CN101748110A - Desmoteplase alpha 1 mutant - Google Patents

Abstract

The invention discloses a desmoteplase alpha 1 mutant which is used for changing 195 bits of amino acid in a wild type DSPA alpha 1 activated loop region, replacing 195 bits of phenylalanine in a wild type DSPA alpha 1 peptide chain into valine and nominating the valine into DSMa or continuously changing 210-213 bits of amino acid based on the DSMa, replacing the four 210-213 bits of amino acid like glutamic acid, aspartic acid, arginine and arginine in the peptide chain into four alanine and nominating the four alanine into DSMb, wherein a nucleotide sequence and an amino acid sequence of the DSMa are shown as shown in SEQID NO. 1 and SEQID NO. 2; and a nucleotide sequence and an amino acid sequence of the DSMb are shown as shown in SEQID NO. 3 and SEQID NO. 4. Compared with the wild type DSPA alpha 1, the desmoteplase alpha 1 mutant has the characteristics of high specific activity, high expression quantity, long half-life period and high thrombolytic activity and particularly has the potential application valve of being developed into a novel effective thrombolytic medicament.

Description

Desmoteplase alpha 1 mutant

Technical field

The present invention relates to be used for the treatment of the plasminogen activator of human thrombomodulin disease, be specifically related to vampire plasminogen activator Desmoteplase alpha 1 (DSPA α 1) mutant, belong to medical technical field.

Technical background

Desmoteplase (DSPA) is an isolating plasminogen activator from a kind of vampire saliva of South America, mainly comprises four kinds of protein: DSPA α 1, DSPA α 2, DSPA β and DSPA γ.Find after deliberation, wherein DSPA α 1 has best biological chemistry and pharmacological property, compare with other plasminogen activators, the characteristics of DSPA α 1 maximum are that scleroproein is had the height specificity, compare with present widespread use tissue plasminogen activator (tPA), under the scleroproein existence condition, the enzymic activity of DSPA α 1 increases by 102100 times, and tPA only increases by 550 times; Under the condition that scleroproein and Fibrinogen exist respectively, 1 two kinds of enzymic activity ratios of DSPA α are 12900, and tPA only is 72; Clinically, DSPA α 1 dosage is few, and is hemorrhage few, and do not cause neurotoxicity, shows the pharmaceutical use more excellent than tPA.

DSPA α 1 is made up of finger type district (F), epidermal growth factor subarea (EGF), four parts of triangular space (K) and protein enzyme district (P), and His236-Asn285-Ser392 is contained in protein enzyme district, and this sequence is the characteristic feature of serine protease.DSPA α 1 has two N-glycosylation site (Asn-117, Asn-362), and lack plasmin cleavage site Arg-Ile in the molecule, it is first strand plasminogen activator proteinoid that occurring in nature is found, other serine proteases generally exist with the zymogen forms of strand, cut by enzyme to be activated after forming two strands.1997, German scholar has been carried out structure elucidation to the protein enzyme district (P) of DSPA α 1, found that, DSPA α 1 is similar to double-stranded tPA proteolytic enzyme district three-dimensional structure height, maximum difference is to activate ring district and Ile pocket region, in the activation process of tPA, along with Arg-Ile is digested, the Ile311 that forms new free N end forms ionic linkage with Asp512 again, thereby causes that altering protein structure activates tPA.And DSPA α 1 is not owing to there is the inner restriction enzyme site of proteolytic enzyme, its active mode is that Lys156 side chain aminoterminal and Asp194 form ionic linkage, cause DSPA α 1 conformational change, thereby activate DSPA α 1, activate the hydrophobic region protection Lys156 of ring district (Gln10-Phe21) formation and the sat linkage that Asp194 forms, make proteolytic enzyme be in active condition; Activate ring district and 186-loop simultaneously by combining, influence DSPA α 1 strand enzymic activity, play on-off action with scleroproein.

Hydrophobic interaction is a kind of common power of protein interaction, by strengthening protein hydrophobic, can strengthen protein interaction.According to the literature, in protein, phenylalanine is replaced with Xie Ansuan, help strengthening this zone hydrophobicity simultaneously, less to proteinic secondary structure influence.Current tPA structure of modification research is more, and existing multiple character improvement mutant listing, obtain clinical efficacy preferably, DSPA α 1 correlative study is then less, in view of having higher homology (reaching 72% on the amino acid levels) with tPA, the present invention DSPA α 1 protein three-dimensional structure is analyzed and to the basis of tPA various mutations body analysis on DSPA α 1 is carried out structure of modification.

Summary of the invention

The object of the invention provides plasminogen activator Desmoteplase alpha 1 (the DSPA α 1) mutant of the property raising while still alive of two kinds of enzymes, expression amount raising, transformation period prolongation, thrombolysis activity raising.

