CN101775392A

CN101775392A - Construction of siRNA recombinants 188 by aiming at CDK2 genes and application

Info

Publication number: CN101775392A
Application number: CN200810209710A
Authority: CN
Inventors: 于英君; 宋高臣; 李娜; 李和伟; 于水澜; 李玲; 赵阳
Original assignee: Individual
Current assignee: Individual
Priority date: 2008-12-16
Filing date: 2008-12-16
Publication date: 2010-07-14

Abstract

The invention relates to construction of siRNA recombinants 188 by aiming at CDK2 genes and application. The invention discloses the construction of RNAi recombinant plasmids pGPU6/GFP/Neo-siRNA188 by aiming at the CDK2 genes and the effect of the RNAi recombinant plasmids pGPU6/GFP/Neo-siRNA188 on the inhabitation of the hepatoma carcinoma cell proliferation. An RNAi technical principle is utilized for designing siRNA188 using CDK2 as target genes, template DNA capable of transcribing shRNA is designed and synthesized, the template DNA is directionally cloned to eukaryotic expression vectors pGPU6/GFP/Neo, the digestion identification and DNA sequence checking technology is used for sieving, and the recombinant plasmids pGPU6/GFP/Neo-siRNA188 are successfully constructed. The recombinant plasmids can obviously inhabit the expression of the CDK2 genes in hepatoma carcinoma cells, and are used for preparing novel antitumor biological preparations and antitumor gene medicine.

Description

Structure and purposes at CDK2 gene siRNA recombinant chou 188

Technical field

The invention belongs to biological technical field, relate to a kind of RNAi construction of recombinant plasmid and the application in therapy of tumor thereof.

Background technology

It is a kind of novel method that suppresses expression of target gene that grew up in recent years that RNA disturbs (RNA interference is called for short RNAi) technology, and it is considered to all ubiquitous a kind of physiological mechanism of defending exogenous nucleic acid to invade and harass from the unicellular lower eukaryote to the higher organism.RNAi be by small molecules double-stranded RNA specificity complementary target to gene transcripts, thereby a kind of technology of induced gene post-transcriptional silencing.Transcribe the little double-stranded RNA (siRNA) or hair clip type RNA (the short hairpin RNA of generation in synthetic or the cell, shRNA) enter cell after, energy and complementary target gene mRNA combination with it, thereby mediate specific nickase mRNA is degraded, reach the purpose that reduces destination gene expression.

The RNAi technology has been widely used in the research field of gene function, signal transduction pathway method and therapy of tumor at present.It is compared with traditional gene therapy method such as gene substitution, antisense strategy, cytokine gene treatment on therapy of tumor, has the characteristics special, efficient, that toxicity is little, therefore can be used to some tumours are treated.

The generation of tumour is the result of forfeiture cell function regulation and control.Unusual and the cell cycle regulating of growth signals will cause unusually cell proliferation unusually, finally produce malignant clone.Progress shows: the biological property of tumour general character is property out of control growth, its main molecules mechanism be the cell cycle disorder cause cell proliferation too much and apoptosis very few.Therefore, we can say that tumour is the class cell cycle property disease due to the growth of cell property out of control.CDK2 is the core element of cell cycle regulating, and under the normal circumstances, CDK2 keeps very constant level in the whole cell cycle, but under the adjusting of cyclin, its activity can change.If cyclin continued the arrestin down-regulated expression of expression or CDK2, CDK2 is in the high reactivity state all the time in the cell cycle, and the cell cycle is in runaway condition, and then cell is with regard to infinite multiplication generation canceration.

The above-mentioned research of gene, we are at the corresponding sequence of CDK2 gene design, be connected on the plasmid vector, make up the siRNA recombinant expression plasmid, it is imported in the liver cancer cell, under the effect of U6 promotor, transcribe and produce shRNA, induce RNAi by these shRNA, thereby suppress the overexpression of CDK2 gene specifically.Therefore, the RNAi recombinant plasmid can be used for preparing new antineoplastic biologic preparation and Antioncogene medicine.

Summary of the invention

The object of the present invention is to provide at CDK2 gene RNAi recombinant plasmid pGPU6/GFP/Neo-siRNA 188 and preparation method, for therapy of tumor provides New Policy.

Another object of the present invention provides new antineoplastic biologic preparation and Antioncogene medicine.

The present invention selectes CDK2 gene action oncotherapy target spot, according to the sequence of human liver cancer cell CDK2 gene (GenBank Accession Number:NM_001798), (sequence is: 5`GGCAGCCCTGGCTCACCCT 3`) by the online design software design of network online tool (http://www.invitrogen.com/nupage) siRNA188.And make up the dsDNA that contains interference fragment, and send biotech firm synthetic, the annealing rear clone is gone into plasmid (pGPU6/GFP/Neo), and cuts evaluation with enzyme and carry out the Screening and Identification recombinant plasmid with the dna sequencing technology; By liposome transfection to liver cancer cell, under the effect of U6 promotor, transcribe and produce short hairpin RNA (short hairpin RNA, shRNA), induce RNAi by these shRNA, detect the inhibition degree of recombinant plasmid of disturbing through real-time quantitative PCR and Western blot, for exploitation becomes new antineoplastic biologic preparation and the Antioncogene medicine provides experimental basis to CDK2 gene mRNA and protein level.

Description of drawings

Fig. 1 pGPU6/GFP/Neo plasmid map

Fig. 2 pGPU6/GFP/Neo-siRNA188 sequencing result

The detection of the luciferase expression of liver cancer cell behind Fig. 3 stable transfection

Fig. 4 real-time quantitative PCR amplification curve

Embodiment

Below the present invention is further illustrated by specific embodiment, and following example only is used to illustrate the present invention, and be not used in the scope of the present invention that limits.

