As seen from Figure 3, cycle number reduces the influence of PCR product amount very big, identifies that based on helping we choose cycle number 15 (C2) is discernible standard value.

Detect bactrocera dorsalis ovum in the citrusfruit with reference to figure 3. different cycle number PCR

Figure3.The?amplification?of?ITS?fragments?with?different?PCR?program

2.5PCR fragment sequence contrast

Reclaim two-wheeled PCR product the sepharose behind electrophoresis respectively, directly sample presentation order-checking behind the purifying.The sequence comparative analysis finds that second takes turns PCR product GS-F in this test, and clip size is 432bp, its complete sequence and first round PCR product GB-F, and clip size is that the partial sequence of 637bp is identical, and is contained in wherein.Proof second is taken turns the specific amplified fragment that the PCR product is a first round PCR product.The two dna sequence dna comparing result is seen Fig. 4, by determining among the figure that second takes turns the part that PCR product GS-F is first round PCR product GB-F.

With reference to figure 4.PCR product GS-F and the contrast of GB-F sequence

Figure4.The?alignment?of?PCR?products?GS-F?and?GS-F

The dna sequence dna of PCR product GB-F is carried out analysis of biological information, and PCR product GB-F fragment sequence is crossed over citrus fruit fly rDNA transcribed spacer ITS-1 and ITS-2.Carry out BLAST by the dna sequence dna with GB-F on NCBI, the trypetid ovum and the citrus fruit fly sibship that are detected are nearest, and sequence contrasts the two homology absolutely, therefore can determine that this tests used worm source is citrus fruit fly.The nested PCR primer that the analysis of biological information result has further proved conclusively in this test design can identify the bactrocera dorsalis ovum in the fruit sample accurately and fast.

Conclusion:

Citrus fruit fly Bactrocera dorsalis (Hendel) is one of important quarantine insect of the harm torrid zone, subtropical fruit.The trypetid kind identifies to be appraisal basis with the adult morphological specificity mainly, though the morphology authentication method is simple, directly perceived, requires the assessor to have rich experience.In the port quarantine process, intercept and capture insect larva or ovum usually but not adult, ordinary method is larva or ovum to be cultivated adult identify that more whole quarantine qualification process reaches several weeks sometimes.At present, utilize Protocols in Molecular Biology that the sibling species of insect the method for identifying of classifying is used more and more widely.For the identification of morphology method, its maximum advantage is exactly the restriction that is not subjected to insect worm attitude, even incomplete polypide also can be identified.

Because biological gene group quantity is quite huge, can't carry out comprehensive sequential analysis, need carry out primary study at individual characteristics gene fragment in the genome.Therefore selecting suitable molecule marker fragment is the key point that molecular detecting method is set up.The marker gene kind that Molecular Detection is selected is a lot, present Mitochondrial DNA (Mitochondrial DNA, mtDNA), rDNA (Ribosomal DNA, rDNA), satellite DNA (Satel.lites Df), microsatellite DNA (MicrosateUites DNA) and nucleoprotein encoding gene characterizing genes such as (Nuclear proteincoding genes) be widely used in the classification evaluation and phylogeny research of insect as molecule marker, wherein a plurality of marker gene are most widely used in the molecular system research of insect among rDNA and the mtDNA ^[9-15]RDNA is the sequence in the nuclear gene group, has diversity region and conserved regions simultaneously, can reflect early stage and recent evolutionary relationship, utilizes its conserved regions to study senior taxonomic category relation.MtDNA belongs to the organelle gene group, lacks the protection mechanism in the cell nucleus gene group, thereby variation is comparatively obvious, can reflect the evolution incident in the short period, is widely used in species and plants the discriminating of relation down.