The present invention improves its activity by the hydrophobicity that strengthens DSPA α 1 activation ring district, with reference to tPA three-dimensional structure and structure of modification research, DSPA α 1210～213 amino acid is suddenlyd change to improve its character simultaneously.

Desmoteplase alpha 1 mutant of the present invention is characterized in that, changes 195 the amino acid that wild-type DSPA α 1 activates the ring district, and 195 phenylalanine in described wild-type DSPA α 1 peptide chain is replaced to Xie Ansuan, called after DSMa; Or on the DSMa basis, continue to change its amino acid of 210～213,210～213 four amino acid L-glutamic acid, aspartic acid, arginine, arginine (QNRR) in the described peptide chain replaced to four L-Ala (AAA), called after DSMb.

Wherein, the nucleotide sequence of described DSMa is shown in SEQ ID NO.1.

Wherein, the aminoacid sequence of described DSMa is shown in SEQ ID NO.2.

Wherein, the nucleotide sequence of described DSMb is shown in SEQ ID NO.3.

Wherein, the aminoacid sequence of described DSMb is shown in SEQ ID NO.4.

Above-mentioned DSPA alpha 1 mutant can adopt method production described in the Chinese patent 200810013776.1.The basic step of its preparation is that (1) obtains DSPA alpha 1 mutant gene, construction recombination plasmid pPIC9K-DSPA α 1 through sudden change; (2) electric shock transforms pichia spp GS115 cell and plate screening positive transformant; (3) pichia spp recombinant bacterial strain fermentation screening; (4) express separation and purification Desmoteplase alpha 1 mutant in the supernatant liquor by the pichia spp recombinant bacterial strain.

The application of Desmoteplase alpha 1 mutant of the present invention in the preparation thrombolytic drug.

Experiment confirm: Desmoteplase alpha 1 mutant of the present invention compared with prior art has following advantage:

For wild-type DSPA α 1, DSPA alpha 1 mutant specific activity improves, expression amount improves, the transformation period prolongs, thrombolysis activity improves, therefore, compare with wild-type DSPA α 1, DSPA alpha 1 mutant of the present invention has more the potential using value that is developed to the novel and effective thrombolytic drug.

Description of drawings

Fig. 1, DSPA alpha 1 mutant and wild-type DSPA α 1 fermented liquid SDS-PAGE are relatively

Wherein swimming lane 1: protein Marker; Swimming lane 2: wild-type DSPA α 1; Swimming lane 3:DSMa transformant 1; Swimming lane 4:DSMa transformant 2; Swimming lane 5:DSMb transformant.

Fig. 2, DSPA alpha 1 mutant and wild-type DSPA α 1 enzyme are lived relatively

Wherein 1: wild-type DSPA α 1; 2:DSMa transformant 1; 3:DSMa transformant 2; The 4:DSMb transformant.

Fig. 3, wild-type DSPA α 1 and mutant Pichia anomala expression amount are relatively.

Embodiment

Following examples will further specify the present invention, but not limit the present invention.

Embodiment 1DSMa structure, expression and purifying

1, construction of recombinant plasmid

On the basis that does not change DSPA α 1 aminoacid sequence, optimize DSPA α 1 gene order according to the pichia spp codon preference, it is synthetic to carry out complete sequence, and its 5 ' end contains XhoI restriction enzyme site and Kex2 restriction enzyme site codon (AAAAGA) respectively, and 3 ' end contains the EcoRI restriction enzyme site.Utilize synthetic DSPA α 1 gene in XhoI and the EcoRI double digestion, it is cloned into pPIC9 alpha factor downstream, construction recombination plasmid pPIC9-DSPA α 1, suitable then restriction enzymes double zyme cutting pPIC9-DSPA α 1 and pPIC9K, pPIC9-DSPA α 1 endonuclease bamhi that will contain DSPA α 1 then utilizes the T4DNA ligase enzyme to be connected with the pPIC9K fragment that contains kalamycin resistance gene, construction recombination plasmid pPIC9K-DSPA α 1.

2, transgenation

Sudden change is according to the GeneEditor of Promega company ^TMIn vitro Site-Directed Mutagenesis System test kit principle is carried out, and concrete steps are as follows:

(1) design of primers

Design DSPA α 1 mutant primer designs the Amp mutant primer, 195 position amino acid mutation primer: 5-GCACTCTACTGGTGGTTTGGTTACTGACATCACTTCTCACCCTTG-3 simultaneously; Amp mutant primer: 5-CCGCGAGACCCACCCTTGGAGGCTCCAGATTTATC-3, the equal phosphorylation modification of two primers 5 ' hold.