Embodiment one: the design of interference sequence

According to the sequence of human liver cancer cell CDK2 gene (GenBank Accession Number:NM_001798), (sequence is: 5`GGCAGCCCTGGCTCACCCT 3`) by the online design software design of network online tool (http://www.invitrogen.com/nupage) siRNA188; Design one group of irrelevant sequence again as negative control.

Embodiment two: construction of recombinant plasmid

Make up the Oligo strand, link Loop ring between justice and antisense strand, on the basic structure basis, add the restriction enzyme site sequence and the transcription termination sequence of Bam H I restriction endonuclease and Bbs I restriction endonuclease then, form the dna fragmentation that coding suppresses the siRNA188 of CDK2 genetic expression specifically:

5`CACCGGCAGCCCTGGCTCACCCT TTCAAGAGAAGGGTGAGCCAGGGCTGCC TTTTTTG3`

5`GATCCAAAAAAGGCAGCCCTGGCTCACCCT TCTCTTGAAAGGGTGAGCCAGGGCTGCC3`

After serving Hai Shenggong company synthetic then, two chain annealing are linked to be two strands.With Bam H I restriction endonuclease and Bbs I enzymes double zyme cutting plasmid pGPU6/GFP/Neo (plasmid map such as Fig. 1), then double-stranded DNA is cloned into plasmid pGPU6/GFP/Neo, be converted into intestinal bacteria, identify transformed bacteria with enzyme cutting method after the extracting, the positive recombinant clone that scalping is possible also carries out dna sequencing and identifies (order-checking collection of illustrative plates such as Fig. 2), is specially 249 to 306 (58 bases).

Embodiment three: transfection hepatoma cell strain SMMC7721

Lipofectamine reagent (the Lipofectamine of Invitrogen company is adopted in this experiment ^TM2000 transfection reagent boxes) transfection hepatoma cell strain.Through groping of transfection conditions repeatedly, find optimal conditions.Fluorescence inverted microscope film making observation behind 24h, the 48h has stronger green fluorescence (detection of the luciferase expression of liver cancer cell such as Fig. 3 behind the stable transfection) after the transfection in the visual field, and promptly proof has the expression of green fluorescent protein.Select 5 cellular regions visuals field (200 *) at random, counting green fluorescence cell count and total cell count, calculate green fluorescence cell incidence (being transfection efficiency) by following formula:

Green fluorescence cell incidence=(green fluorescence cell count/total cell count) * 100%

48h records transfection efficiency and reaches more than 90% behind the transfection SMMC7721.

Embodiment four: the quantitative PCR detection recombinant plasmid is to the influence of CDK2 gene mRNA level

Getting liver cancer cell normally cultivates, when respectively transfection recombinant plasmid pGPU6/GFP/Neo-siRNA188 and pGPU6/GFP/Neo-NC (negative control) 48h treat that cell converges rate and reaches 80-90%, total RNA extracts with the Trizol method, and gained RNA is dissolved in the ddH that DEPC handles ₂Among the O.The primer is used Primer Premier 5.0 softwares and is carried out design of primers according to CDK2mRNA and GAPDH mRNA complete genome sequence, and it is synthetic to serve Hai Shenggong.Reverse transcription reaction obtains template cDNA, carry out Real-time PCR reaction, adopt the relative quantification method, the CDK2 gene changes (real-time quantitative PCR amplification curve such as Fig. 4) with respect to the expression of GAPDH internal control gene in the SMMC7721 liver cancer cell behind the analysis transfection siRNA expression vector.Behind the pcr amplification, setting threshold line (threshold) is 0.2, gathers corresponding C _TValue (Thresholdcycle) is then according to 2 ^{-Δ Δ CT}Method is carried out analyzing and processing to data, and the gained data are carried out the homogenization processing to internal control gene GAPDH, obtain the changes in gene expression of sample sets with respect to negative control group then.Found that recombinant plasmid pGPU6/GFP/Neo-siRNA188 can significantly suppress liver cancer cell CDK2 gene mRNA expression, suppressing efficient is 31%.

Claims

1. one kind is the siRNA188 of target gene with CDK2, it is characterized in that its base sequence is: 5`GGCAGCCCTGGCTCACCCT 3`.

2. according to the described siRNA of claim 1, it is characterized in that it is prepared as in the construction recombination plasmid pGPU6/GFP/Neo-siRNA188 body and transcribes generation.

3. according to the described preparation method of claim 2, it is characterized in that used plasmid comprises: the carrier pGPU6/GFP/Neo that contains III type RNA polymerase and eucaryon U6 promotor; Coding suppresses the dna fragmentation of the siRNA188 of CDK2 genetic expression specifically.

4. coding according to claim 3 suppresses the dna fragmentation of the siRNA188 of CDK2 genetic expression specifically, it is characterized in that, its base sequence is:

5`CACCGGCAGCCCTGGCTCACCCT TTCAAGAGAAGGGTGAGCCAGGGCTGCC TTTTTTG3`

5`GATCCAAAAAAGGCAGCCCTGGCTCACCCT TCTCTTGAAAGGGTGAGCCAGGGCTGCC3`

5. according to the described recombinant plasmid pGPU6/GFP/Neo-siRNA188 of claim 2, it is characterized in that it can significantly suppress CDK2 expression of gene in the liver cancer cell, can be used for preparing new antineoplastic biologic preparation and Antioncogene medicine.