Aspect the Molecular Detection of citrus fruit fly, we select to use the rDNA molecular marker gene.The rDNA characteristics are coding region tool high conservatives of mature rna, and transcribed spacer sequence ITS (internal transcribedspacer) district is divided into two sections of ITS-1 and ITS-2 by 5.8SrRNA, and its rate of evolution is than very fast.The transcribed spacer sequence is not owing to be subjected to the influence of selective pressure, and its variation is bigger, and non-coding region has the polymorphism of height, is commonly used to distinguish the difference of the inner Different Individual of sibling species, different population of the same race or same biological group.ITS-1 and ITS-2 mainly are used to study the phylogeny of sibling species or rudimentary taxonomic category at present, are used to differentiate few hair on the neck trypetid sibling species as ITS.ITS uses one of maximum marker gene in the Molecular Phylogeny research, because ITS is of moderate size, the about 1.5kb of total length can provide enough information, is convenient to laboratory operation again; Its sequence is non-conservative in many sibling specieses, helps designing special primer and is used for sequence amplification; ITS based on rDNA also has certain conservative property, and the analytical results of its complete sequence is reliable, and consistent with traditional form deduction basically, at present biological each monoid has accumulated huge gene database in this zone.Therefore, we are by the design nested type Auele Specific Primer citrus fruit fly rDNA specific I TS fragment that increases, and reach accurately, bactrocera dorsalis ovum in the Rapid identification fruit, and determine the differentiation of itself and sibling species by the sequence contrast.

?

?

patent?sup725.WorkFile

Organization?Applicant

----------------------

Street: No. 2901, northern Zhai Lu

City: Shanghai

State：

Country: China

PostalCode：201106

PhoneNumber：021-62201002

FaxNumber：021-37195193

EmailAddress：qiuliank@yahoo.com.cn

＜110〉OrganizationName: Academy of Agricultural Sciences, Shanghai City

Application?Project

-------------------

＜120〉Title: the method for ITS break sequence among the nested PCR amplification citrus fruit fly rDNA

<130>AppFileReference：XQ12026977011

<140>CurrentAppNumber：2009102289725

<141>CurrentFilingDate：2009-12-07

Sequence

--------

＜213〉OrganismName: citrus fruit fly (Bactrocera dorsalis (Hendel))

<400>PreSequenceString：

gcggatgacg?tgctggattt?tattttaaaa?atttgttata?aatattatta?ttattattct 60

ttcaataaat?taaaaactct?tgactttgaa?tcaaaaaaca?caaaaaattt?ttactctaag 120

cggtggatca?ctcggctcat?gggtcgatga?agaacgcagc?aaactgtgcg?tcatcgtgtg 180

aactgcagga?cacatgaaca?tcgacatttt?gaacgcatat?tgcggtccat?gctgttatgt 240

actttaatta?attttaaagt?gctgcttgga?ctacatatgg?ttgagggttg?taagactatg 300

ctaaattagt?tgcttattct?tttagttaat?taaaagaatt?taagcatatg?gtatattatt 360

ggattgtatt?ttccaatcca?taatattaat?agcataaaaa?gaaatatata?caatatattc 420

ttgaatacct?catatttgaa?cgaaatttta?taataaatga?gaatcttagt?attcccaaaa 480

taaaaaaaaa?atttcaatat?tatttaaaat?atatttaaat?aaatacatta?cgaggacagt 540

ctagcataaa?atatattcat?attgtgacct?agaccttaac?tccaca 586

<212>Type：DNA

<211>Length：586

SequenceName：1

SequenceDescription：

Feature

-------

Sequence：1：

<221>FeatureKey：GB-F

<222>LocationFrom：1

<222>LocationTo：586

Other Information: first round PCR product order-checking

CDSJoin：No

Sequence

--------

＜213〉OrganismName: citrus fruit fly (Bactrocera dorsalis (Hendel))