(2) mutation process

Template preparation: double-stranded DNA template 0.5pmol, 2M NaOH, 2mM EDTA 2 μ l, sterilized water is supplemented to 20 μ l, and room temperature leaves standstill 5min, add 2 μ l 2M amine acetates (pH 4.6) and 75 μ l, 100% ethanol (4 ℃), place 30min, 4 ℃, 12000rpm for-70 ℃, centrifugal 15min, deposit D NA is with 200 μ l, 70% ethanol (4 ℃) washing precipitation, 12000rpm, centrifugal 15min, the drying at room temperature precipitation with 100 μ l TE damping fluid (pH 8.0) dissolution precipitations, is got 10 μ l samples and is carried out electrophoresis detection, and be contrast with unmodified template, detect the template denaturation degrees;

Hybridization: template DNA 0.05pmol, Amp mutant primer 0.25pmol, transgenation primer 1.25pmol, annealing buffer (10 *) 2 μ l are supplemented to 20 μ l with sterilized water.Establish blank simultaneously: alkaline denaturation -11Zf (+) carrier 0.05pmol selects primer 0.25pmol, and the LacZ blank knocks out primer 1.25pmol, annealing buffer (10 *) 2 μ l, and sterilized water is supplemented to 20 μ l.The annealing reaction system is placed 5min at 75 ℃, slowly be cooled to 37 ℃ then.

The sudden change chain synthesizes and is connected: gently centrifugal in case annealing reaction is cooled to 37 ℃, and liquid in pipe is concentrated on manage at the end, add following reagent: Synthesis 10 * Buffer 3 μ l, T4DNA polysaccharase 10U, T4DNA ligase enzyme 3U, sterilized water are supplemented to 30 μ l; 37 ℃ of incubation 90min make the synthetic and connection of sudden change chain.

Transform BMH71-18 (mutS) competent cell: precooling EP manages on ice, take out frozen competent cell from-70 ℃, place 5min or extremely dissolving on ice, flick tube wall mixing cell, getting 100 μ l dissolved BMH71-18 (mutS) competent cells then manages (in 17 * 100mm) in the EP of each precooling, get 1.5 μ l jump reaction liquid or blank (about 10ng template DNA) in 100 μ l BMH71-18 (mutS) competent cells, mixing, flick the EP pipe fast several times, place 10min on ice immediately, 42 ℃ of (accurately) water-baths, thermal shock 45～50s, ice bath 2min immediately adds the LB of 900 μ l antibiotic-frees, 37 ℃ of vibrations (225rpm) incubation 60min adds and contains 100 μ lGeneEditor ^TMThe 4ml LB of AntibioticSelection Mix, 37 ℃ of incubations (225rpm), 16～18h, the extracting plasmid DNA, carry out sequence verification then, after checking is correct, sudden change DSPA α 1 is cloned on the plasmid that contains wild-type Amp gene from plasmid pPIC9K, suddenlys change once more, DSPA α 1 gene clone of twice sudden change is expressed construction recombination plasmid pPIC9K-DSPA α 1 (M) to plasmid pPIC9K.

3, mutant transforms pichia spp and plate screening

Sudden change is after sequence verification is correct, and the extracting plasmid utilizes restriction enzyme HpaI enzyme to cut recombinant plasmid pPIC9K-DSPA α 1 (M) and blank plasmid pPIC9K, gets 5 μ g～20 μ g plasmids conversion pichia spp GS115 cell that shocks by electricity.Used GenepulsterII electricity conversion instrument (parameter CA) is for Bio-Rad laboratories Inc., Hercules: voltage 1.5kV, electric capacity 25 μ F, resistance 200 Ω, discharge time 4.0ms.Add the ice-cold 1.0mol/L sorbyl alcohol of 1.0ml after the electric shock immediately, be coated with MD flat board (His rapidly ^-), 28 ℃～30 ℃ cultivations, screening His ⁺Transformant.

4, shake flask fermentation screening

Picked at random positive strain (simultaneously the blank plasmid of picking transforms bacterial strain in contrast) carries out the shake flask fermentation preliminary screening, and screening method is as follows: from the MD flat board at random the picking mono-clonal in the YPD substratum, 28 ℃ of 200r/min incubated overnight; Connect 5～8% (v/v) bacterium liquid in liquid B MGY substratum (20mL/150mL triangular flask), cultivate in 28 ℃ of 200r/min; Treat that cell density grows into OD ₆₀₀During ≈ 5-15,4, the centrifugal 5min of 000r/min collects thalline, with the resuspended precipitation of liquid B MMY substratum, inoculate to the BMMY substratum (the 50mL/500mL triangular flask, pH6.0) in, make its OD ₆₀₀2.0,20 ℃ of ≈, 220r/min cultivates, and adds 0.5% methyl alcohol (v/v) every day, detects protein expression amount (result such as Fig. 1) with SDS-PAGE therebetween, and detects enzyme work, pH, biomass simultaneously, and each sample detects for parallel two parts.

