CN101748110B - Desmoteplase alpha 1 mutant - Google Patents
Desmoteplase alpha 1 mutant Download PDFInfo
- Publication number
- CN101748110B CN101748110B CN2008102377098A CN200810237709A CN101748110B CN 101748110 B CN101748110 B CN 101748110B CN 2008102377098 A CN2008102377098 A CN 2008102377098A CN 200810237709 A CN200810237709 A CN 200810237709A CN 101748110 B CN101748110 B CN 101748110B
- Authority
- CN
- China
- Prior art keywords
- alpha
- dspa
- desmoteplase
- dsma
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a desmoteplase alpha 1 mutant which is used for changing 195 bits of amino acid in a wild type DSPA alpha 1 activated loop region, replacing 195 bits of phenylalanine in a wild type DSPA alpha 1 peptide chain into valine and nominating the valine into DSMa or continuously changing 210-213 bits of amino acid based on the DSMa, replacing the four 210-213 bits of amino acid like glutamic acid, aspartic acid, arginine and arginine in the peptide chain into four alanine and nominating the four alanine into DSMb, wherein a nucleotide sequence and an amino acid sequence of the DSMa are shown as shown in SEQID NO. 1 and SEQID NO. 2; and a nucleotide sequence and an amino acid sequence of the DSMb are shown as shown in SEQID NO. 3 and SEQID NO. 4. Compared with the wild type DSPA alpha 1, the desmoteplase alpha 1 mutant has the characteristics of high specific activity, high expression quantity, long half-life period and high thrombolytic activity and particularly has the potential application valve of being developed into a novel effective thrombolytic medicament.
Description
Technical field
The present invention relates to be used to treat the plasminogen activator of human thrombomodulin disease, be specifically related to vampire plasminogen activator Desmoteplase alpha 1 (DSPA α 1) two mutants, belong to medical technical field.
Technical background
Desmoteplase (DSPA) is an isolating plasminogen activator from a kind of vampire saliva of South America, mainly comprises four kinds of protein: DSPA α 1, DSPA α 2, DSPA β and DSPA γ.Find after deliberation; Wherein DSPA α 1 has best biological chemistry and pharmacological property, compares with other plasminogen activators, and DSPA α 1 maximum characteristics are that scleroproein is had the height specificity; Compare with present widespread use tissue plasminogen activator (tPA); Under the scleroproein existence condition, the enzymic activity of DSPA α 1 increases by 102100 times, and tPA only increases by 550 times; Under the condition that scleroproein and Fibrinogen exist respectively, 1 two kinds of enzymic activity ratios of DSPA α are 12900, and tPA is merely 72; Clinically, DSPA α 1 dosage is few, and is hemorrhage few, and do not cause neurotoxicity, shows the pharmaceutical use more excellent than tPA.
DSPA α 1 is made up of finger type district (F), epidermal growth factor subarea (EGF), four parts of triangular space (K) and protein enzyme district (P), and His236-Asn285-Ser392 is contained in protein enzyme district, and this sequence is the characteristic feature of Tryase.DSPA α 1 has two N-glycosylation site (Asn-117; Asn-362); And lack plasmin cleavage site Arg-Ile in the molecule; Be first strand plasminogen activator proteinoid that occurring in nature is found, other Tryases generally exist with the zymogen forms of strand, cut through enzyme to be activated after forming two strands.1997, German scholar was carried out structure elucidation to the protein enzyme district (P) of DSPA α 1, and the result finds; DSPA α 1 is similar with double-stranded tPA proteolytic enzyme district three-dimensional structure height; Maximum difference is to activate ring district and Ile pocket region, in the activation process of tPA, along with Arg-Ile is digested; The Ile311 that forms new free N end forms ionic linkage with Asp512 again, thereby causes that altering protein structure activates tPA.And DSPA α 1 is not owing to there is the inner restriction enzyme site of proteolytic enzyme; Its active mode is that Lys156 side chain aminoterminal and Asp194 form ionic linkage; Cause DSPA α 1 conformational change; Thereby activate DSPA α 1, activate the hydrophobic region protection Lys156 of ring district (Gln10-Phe21) formation and the sat linkage that Asp194 forms, make proteolytic enzyme be in active condition; Activate ring district and 186-loop simultaneously through combining, influence DSPA α 1 strand enzymic activity, play on-off action with scleroproein.