<400>PreSequenceString：

aactgtgcgt?catcgtgtga?actgcaggac?acatgaacat?cgacattttg?aacgcatatt 60

gcggtccatg?ctgttatgta?ctttaattaa?ttttaaagtg?ctgcttggac?tacatatggt 120

tgagggttgt?aagactatgc?taaattagtt?gcttattctt?ttagttaatt?aaaagaattt 180

aagcatatgg?tatattattg?gattgtattt?tccaatccat?aatattaata?gcataaaaag 240

aaatatatac?aatatattct?tgaatacctc?atatttgaac?gaaattttat?aataaatgag 300

aatcttagta?ttcccaaaat?aaaaaaaaaa?tttcaatatt?atttaaaata?tatttaaata 360

aatacattac?gaggacagtc?tagcata 387

<212>Type：DNA

<211>Length：387

SequenceName：2

SequenceDescription：

Feature

-------

Sequence：2：

<221>FeatureKey：GS-F

<222>LocationFrom：1

<222>LocationTo：387

Other Information: second takes turns the order-checking of PCR product

CDSJoin：No

Sequence

--------

＜213〉OrganismName: artificial sequence

<400>PreSequenceString：

tgacctaaga?catgcgcagc?tt 22

<212>Type：DNA

<211>Length：22

SequenceName：3

SequenceDescription：

Feature

-------

Sequence：3：

<221>FeatureKey：PF-1

<222>LocationFrom：1

<222>LocationTo：22

Other Information: first round PCR forward primer

CDSJoin：No

Sequence

---------

＜213〉OrganismName: artificial sequence

<400>PreSequenceString：

gggacttaag?gtctaggtca?ca 22

<212>Type：DNA

<211>Length：22

SequenceName：4

SequenceDescription：

Feature

-------

Sequence：4：

<221>FeatureKey：PR-1

<222>LocationFrom：1

<222>LocationTo：22

Other Information: first round PCR reverse primer

CDSJoin：No

Sequence

--------

＜213〉OrganismName: artificial sequence

<400>PreSequenceString：

tctaagcggt?ggatcact 18

<212>Type：DNA

<211>Length：18

SequenceName：5

SequenceDescription：

Feature

-------

Sequence：5：

<221>FeatureKey：PF-2

<222>LocationFrom：1

<222>LocationTo：18

Other Information: second takes turns the PCR forward primer

CDSJoin：No

Sequence

--------

＜213〉OrganismName: artificial sequence

<400>PreSequenceString：

tgctagactg?tcctcgta 18

<212>Type：DNA

<211>Length：18

SequenceName：6

SequenceDescription：

Feature

-------

Sequence：6：

<221>FeatureKey：PR-2

<222>LocationFrom：1

<222>LocationTo：18

Other Information: second takes turns the PCR reverse primer

CDSJoin：No

Sequence

--------

＜213〉OrganismName: citrus fruit fly (Bactrocero dorsalis (Hendel))

<400>PreSequenceString：

tgacctaaga?catgcgcagc?ttgcaaatgt?ttgggtttaa?aattacaatt?tattgaaaga 60

tgtgttggaa?ttttatttta?aaaatttgtt?ataaatatta?ttattattat?tctttcaata 120

aattaaaaac?tcttgacttt?gaatcaaaaa?acacaaaaaa?tttttactct?aagcggtgga 180

tcactcggct?catgcatcga?tgaagaacgc?agcaaactgt?gcgtcatcgt?gtgaactgca 240

ggacacatga?acatcgacat?tttgaacgca?tattgcggtc?catgctgtta?tgtactttaa 300

ttaattttaa?agtgctgctt?ggactacata?tggttgaggg?ttgtaagact?atggctaaat 360

tagttgctta?ttcttttagt?taattaaaag?aatttaagca?tatggtatat?tattggattg 420

tattttccaa?tccataatat?taatagcata?aaaagaaata?tatacaatat?attcttgaat 480

acctcatatt?tgaacgaaat?tttataataa?atgagaatct?tagtattccc?aaaataaaaa 540

aaaaatttca?atattattta?aaatatattt?aaataaatac?attacgagga?cagtctagca 600

taaaatatat?tcatattgtg?acctagacct?taagtccc 638

<212>Type：DNA

<211>Length：638

SequenceName：7

SequenceDescription：

Feature

-------

Sequence：7：

＜221〉FeatureKey: first round PCR product contrasts sequence on the net

<222>LocationFrom：1

<222>LocationTo：638

Other Information: this sequence is from online openly sequence, for design PCR primer is done reference.

CDSJoin：No

Datebase

--------

Sequence：7：

<308>DBAccessionNumber：AF276516

<309>DBEntryDate：2001-07-02

<313>From：1

<313>To：638

Sequence

--------

＜213〉OrganismName: citrus fruit fly (Bactrocero dorsalis (Hendel))