Wherein enzyme biopsy survey method detects according to the fibrinolytic flat band method, method is to make fibrin plate, the punching footpath is the hole of 2mm on flat board, add standard substance and testing sample in the hole respectively, every hole 10 μ L, every extent of dilution is done 2 holes, hatches 5h in 37 ℃ of wet boxes, vertical and horizontal are measured the solusphere diameter, to compare DSPA α 1 enzymic activity (result such as Fig. 2).

5, DSMa purifying

With the fermented liquid of collecting, 10000rpm, 4 ℃ of centrifugal 30min collect supernatant.With supernatant Sephadex G-25 desalination, the desalination damping fluid is A.Sample on the sample after the desalination to the good CM Sepharose FF of A damping fluid balance, is used the buffer B wash-out again behind the end of the sample, type of elution is 10 column volumes of linear elution, collects to have the component of fibrinolytic.With the component Na that collects ₂HPO ₄Transfer pH to 8.0, last sample is treated to wash with damping fluid D behind the end of the sample to on the good ETI-Sepharose4B post of C damping fluid balance again.After flushing is finished,, collect elutriant with damping fluid E wash-out.

Above-mentioned buffer solution system:

A：20mM?PBS?pH8.0；

B:20mM PBS also contains 0.3M NaCl pH 8.0;

C：50mM?PBS?pH8.0；

D:50mM PBS also contains 0.5M NaCl pH 8.0;

E:50mM citrate buffer solution pH 4.0.

Embodiment 2DSMb structure, expression and purifying

Carry out the structure of DSMb on the basis of DSPA alpha 1 mutant DSMa, wherein mutant primer is: 5-GGCAGGCTGCTATCTTCGCTGCTGCTGCTGCTTCCTCTGGTGGAGATTCTTGTG TGG-3; All the other steps and embodiment 1 are identical, and the pure product of final purified acquisition DSMb protein.

Embodiment 3DSMa, DSMb and wild-type DSPA α 1 character are relatively

1, DSMa, DSMb and wild-type DSPA α 1 expression amount are relatively

Two kinds of mutant and pichia spp source DSPA α 1 final purifying acquisition protein are carried out quantitatively, to compare its expression amount, result such as Fig. 3.

2, DSMa, DSMb and wild-type DSPA α 1 activity ratio are

Is that chromophoric substrate detects to DSMa, DSMb, pichia spp source wild-type DSPA α 1 specific activity than adopting with S-2251.

Test is carried out in 96 orifice plates, and reaction volume is 220 μ l.The buffer system 50mM Tris-HCl of whole test, 0.15M NaCl, pH7.4.The concentration of S-2251 is 0.3mM, and the concentration of Profibrinolysin is 0.04375～0.61 μ mol, totally 5 concentration gradients.Scleroproein is 100 μ g/ml; Plasminogen activator concentration 5nM, 37 ℃ of temperature of reaction detect once every 2min under 405nm, detect 2h altogether.Calculate Km (μ mol.L according to absorbancy and time relation ^-1), kcat (s ^-1), kcat/Km (M.L ^-1.S ^-1) numerical value.

The result is as shown in table 1:

Table 1 chromophoric substrate method is surveyed enzyme kinetics constant and relative vigor (is 1.000 with yeast expression DSPA α 1)

	?Km(μmol.L -1)	??Kcat(s -1)	??kcat/Km(M.L -1.S -1)	Relative vigor size
					Yeast expression DSPA α 1	??0.121	??0.410	??3.388×10 6	??1.000
??DSMa	??0.131	??0.820	??6.250×10 6	??1.844
					??DSMb	??0.288	??0.261	??3.638×10 6	??1.074

3, DSMa, DSMb and wild-type DSPA α 1 external thrombolysis activity experiment

With the Sodium Citrate is that antithrombotics prepares the human plasma biased sample, adopts multiple calcium method to handle blood plasma, with 100 μ l/ holes inoculation enzyme plate, can prepare the little caking of the thrombus with certain turbidity behind 37 ℃ of incubation 30min.DSPA sample (yeast expression DSPA α 1, DSMa, DSMb) is diluted to final concentration with 6%BSA-PBS respectively is respectively 0,0.39,0.78,1.56,3.13,6.25,12.5,25,50 and 100 μ g/ml.Get described sample then respectively and use liquid 25 μ l to be added in the little caking supernatant of adhesive type blood plasma of each hole prepared fresh, 100 μ l 6%BSA-PBS are added in every hole, test according to doing 2 plates with quadrat method as parallel control at every turn.The zeroing hole then adds with volume 6%BSA-PBS.Enzyme plate is hatched 4h under the rearmounted 37 ℃ of water bath condition of oscillator plate vibration 2min, the turbidity that uses microplate reader to measure each hole of different time points is A _405nmThe DSPA concentration that reduces by 50% correspondence with turbidity behind 37 ℃ of incubation 4h of SPSS (Statistical Package for the Social Science) statistics is ED ₅₀For external thrombolysis activity index is investigated each sample thrombolysis activity size.