Hydrophobic interaction is a kind of common power of protein interaction, through strengthening protein hydrophobic, can strengthen protein interaction.According to bibliographical information, in protein, phenylalanine(Phe) is replaced with Xie Ansuan, help strengthening should the zone hydrophobicity simultaneously, less to proteinic secondary structure influence.Current tPA structure of modification research is more; And existing multiple character improvement two mutants listing; Obtain clinical efficacy preferably; DSPA α 1 correlative study is then less, in view of having higher homology (reaching 72% on the amino acid levels) with tPA, the present invention DSPA α 1 protein three-dimensional structure is analyzed and to the basis of tPA various mutations body analysis on DSPA α 1 is carried out structure of modification.
Summary of the invention
The object of the invention provides plasminogen activator Desmoteplase alpha 1 (the DSPA α 1) two mutants of the property raising while still alive of two kinds of enzymes, expression amount raising, transformation period prolongation, thrombolysis activity raising.
The present invention improves its activity through the hydrophobicity that strengthens DSPA α 1 activation ring district, with reference to tPA three-dimensional structure and structure of modification research, DSPA α 1210～213 amino acid is suddenlyd change to improve its character simultaneously.
Desmoteplase alpha 1 mutant according to the invention is characterized in that, changes 195 the amino acid that wild-type DSPA α 1 activates the ring district, and 195 phenylalanine(Phe) in said wild-type DSPA α 1 peptide chain is replaced to Xie Ansuan, called after DSMa; Or on the DSMa basis, continue to change its amino acid of 210～213,210～213 four amino acid L-glutamic acid, aspartic acid, l-arginine, l-arginine (QNRR) in the said peptide chain replaced to four L-Ala (AAA), called after DSMb.
Wherein, the nucleotide sequence of said DSMa is shown in SEQ ID NO.1.
Wherein, the aminoacid sequence of said DSMa is shown in SEQ ID NO.2.
Wherein, the nucleotide sequence of said DSMb is shown in SEQ ID NO.3.
Wherein, the aminoacid sequence of said DSMb is shown in SEQ ID NO.4.
Above-mentioned DSPA alpha 1 mutant can adopt method production described in the Chinese patent 200810013776.1.The basic step of its preparation is that (1) obtains DSPA alpha 1 mutant gene, construction recombination plasmid pPIC9K-DSPA α 1 through sudden change; (2) electric shock transforms pichia spp GS115 cell and plate screening positive transformant; (3) pichia spp recombinant bacterial strain fermentation screening; (4) express separation and purification Desmoteplase alpha 1 mutant in the supernatant by the pichia spp recombinant bacterial strain.
The application of Desmoteplase alpha 1 mutant according to the invention in the preparation thrombolytic drug.
Experiment confirm: Desmoteplase alpha 1 mutant according to the invention compared with prior art has following advantage:
For wild-type DSPA α 1; DSPA alpha 1 mutant specific activity improves, expression amount improves, the transformation period prolongs, thrombolysis activity improves; Therefore; Compare with wild-type DSPA α 1, DSPA alpha 1 mutant according to the invention has more the potential using value that is developed to the novel and effective thrombolytic drug.
Description of drawings
Fig. 1, DSPA alpha 1 mutant and wild-type DSPA α 1 fermented liquid SDS-PAGE are relatively
Wherein swimming lane 1: protein Marker; Swimming lane 2: wild-type DSPA α 1; Swimming lane 3:DSMa transformant 1; Swimming lane 4:DSMa transformant 2; Swimming lane 5:DSMb transformant.
Fig. 2, DSPA alpha 1 mutant and wild-type DSPA α 1 enzyme are lived relatively
Wherein 1: wild-type DSPA α 1; 2:DSMa transformant 1; 3:DSMa transformant 2; The 4:DSMb transformant.
Fig. 3, wild-type DSPA α 1 and two mutants Pichia anomala expression amount are relatively.
Embodiment
Following examples will further specify the present invention, but not limit the present invention.