<400>PreSequenceString：

tctaagcggt?ggatcactcg?gctcatgcat?cgatgaagaa?cgcagcaaac?tgtgcgtcat 60

cgtgtgaact?gcaggacaca?tgaacatcga?cattttgaac?gcatattgcg?gtccatgctg 120

ttatgtactt?taattaattt?taaagtgctg?cttggactac?atatggttga?gggttgtaag 180

actatggcta?aattagttgc?ttattctttt?agttaattaa?aagaatttaa?gcatatggta 240

tattattgga?ttgtattttc?caatccataa?tattaatagc?ataaaaagaa?atatatacaa 300

tatattcttg?aatacctcat?atttgaacga?aattttataa?taaatgagaa?tcttagtatt 360

cccaaaataa?aaaaaaaatt?tcaatattat?ttaaaatata?tttaaataaa?tacattacga 420

ggacagtcta?gca 433

<212>Type：DNA

<211>Length：433

SequenceName：8

SequenceDescription：

Feature

-------

Sequence：8：

＜221〉FeatureKey: second takes turns the PCR product contrasts sequence on the net

<222>LocationFrom：1

<222>LocationTo：433

Other Information: this sequence is from online openly sequence, for design PCR primer is done reference.

CDSJoin：No

Datebase

--------

Sequence：8：

<308>DBAccessionNumber：AF276516

<309>DBEntryDate：2001-07-02

<313>From：1

<313>To：433

 

Claims (1)

1. ITS break sequence method among the nested PCR amplification citrus fruit fly rDNA:

(1) test materials and method:

(1.1) for test agent and worm source

Oranges and tangerines are pruned diameter 3-4 centimetre, and the crust that thickness is 2 millimeters is put into incubator, and female to the citrus fruit fly of adult, male each one of the laboratory rearing of learning from else's experience is put into incubator, treats that female worm lays eggs, and gets oranges and tangerines and extracts total genomic dna;

(1.2) extracting genome DNA--CTAB method

The oranges and tangerines outer skin portion of pruning is cut out long and wide to be 0.5 centimetre, thick 0.2 centimetre square, to be used for extracting genome DNA; The extraction of DNA and quality determining method are with reference to the molecular cloning handbook; The DNA sample is put in-20 ℃ of refrigerators and preserves; Specific as follows: the about 0.05g--frotton of vegetable material liquid nitrogen freezing one each eppendorf pipe is smashed (fast) to pieces, add 500ul 2%CTAB then, mixing, more than 65 ℃ of insulation 30min, middle attention is shaken, add chloroform: primary isoamyl alcohol---24: 1500ul shakes mixing, 12000rpm, 10min is centrifugal, gets supernatant, add isopyknic Virahol, place more than the 30min for-20 ℃; 10000rpm once more, 5min is centrifugal, abandons supernatant, wash once with 70% ethanol, 10000rpm, 5min is centrifugal, abandons supernatant, thoroughly dries, and adds 30ul TE dissolving genomic dna;

(1.3) design of primers

Design of primers goes up disclosed citrus fruit fly rDNA gene order, first round PCR primer, forward primer PF-1:5 ' TGACCTAAGACATGCGCAGCTT 3 ' with reference to NCBI; Reverse primer PR-1:5 ' GGGACTTAAGGTCTAGGTCACA 3 ';

First round PCR product D NA sequence:

tgacct?aagacatgcg?cagcttgcaa?atgtttgggt

ttaaaattac?aatttattga?aagatgtgtt?ggaattttat?tttaaaaatt?tgttataaat

attattatta?ttattctttc?aataaattaa?aaactcttga?ctttgaatca?aaaaacacaa

aaaattttta?ctctaagcgg?tggatcactc?ggctcatgca?tcgatgaaga?acgcagcaaa

ctgtgcgtca?tcgtgtgaac?tgcaggacac?atgaacatcg?acattttgaa?cgcatattgc

ggtccatgct?gttatgtact?ttaattaatt?ttaaagtgct?gcttggacta?catatggttg

agggttgtaa?gactatggct?aaattagttg?cttattcttt?tagttaatta?aaagaattta

agcatatggt?atattattgg?attgtatttt?ccaatccata?atattaatag?cataaaaaga

aatatataca?atatattctt?gaatacctca?tatttgaacg?aaattttata?ataaatgaga

atcttagtat?tcccaaaata?aaaaaaaaat?ttcaatatta?tttaaaatat?atttaaataa

atacattacg?aggacagtct?agcataaaat?atattcatat?tgtgacctag?accttaagtc

cc

Second takes turns the PCR primer, forward primer PF-2:5 ' tctaagcggtggatcact 3 '; Reverse primer PR-2:5 ' tgctagactgtcctcgta 3 '; Primer is synthetic synthetic by Shanghai Ying Jun Bioisystech Co., Ltd;