The result is as shown in table 2.

The external thrombolysis activity of table 2DSPA α 1 and mutant thereof relatively

	??ED50(μg/ml)	95% credibility interval
			Yeast expression DSPA α 1	??2.76	??2.22-3.47
??DSMa	??1.49	??1.19-1.87
			??DSMb	??1.83	??1.34-2.13

4, thrombolysis activity experiment in the DSPA alpha 1 mutant body

Adopt rabbit neck arteriovenous shut method to investigate thrombolysis activity in the body of DSPA α 1.Rabbit is used vetanarcol 30mgkg ^-1Iv anesthesia, it is fixing to lie on the back, and separates right common carotid artery and left external jugular vein, and with a long 6cm, No. 4 silk threads of having weighed are put into the polyethylene tube of long 25cm, internal diameter 2mm, with heparin-saline solution (50Uml ^-1) be full of polyethylene tube, after an end of polyethylene tube inserts right common carotid artery, and then the other end of polyethylene tube inserted left external jugular vein.Open bulldog clamp, allow blood flow in right common carotid artery flow to polyethylene tube, return left external jugular vein again.Open blood flow 45min thrombosis is injected 6nmolkg respectively through auricular vein ^-1And 12nmolkg ^-1DSPA sample (yeast expression DSPA α 1, DSMa, DSMb) (2min), Herba Clinopodii among the 90min after the administration, take out silk thread in the neck arteriovenous shut rapidly, after removing floating blood, weigh with the precise electronic balance, deduct silk thread weight with gross weight and be wet weight of thrombus (mg), put in 60 ℃ of baking ovens weighing thrombus net dry weight behind the oven dry 4h.

The result is as shown in table 3.

Thrombolysis activity relatively in table 3DSPA α 1 and the mutant body thereof

Plasmid and pichia spp yeast strain are all available from Invitrogen company among the present invention.

Among the present invention the prescription of LB flat board be (/L): 1% yeast extract; 0.5% peptone; 1%NaCl.

Among the present invention the prescription of MD flat board be (/L): 1.34% no amino acid yeast nitrogen (YNB); 4 * 10 ^-5The % vitamin H; 2%D-glucose;

Among the present invention the prescription of YPD substratum be (/L): 1% yeast extract; 2% peptone; 2%D-glucose;

Among the present invention the prescription of YPDS substratum be (/L): 1% yeast extract; 2% peptone; 2%D-glucose, the 1M sorbyl alcohol.

Among the present invention the prescription of BMGY substratum be (/L): 1% yeast extract; 2% peptone; 100mM phosphoric acid buffer (pH 6.0); 1.34% no amino acid yeast nitrogen (YNB); 4 * 10 ^-5The % vitamin H; 1% glycerine;

Among the present invention the prescription of BMMY substratum be (/L): 1% yeast extract; 2% peptone; 100mM phosphoric acid buffer (pH 6.0); 1.34% no amino acid yeast nitrogen (YNB); 4 * 10 ^-5The % vitamin H; 0.5% methyl alcohol;

Among the present invention the prescription of BMG substratum be (/L): 100mM phosphoric acid buffer (pH 6.0); 1.34% no amino acid yeast nitrogen (YNB); 4 * 10 ^-5The % vitamin H; 1% glycerine.

Among the present invention the prescription of BMM substratum be (/L): 100mM phosphoric acid buffer (pH 6.0); 1.34% no amino acid yeast nitrogen (YNB); 4 * 10 ^-5The % vitamin H; 0.5% methyl alcohol.

Sequence table

＜110〉Qilu Pharmaceutical Co., Ltd.