1, construction of recombinant plasmid
On the basis that does not change DSPA α 1 aminoacid sequence; Optimize DSPA α 1 gene order according to the pichia spp codon preference; It is synthetic to carry out complete sequence, and its 5 ＇ end contains XhoI restriction enzyme site and Kex2 restriction enzyme site codon (AAAAGA) respectively, and 3 ＇ end contains the EcoRI restriction enzyme site.Utilize synthetic DSPA α 1 gene in XhoI and the EcoRI double digestion; It is cloned into pPIC9 alpha factor downstream; Construction recombination plasmid pPIC9-DSPA α 1; Suitable then restriction enzymes double zyme cutting pPIC9-DSPA α 1 and pPIC9K, pPIC9-DSPA α 1 endonuclease bamhi that will contain DSPA α 1 then utilizes the T4DNA ligase enzyme to be connected with the pPIC9K fragment that contains kalamycin resistance gene, construction recombination plasmid pPIC9K-DSPA α 1.
2, transgenation
Sudden change is according to the GeneEditor of Promega company
TMIn vitro Site-Directed Mutagenesis System test kit principle is carried out, and concrete steps are following:
(1) design of primers
Design DSPA α 1 mutant primer designs the Amp mutant primer, 195 position amino acid mutation primer: 5-GCACTCTACTGGTGGTTTGGTTACTGACATCACTTCTCACCCTTG-3 simultaneously; Amp mutant primer: 5-CCGCGAGACCCACCCTTGGAGGCTCCAGATTTATC-3, two primer 5 ＇ hold equal phosphorylation modification.
(2) mutation process
The template preparation: double-stranded DNA template 0.5pmol, 2M NaOH, 2mM EDTA2 μ l, sterilized water is supplemented to 20 μ l; Room temperature leaves standstill 5min, adds 2 μ l2M amine acetates (pH4.6) and 75 μ l100% ethanol (4 ℃), places 30min, 4 ℃ for-70 ℃; 12000rpm, centrifugal 15min, deposit D NA is with 200 μ l70% ethanol (4 ℃) washing precipitations; 12000rpm, centrifugal 15min, the drying at room temperature deposition is with 100 μ l TE damping fluid (pH8.0) dissolution precipitations; Get 10 μ l samples and carry out electrophoresis detection, and use unmodified template to be contrast, detect the template denaturation degrees;
Hybridization: template DNA 0.05pmol, Amp mutant primer 0.25pmol, transgenation primer 1.25pmol, annealing buffer (10 *) 2 μ l are supplemented to 20 μ l with sterilized water.Establish blank simultaneously:
-11Zf (+) carrier 0.05pmol of alkaline denaturation; Select primer 0.25pmol; The LacZ blank knocks out primer 1.25pmol; Annealing buffer (10 *) 2 μ l, sterilized water is supplemented to 20 μ l.The annealing reaction system is placed 5min at 75 ℃, slowly be cooled to 37 ℃ then.
The sudden change chain synthesizes and is connected: gently centrifugal in case annealing reaction is cooled to 37 ℃, and liquid in pipe is concentrated on manage at the end, add following reagent: Synthesis10 * Buffer3 μ l, T4DNA polysaccharase 10U, T4DNA ligase enzyme 3U, sterilized water are supplemented to 30 μ l; 37 ℃ of incubation 90min make the synthetic and connection of sudden change chain.
Transform BMH71-18 (mutS) competent cell: precooling EP manages on ice, from-70 ℃ of competent cells that taking-up is frozen, places 5min or extremely dissolving on ice; Flick tube wall mixing cell, get 100 μ l dissolved BMH71-18 (mutS) competent cells then and (in 17 * 100mm), get 1.5 μ l jump reaction liquid or blank (about 10ng template DNA) in 100 μ l BMH71-18 (mutS) competent cells in the EP of each precooling pipe; Mixing flicks the EP pipe several times fast, places 10min on ice immediately; 42 ℃ of (accurately) water-baths; Thermal shock 45～50s, ice bath 2min immediately adds the LB of 900 μ l antibiotic-frees; 37 ℃ of vibrations (225rpm) incubation 60min adds and contains 100 μ lGeneEditor
TMThe 4ml LB of AntibioticSelection Mix, 37 ℃ of incubations (225rpm), 16～18h, extracting DNA; Carry out sequence verification then; After checking is correct, sudden change DSPA α 1 is cloned on the plasmid that contains wild-type Amp gene from plasmid pPIC9K, suddenlys change once more; DSPA α 1 gene clone of twice sudden change is expressed construction recombination plasmid pPIC9K-DSPA α 1 (M) to plasmid pPIC9K.