Second takes turns PCR product D NA sequence:

tctaagcgg tggatcactc?ggctcatgca?tcgatgaaga?acgcagcaaa

ctgtgcgtca?tcgtgtgaac?tgcaggacac?atgaacatcg?acattttgaa?cgcatattgc

ggtccatgct?gttatgtact?ttaattaatt?ttaaagtgct?gcttggacta?catatggttg

agggttgtaa?gactatggct?aaattagttg?cttattcttt?tagttaatta?aaagaattta

agcatatggt?atattattgg?attgtatttt?ccaatccata?atattaatag?cataaaaaga

aatatataca?atatattctt?gaatacctca?tatttgaacg?aaattttata?ataaatgaga

atcttagtat?tcccaaaata?aaaaaaaaat?ttcaatatta?tttaaaatat?atttaaataa

atacattacg?aggacagtct?agca

(1.4) optimization of PCR reaction system and reaction conditions

The amplification volume of PCR reaction is 20 μ L, comprises 1 * PCR damping fluid, 2mmol/L Mg ²⁺, 0.2mmol/L dNTP, each 0.2 μ mol/L of forward and reverse primer, 1U Taq enzyme (Takara), template DNA 20～40ng; The pcr amplification general conditions is 94 ℃ of pre-sex change 2min, moves 30 circulations altogether; Each circulation comprises: 95 ℃ of sex change 30s, and 55 ℃ of annealing 30s, 72 ℃ are extended 30s, circulate for the last time back 72 ℃ to extend 5min; Sample carries out the purpose fragment amplification on Biosystem Gene Amp PCR System 9700 instruments; The PCR product is the electrophoresis detection expanding effect on 1% agar gel;

(1.5) the PCR product purification reclaims

PCR product QIAquick PCR Purification Germany, QIAGEN test kit purified pcr product;

(1.6) sequencing

After the PCR product was purified, sample presentation directly checked order;

(1.7) dna sequence data is handled and contrast

The sequential file of the dna sequencing that obtains with the DNAstar software editing carries out BLAST on NCBI, contrast close kind and analyze;

(2) result and analysis:

(2.1) sample gene group DNA extraction

With different egg oranges and tangerines sample cut growth and wide 0.5 centimetre, 0.2 centimetre of square of thickness in period, used oranges and tangerines test materials in this test, naked eyes can't tell whether have the trypetid ovum, need under stereoscopic microscope, count the ovum number, by the ovum number sample is divided into 3 grades, S1:1-10 ovum/piece, S2:10-100 ovum/piece, S3:100-500 ovum/piece; Respectively sample is added liquid nitrogen grinding, extract genomic dna; With the testing sample classification, purpose is to survey round pcr contains the citrusfruit of different amount bactrocera dorsalis ovums in evaluation efficient; For the test agent extracting genome DNA is to carry out according to traditional plant material genome DNA extracting method, the DNA sample OD pH-value determination pH that extracts just to the mensuration of citrusfruit tissue gene group dna content and quality, is unable to estimate trypetid ovum genomic dna content and proportion;

(2.2) PCR design of primers

On NCBI, search the 18S rRNA gene fragment of citrus fruit fly, accession number is AF276516, it is the part fragment of an incomplete rDNA gene, size is 1522bp, according to this sequence, has designed two cover PCR primers, first round PCR primer amplification purpose clip size is 637bp, wherein forward primer is positioned at rDNA transcribed spacer ITS-1, and this district is a diversity region, can be in order to distinguish the relation of the sibling species that morphological method is difficult to differentiate; Reverse primer is positioned at rDNA transcribed spacer ITS-2, and same this district also is a district that variation is bigger, can be used for identifying nearly edge relation; Second to take turns PCR primer amplification purpose stripe size be 432bp, and this fragment is comprised in the first round PCR fragment; Its forward primer is positioned at 5.8S rRNA gene inside, and this is a very conservative zone, can be used to differentiate different species; The position of PCR primer in rDNA; Second takes turns the PCR reverse primer is positioned at rDNA transcribed spacer ITS-2.

Images