＜120〉Desmoteplase alpha 1 mutant

<141>2008-11-27

<160>4

<210>1

<211>1326

<212>DNA

＜213〉pichia spp (Pichia pastoris)

＜221〉Desmoteplase alpha 1 mutant DSMa nucleotide sequence

<222>(1)…(1326)

<400>1

gcttacggtg?ttgcttgtaa?ggacgagatc?actcagatga?cttacagaag?acaagagtct?60

tggttgagac?cagaagtcag?atccaagaga?gttgaacact?gtcagtgtga?cagaggtcag?120

gctagatgtc?acactgttcc?agtcaactct?tgttctgaac?caagatgttt?caacggtggt?180

acttgttggc?aggctgtcta?cttctctgac?ttcgtttgtc?agtgtccagc?tggttacact?240

ggtaagagat?gtgaagttga?cactagagct?acttgttacg?aaggtcaggg?tgtcacttac?300

agaggtactt?ggtctactgc?tgaatccaga?gttgaatgta?tcaactggaa?ctcttccttg?360

ttgactagaa?gaacttacaa?cggtagaatg?ccagacgcct?tcaacttggg?tttgggtaac?420

cacaactact?gtagaaaccc?aaacggtgct?ccaaagcctt?ggtgttacgt?catcaaggct?480

ggtaagttca?cttctgaatc?ttgttctgtt?ccagtctgtt?ctaaggctac?ttgtggtttg?540

agaaagtaca?aggaaccaca?gttgcactct?actggtggtt?tggttactga?catcacttct?600

cacccttggc?aggctgctat?cttcgctcag?aacagaagat?cctctggtga?gagattcttg?660

tgtggtggta?tcttgatctc?ttcttgttgg?gtcttgactg?ctgctcactg?tttccaggaa?720

tcttacttgc?cagaccagtt?gaaggttgtc?ttgggtagaa?cttacagagt?caagccaggt?780

gaggaagagc?agactttcaa?ggtcaagaag?tacatcgttc?acaaggagtt?cgatgacgac?840

acttacaaca?acgacattgc?tttgttgcag?ttgaagtctg?actctccaca?gtgtgctcaa?900

gaatctgact?ctgttagagc?tatctgtttg?ccagaagcta?acttgcagtt?gccagactgg?960

actgaatgtg?agttgtctgg?ttacggtaag?cacaagtctt?cttctccatt?ctactctgaa?1020

cagttgaagg?aaggtcacgt?cagattgtac?ccatcttcca?gatgtgctcc?aaagttcttg?1080

ttcaacaaga?ctgttactaa?caacatgttg?tgtgctggtg?acactagatc?cggtgaaatc?1140

tacccaaacg?ttcacgacgc?ttgtcagggt?gactctggtg?gtccattggt?ctgtatgaac?1200

gacaaccaca?tgactttgtt?gggtatcatc?tcttggggtg?ttggttgtgg?tgagaaggac?1260

gttccaggtg?tctacactaa?ggttactaac?tacttgggtt?ggatcagaga?caacatgcac?1320

ttgtaa????????????????????????????????????????????????????????????1326

<210>2

<211>442

<212>PRT

＜221〉Desmoteplase alpha 1 mutant DSMa aminoacid sequence

<222>(1)…(442)