3, two mutants transforms pichia spp and plate screening
Sudden change is after sequence verification is correct, and the extracting plasmid utilizes restriction enzyme HpaI enzyme to cut recombinant plasmid pPIC9K-DSPA α 1 (M) and blank plasmid pPIC9K, gets 5 μ g～20 μ g plasmids conversion pichia spp GS115 cell that shocks by electricity.Used GenepulsterII electricity conversion instrument (parameter CA) is for Bio-Rad laboratories Inc., Hercules: voltage 1.5kV, electric capacity 25 μ F, resistance 200 Ω, discharge time 4.0ms.Add the ice-cold 1.0mol/L sorbyl alcohol of 1.0ml after the electric shock immediately, be coated with MD flat board (His rapidly
-), 28 ℃～30 ℃ cultivations, screening His
+Transformant.
4, shake flask fermentation screening
Picked at random positive strain (simultaneously the blank plasmid of picking transforms bacterial strain as contrast) carries out the shake flask fermentation preliminary screening, and screening method is following: from the MD flat board at random the picking mono-clonal in the YPD substratum, 28 ℃ of 200r/min incubated overnight; Connect 5～8% (v/v) bacterium liquid in liquid B MGY substratum (20mL/150mL triangular flask), cultivate in 28 ℃ of 200r/min; Treat that cell density grows into OD
600During ≈ 5-15,4, the centrifugal 5min of 000r/min collects thalline, with the resuspended deposition of liquid B MMY substratum, inoculate to the BMMY substratum (the 50mL/500mL triangular flask, pH6.0) in, make its OD
6002.0,20 ℃ of ≈, 220r/min cultivates, and adds 0.5% methyl alcohol (v/v) every day, detects protein expression amount (result such as Fig. 1) with SDS-PAGE therebetween, and detects enzyme work, pH, living weight simultaneously, and each sample detects for parallel two parts.
Wherein enzyme biopsy survey method detects according to the fibrinolytic flat band method, and method is to make fibrin plate, and the punching footpath is the hole of 2mm on flat board; Add standard substance and testing sample in the hole respectively; Every hole 10 μ L, every extent of dilution is done 2 holes, hatches 5h in 37 ℃ of wet boxes; Vertical and horizontal are measured the solusphere diameter, to compare DSPA α 1 enzymic activity (result such as Fig. 2).
5, DSMa purifying
With the fermented liquid of collecting, 10000rpm, 4 ℃ of centrifugal 30min collect supernatant.With Sephadex G-25 desalination, the desalination damping fluid is A with supernatant.Appearance on the sample after the desalination is used the buffer B wash-out again to the good CM Sepharose FF of A damping fluid balance behind the end of the sample, type of elution is 10 column volumes of linear elution, collects to have the component of fibrinolytic.The component of collecting is used Na
2HPO
4Transfer pH to 8.0, last appearance treats to wash with damping fluid D behind the end of the sample to on the good ETI-Sepharose4B post of C damping fluid balance again.After flushing is finished,, collect elutriant with damping fluid E wash-out.
Above-mentioned buffer solution system:
A：20mM PBS?pH8.0；
B:20mM PBS also contains 0.3M NaCl pH8.0;
C：50mM PBS?pH8.0；
D:50mM PBS also contains 0.5M NaCl pH8.0;
E:50mM citrate buffer solution pH4.0.
On the basis of DSPA alpha 1 mutant DSMa, carry out the structure of DSMb, wherein mutant primer is: 5-GGCAGGCTGCTATCTTCGCTGCTGCTGCTGCTTCCTCTGGTGGAGATTCTTGTG TGG-3; All the other steps and embodiment 1 are identical, and the pure article of final purified acquisition DSMb protein.
1, DSMa, DSMb and wild-type DSPA α 1 expression amount are relatively
Two kinds of two mutants and pichia spp source DSPA α 1 final purifying acquisition protein are carried out quantitatively, to compare its expression amount, result such as Fig. 3.
2, DSMa, DSMb and wild-type DSPA α 1 activity ratio are
Is that chromophoric substrate detects to DSMa, DSMb, pichia spp source wild-type DSPA α 1 specific activity than adopting with S-2251.