<400>2

Ala?Tyr?Gly?Val?Ala?Cys?Lys?Asp?Glu?Ile?Thr?Gln?Met?Thr?Tyr

5???????????????????10??????????????????15

Arg?Arg?Gln?Glu?Ser?Trp?Leu?Arg?Pro?Glu?Val?Arg?Ser?Lys?Arg

20??????????????????25??????????????????30

Val?Glu?His?Cys?Gln?Cys?Asp?Arg?Gly?Gln?Ala?Arg?Cys?His?Thr

35??????????????????40??????????????????45

Val?Pro?Val?Asn?Ser?Cys?Ser?Glu?Pro?Arg?Cys?Phe?Asn?Gly?Gly

50??????????????????55??????????????????60

Thr?Cys?Trp?Gln?Ala?Val?Tyr?Phe?Ser?Asp?Phe?Val?Cys?Gln?Cys

65??????????????????70??????????????????75

Pro?Ala?Gly?Tyr?Thr?Gly?Lys?Arg?Cys?Glu?Val?Asp?Thr?Arg?Ala

80??????????????????85??????????????????90

Thr?Cys?Tyr?Glu?Gly?Gln?Gly?Val?Thr?Tyr?Arg?Gly?Thr?Trp?Ser

95?????????????????100?????????????????105

Thr?Ala?Glu?Ser?Arg?Val?Glu?Cys?Ile?Asn?Trp?Asn?Ser?Ser?Leu

110?????????????????115?????????????????120

Leu?Thr?Arg?Arg?Thr?Tyr?Asn?Gly?Arg?Met?Pro?Asp?Ala?Phe?Asn

125?????????????????130?????????????????135

Leu?Gly?Leu?Gly?Asn?His?Asn?Tyr?Cys?Arg?Asn?Pro?Asn?Gly?Ala

140?????????????????145?????????????????150

Pro?Lys?Pro?Trp?Cys?Tyr?Val?Ile?Lys?Ala?Gly?Lys?Phe?Thr?Ser

155?????????????????160?????????????????165

Glu?Ser?Cys?Ser?Val?Pro?Val?Cys?Ser?Lys?Ala?Thr?Cys?Gly?Leu

170?????????????????175?????????????????180

Arg?Lys?Tyr?Lys?Glu?Pro?Gln?Leu?His?Ser?Thr?Gly?Gly?Leu?Val

185?????????????????190?????????????????195

Thr?Asp?Ile?Thr?Ser?His?Pro?Trp?Gln?Ala?Ala?Ile?Phe?Ala?Gln

200?????????????????205?????????????????210

Asn?Arg?Arg?Ser?Ser?Gly?Glu?Arg?Phe?Leu?Cys?Gly?Gly?Ile?Leu

215?????????????????220?????????????????225

Ile?Ser?Ser?Cys?Trp?Val?Leu?Thr?Ala?Ala?His?Cys?Phe?Gln?Glu

230?????????????????235?????????????????240

Ser?Tyr?Leu?Pro?Asp?Gln?Leu?Lys?Val?Val?Leu?Gly?Arg?Thr?Tyr

245?????????????????250?????????????????255

Arg?Val?Lys?Pro?Gly?Glu?Glu?Glu?Gln?Thr?Phe?Lys?Val?Lys?Lys

260?????????????????265?????????????????270

Tyr?Ile?Val?His?Lys?Glu?Phe?Asp?Asp?Asp?Thr?Tyr?Asn?Asn?Asp

275?????????????????280?????????????????285

Ile?Ala?Leu?Leu?Gln?Leu?Lys?Ser?Asp?Ser?Pro?Gln?Cys?Ala?Gln

290?????????????????295?????????????????300

Glu?Ser?Asp?Ser?Val?Arg?Ala?Ile?Cys?Leu?Pro?Glu?Ala?Asn?Leu

305?????????????????310?????????????????315

Gln?Leu?Pro?Asp?Trp?Thr?Glu?Cys?Glu?Leu?Ser?Gly?Tyr?Gly?Lys

320?????????????????325?????????????????330

His?Lys?Ser?Ser?Ser?Pro?Phe?Tyr?Ser?Glu?Gln?Leu?Lys?Glu?Gly

335?????????????????340?????????????????345

His?Val?Arg?Leu?Tyr?Pro?Ser?Ser?Arg?Cys?Ala?Pro?Lys?Phe?Leu

350?????????????????355?????????????????360

Phe?Asn?Lys?Thr?Val?Thr?Asn?Asn?Met?Leu?Cys?Ala?Gly?Asp?Thr

365?????????????????370?????????????????375

Arg?Ser?Gly?Glu?Ile?Tyr?Pro?Asn?Val?His?Asp?Ala?Cys?Gln?Gly

380?????????????????385?????????????????390

Asp?Ser?Gly?Gly?Pro?Leu?Val?Cys?Met?Asn?Asp?Asn?His?Met?Thr

395?????????????????400?????????????????405

Leu?Leu?Gly?Ile?Ile?Ser?Trp?Gly?Val?Gly?Cys?Gly?Glu?Lys?Asp

410?????????????????415?????????????????420

Val?Pro?Gly?Val?Tyr?Thr?Lys?Val?Thr?Asn?Tyr?Leu?Gly?Trp?Ile

425?????????????????430?????????????????435

Arg?Asp?Asn?Met?His?Leu?Leu

440?????442

<210>3

<211>1326

<212>DNA

＜221〉Desmoteplase alpha 1 mutant DSMb nucleotide sequence

<222>(1)…(1326)