Test is carried out in 96 orifice plates, and reaction volume is 220 μ l.The buffer system 50mM Tris-HCl of whole test, 0.15M NaCl, pH7.4.The concentration of S-2251 is 0.3mM, and the concentration of Profibrinolysin is 0.04375～0.61 μ mol, totally 5 concentration gradients.Scleroproein is 100 μ g/ml; Plasminogen activator concentration 5nM, 37 ℃ of temperature of reaction, every separated 2min detects once under 405nm, detects 2h altogether.Calculate Km (μ mol.L according to absorbancy and time relation
-1), kcat (s
-1), kcat/Km (M.L
-1.S
-1) numerical value.
The result is as shown in table 1:
Table 1 chromophoric substrate method is surveyed enzyme kinetics constant and relative vigor (is 1.000 with yeast expression DSPA α 1)
| Km(μmol.L -1) | Kcat(s -1) | kcat/Km(M.L -1.S -1) | Vigor is big or small relatively | |
| Yeast expression DSPA |
0.121 | 0.410 | 3.388×10 6 | 1.000 |
| DSMa | 0.131 | 0.820 | 6.250×10 6 | 1.844 |
| DSMb | 0.288 | 0.261 | 3.638×10 6 | 1.074 |
3, DSMa, DSMb and wild-type DSPA α 1 external thrombolysis activity experiment
With the Sodium Citrate is that antithrombotics prepares the human plasma biased sample, adopts multiple calcium method to handle blood plasma, with 100 μ l/ holes inoculation enzyme plate, can prepare the little caking of the thrombus with certain turbidity behind 37 ℃ of incubation 30min.DSPA sample (yeast expression DSPA α 1, DSMa, DSMb) is diluted to final concentration with 6%BSA-PBS respectively is respectively 0,0.39,0.78,1.56,3.13,6.25,12.5,25,50 and 100 μ g/ml.Get said sample then respectively and use liquid 25 μ l to be added in the little caking supernatant of adhesive type blood plasma of each hole prepared fresh, 100 μ l6%BSA-PBS are added in every hole, test according to doing 2 plates with quadrat method as parallel control at every turn.The zeroing hole then adds with volume 6%BSA-PBS.Enzyme plate is hatched 4h under the rearmounted 37 ℃ of water bath condition of oscillator plate vibration 2min, the turbidity that uses ELIASA to measure each hole of different time points is A
405nmReducing by 50% corresponding DSPA concentration with turbidity behind 37 ℃ of incubation 4h of SPSS (Statistical Package for the Social Science) statistics is ED
50For external thrombolysis activity index is investigated each sample thrombolysis activity size.
The result is as shown in table 2.
The external thrombolysis activity of table 2D SPA α 1 and two mutants thereof relatively
| ED50(μg/ml) | 95% credibility interval | |
| Yeast |
2.76 | 2.22-3.47 |
| DSMa | 1.49 | 1.19-1.87 |
| DSMb | 1.83 | 1.34-2.13 |
4, thrombolysis activity experiment in the DSPA alpha 1 mutant body
Adopt rabbit neck arteriovenous shut method to investigate thrombolysis activity in the body of DSPA α 1.Rabbit is used vetanarcol 30mgkg
-1Iv anesthesia, it is fixing to lie on the back, and separates RCCA and left external jugular vein, and with a long 6cm, No. 4 silk threads of having weighed are put into the polyethylene tube of long 25cm, internal diameter 2mm, with heparin-saline solution (50Uml
-1) be full of polyethylene tube, after an end of polyethylene tube inserts RCCA, and then the other end of polyethylene tube inserted left external jugular vein.Open bulldog clamp, let blood flow in RCCA flow to polyethylene tube, return left external jugular vein again.Open blood flow 45min thrombosis is injected 6nmolkg respectively through auricular vein
-1And 12nmolkg
-1DSPA sample (yeast expression DSPA α 1, DSMa, DSMb) (2min); Herba Clinopodii among the 90min after the administration; Take out rapidly silk thread in the neck arteriovenous shut, remove floating blood after, weigh with the precise electronic balance; Deduct silk thread weight with gross weight and be wet weight of thrombus (mg), put in 60 ℃ of baking ovens weighing thrombus net dry weight behind the oven dry 4h.
The result is as shown in table 3.
Thrombolysis activity relatively in table 3D SPA α 1 and the two mutants body thereof
Plasmid and pichia spp yeast strain are all available from Invitrogen company among the present invention.
Among the present invention the dull and stereotyped prescription of LB be (/L): 1% yeast extract; 0.5% peptone; 1%NaCl.
Among the present invention the dull and stereotyped prescription of MD be (/L): 1.34% no amino acid yeast nitrogen (YNB); 4 * 10
-5The % vitamin H; 2%D-glucose;
Among the present invention the prescription of YPD substratum be (/L): 1% yeast extract; 2% peptone; 2%D-glucose;
Among the present invention the prescription of YPDS substratum be (/L): 1% yeast extract; 2% peptone; 2%D-glucose, the 1M sorbyl alcohol.
Among the present invention the prescription of BMGY substratum be (/L): 1% yeast extract; 2% peptone; 100mM phosphoric acid buffer (pH6.0); 1.34% no amino acid yeast nitrogen (YNB); 4 * 10
-5The % vitamin H; 1% glycerine;
Among the present invention the prescription of BMMY substratum be (/L): 1% yeast extract; 2% peptone; 100mM phosphoric acid buffer (pH6.0); 1.34% no amino acid yeast nitrogen (YNB); 4 * 10
-5The % vitamin H; 0.5% methyl alcohol;
Among the present invention the prescription of BMG substratum be (/L): 100mM phosphoric acid buffer (pH6.0); 1.34% no amino acid yeast nitrogen (YNB); 4 * 10
-5The % vitamin H; 1% glycerine.
Among the present invention the prescription of BMM substratum be (/L): 100mM phosphoric acid buffer (pH6.0); 1.34% no amino acid yeast nitrogen (YNB); 4 * 10
-5The % vitamin H; 0.5% methyl alcohol.。
Sequence table
< 110>Qilu Pharmaceutical Co., Ltd.
< 120>Desmoteplase alpha 1 mutant
<141>2008-11-27
<160>4
<210>1
<211>1326
<212>DNA
< 213>pichia spp (Pichia pastoris)
< 221>Desmoteplase alpha 1 mutant DSMa nucleotide sequence
<222>(1)…(1326)
<400>1
<210>2
<211>442
<212>PRT
< 221>Desmoteplase alpha 1 mutant DSMa aminoacid sequence
<222>(1)…(442)
<400>2
<210>3
<211>1326
<212>DNA
< 221>Desmoteplase alpha 1 mutant DSMb nucleotide sequence
<222>(1)…(1326)
<400>3
<210>4
<211>442
<212>PRT
< 221>Desmoteplase alpha 1 mutant DSMb aminoacid sequence
<222>(1)…(442)
<400>4
Claims (6)
1. a Desmoteplase alpha 1 mutant is characterized in that, changes 195 the amino acid in wild-type Desmoteplase alpha 1 Gln10-Phe21 district, and 195 phenylalanine(Phe) in the said wild-type Desmoteplase alpha 1 peptide chain is replaced to Xie Ansuan, called after DSMa; Or on the DSMa basis, continue to change its amino acid of 210～213,210～213 four amino acid L-glutamic acid, aspartic acid, l-arginine, l-arginine in the said peptide chain are replaced to four L-Ala, called after DSMb.
2. Desmoteplase alpha 1 mutant according to claim 1 is characterized in that the nucleotide sequence of said DSMa is shown in SEQ ID NO.1.
3. Desmoteplase alpha 1 mutant according to claim 1 is characterized in that the aminoacid sequence of said DSMa is shown in SEQ ID NO.2.
4. Desmoteplase alpha 1 mutant according to claim 1 is characterized in that the nucleotide sequence of said DSMb is shown in SEQ ID NO.3.
5. Desmoteplase alpha 1 mutant according to claim 1 is characterized in that the aminoacid sequence of said DSMb is shown in SEQ ID NO.4.
6. the application of the said Desmoteplase alpha 1 mutant of claim 1 in the preparation thrombolytic drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102377098A CN101748110B (en) | 2008-12-01 | 2008-12-01 | Desmoteplase alpha 1 mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102377098A CN101748110B (en) | 2008-12-01 | 2008-12-01 | Desmoteplase alpha 1 mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101748110A CN101748110A (en) | 2010-06-23 |
| CN101748110B true CN101748110B (en) | 2012-06-06 |
Family
ID=42475724
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102377098A Expired - Fee Related CN101748110B (en) | 2008-12-01 | 2008-12-01 | Desmoteplase alpha 1 mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101748110B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114150007B (en) * | 2021-12-14 | 2023-07-21 | 扬州大学 | Coding gene applicable to rabbit mammary gland specific expression deaminase and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101155916A (en) * | 2005-03-04 | 2008-04-02 | 帕昂德国有限公司 | Targeted plasminogen activator fusion proteins as thrombolytic agents |
-
2008
- 2008-12-01 CN CN2008102377098A patent/CN101748110B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101155916A (en) * | 2005-03-04 | 2008-04-02 | 帕昂德国有限公司 | Targeted plasminogen activator fusion proteins as thrombolytic agents |
Non-Patent Citations (4)
| Title |
|---|
| Jose P Lopez-Atalaya et al..Toward safer thrombolytic agents in stroke: molecular requirements for NMDA receptor-mediated neurotoxicity.《Journal of Cerebral Blood Flow & Metabolism》.2008,第28卷1212-1221. |
| Jose P Lopez-Atalaya et al..Toward safer thrombolytic agents in stroke: molecular requirements for NMDA receptor-mediated neurotoxicity.《Journal of Cerebral Blood Flow & * |
| Metabolism》.2008,第28卷1212-1221. * |
| 董宁征等.dsPAα1 的缺失突变体的构建及其活性.《中国生物化学与分子生物学报》.2004,第20卷(第6期),805-809. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101748110A (en) | 2010-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105907758A (en) | CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-Cas9) homing sequences and primers thereof, and transgenic expression vector and establishment method thereof | |
| CN102154253A (en) | Micro plasminogen mutant with function of inhibiting platelet aggregation and preparation method and application thereof | |
| CN103937830B (en) | A kind of recombinant bacterium of efficient secretory expression Nattokinase | |
| CN102199587B (en) | Functional mutant of human plasminogen, its preparation method and application | |
| Rodgers et al. | Characterization of the interaction between factor Xa and bovine aortic endothelial cells | |
| CN101748110B (en) | Desmoteplase alpha 1 mutant | |
| CN103710367B (en) | A kind of recombined human kallikrein 1 and encoding gene thereof and preparation method | |
| CN100446810C (en) | Non-neurotoxic plasminogen activating factors for treating stroke | |
| CN106929496A (en) | A kind of pharmaceutical grade recombined human kininogenase industrialization production method | |
| JP2006516113A5 (en) | ||
| CN107760660A (en) | A kind of tissue-type plasminogen activator mutant and its application | |
| CN109679941A (en) | A kind of Cordyceps militaris fibrinoclase and its preparation method and application | |
| Su et al. | Construction and characterization of novel staphylokinase variants with antiplatelet aggregation activity and reduced immunogenecity | |
| CN106337042A (en) | Mutant of double-base enzyme kex2 and high-efficiency expression method for double-base enzyme kex2 | |
| CN109971774A (en) | A kind of bovine trypsinogen mutant, encoding gene and its preparation | |
| CN102850451B (en) | Recombinant textilinin-1 with plasmin inhibition activity, and preparation method and application thereof | |
| CN102180973B (en) | Target multifunctional anti-embolism fusion protein as well as preparation method and application thereof | |
| CN101139578B (en) | Double-functional staphylokinase mutant having platelet aggregation resistance and fibrinolytic activity, application and preparation method thereof | |
| CN101705240A (en) | Synthesis of batroxobin gene and preparation method of expression product thereof | |
| CN102277379B (en) | Expression vector for expressing coagulation factor VIII and application thereof | |
| CN101240284B (en) | Recombination staphylokinase and highly effective secretion expression method thereof | |
| CN100355884C (en) | Novel earthworm fibrinolytic enzyme, its encoding sequence and uses | |
| CN103789291A (en) | Preparation process of separating and purifying recombinant human pro-urokinase in recombinant E. colifermentation broth | |
| RU2247777C2 (en) | Plasminogen urokinase type modified activator, dna sequence, recombinant plasmid, strain-producer, method for preparing plasminogen urokinase type modified activator and pharmaceutical composition eliciting thrombolytic effect | |
| CN1259411C (en) | Strain of Pichia yeast genetic engineering, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120606 Termination date: 20141201 |
|
| EXPY | Termination of patent right or utility model |