<400>3

gcttacggtg?ttgcttgtaa?ggacgagatc?actcagatga?cttacagaag?acaagagtct?60

tggttgagac?cagaagtcag?atccaagaga?gttgaacact?gtcagtgtga?cagaggtcag?120

gctagatgtc?acactgttcc?agtcaactct?tgttctgaac?caagatgttt?caacggtggt?180

acttgttggc?aggctgtcta?cttctctgac?ttcgtttgtc?agtgtccagc?tggttacact?240

ggtaagagat?gtgaagttga?cactagagct?acttgttacg?aaggtcaggg?tgtcacttac?300

agaggtactt?ggtctactgc?tgaatccaga?gttgaatgta?tcaactggaa?ctcttccttg?360

ttgactagaa?gaacttacaa?cggtagaatg?ccagacgcct?tcaacttggg?tttgggtaac?420

cacaactact?gtagaaaccc?aaacggtgct?ccaaagcctt?ggtgttacgt?catcaaggct?480

ggtaagttca?cttctgaatc?ttgttctgtt?ccagtctgtt?ctaaggctac?ttgtggtttg?540

agaaagtaca?aggaaccaca?gttgcactct?actggtggtt?tggttactga?catcacttct?600

cacccttggc?aggctgctat?cttcgctgct?gctgctgctt?cctctggtga?gagattcttg?660

tgtggtggta?tcttgatctc?ttcttgttgg?gtcttgactg?ctgctcactg?tttccaggaa?720

tcttacttgc?cagaccagtt?gaaggttgtc?ttgggtagaa?cttacagagt?caagccaggt?780

gaggaagagc?agactttcaa?ggtcaagaag?tacatcgttc?acaaggagtt?cgatgacgac?840

acttacaaca?acgacattgc?tttgttgcag?ttgaagtctg?actctccaca?gtgtgctcaa?900

gaatctgact?ctgttagagc?tatctgtttg?ccagaagcta?acttgcagtt?gccagactgg?960

actgaatgtg?agttgtctgg?ttacggtaag?cacaagtctt?cttctccatt?ctactctgaa?1020

cagttgaagg?aaggtcacgt?cagattgtac?ccatcttcca?gatgtgctcc?aaagttcttg?1080

ttcaacaaga?ctgttactaa?caacatgttg?tgtgctggtg?acactagatc?cggtgaaatc?1140

tacccaaacg?ttcacgacgc?ttgtcagggt?gactctggtg?gtccattggt?ctgtatgaac?1200

gacaaccaca?tgactttgtt?gggtatcatc?tcttggggtg?ttggttgtgg?tgagaaggac?1260

gttccaggtg?tctacactaa?ggttactaac?tacttgggtt?ggatcagaga?caacatgcac?1320

ttgtaa????????????????????????????????????????????????????????????1326

<210>4

<211>442

<212>PRT

＜221〉Desmoteplase alpha 1 mutant DSMb aminoacid sequence

<222>(1)…(442)

<400>4

Ala?Tyr?Gly?Val?Ala?Cys?Lys?Asp?Glu?Ile?Thr?Gln?Met?Thr?Tyr

5???????????????????10??????????????????15

Arg?Arg?Gln?Glu?Ser?Trp?Leu?Arg?Pro?Glu?Val?Arg?Ser?Lys?Arg

20??????????????????25??????????????????30

Val?Glu?His?Cys?Gln?Cys?Asp?Arg?Gly?Gln?Ala?Arg?Cys?His?Thr

35??????????????????40??????????????????45

Val?Pro?Val?Asn?Ser?Cys?Ser?Glu?Pro?Arg?Cys?Phe?Asn?Gly?Gly

50??????????????????55??????????????????60

Thr?Cys?Trp?Gln?Ala?Val?Tyr?Phe?Ser?Asp?Phe?Val?Cys?Gln?Cys

65??????????????????70??????????????????75

Pro?Ala?Gly?Tyr?Thr?Gly?Lys?Arg?Cys?Glu?Val?Asp?Thr?Arg?Ala

80??????????????????85??????????????????90

Thr?Cys?Tyr?Glu?Gly?Gln?Gly?Val?Thr?Tyr?Arg?Gly?Thr?Trp?Ser

95?????????????????100?????????????????105

Thr?Ala?Glu?Ser?Arg?Val?Glu?Cys?Ile?Asn?Trp?Asn?Ser?Ser?Leu

110?????????????????115?????????????????120

Leu?Thr?Arg?Arg?Thr?Tyr?Asn?Gly?Arg?Met?Pro?Asp?Ala?Phe?Asn

125?????????????????130?????????????????135

Leu?Gly?Leu?Gly?Asn?His?Asn?Tyr?Cys?Arg?Asn?Pro?Asn?Gly?Ala

140?????????????????145?????????????????150

Pro?Lys?Pro?Trp?Cys?Tyr?Val?Ile?Lys?Ala?Gly?Lys?Phe?Thr?Ser

155?????????????????160?????????????????165

Glu?Ser?Cys?Ser?Val?Pro?Val?Cys?Ser?Lys?Ala?Thr?Cys?Gly?Leu

170?????????????????175?????????????????180

Arg?Lys?Tyr?Lys?Glu?Pro?Gln?Leu?His?Ser?Thr?Gly?Gly?Leu?Val

185?????????????????190?????????????????195

Thr?Asp?Ile?Thr?Ser?His?Pro?Trp?Gln?Ala?Ala?Ile?Phe?Ala?Ala

200?????????????????205?????????????????210

Ala?Ala?Ala?Ser?Ser?Gly?Glu?Arg?Phe?Leu?Cys?Gly?Gly?Ile?Leu

215?????????????????220?????????????????225

Ile?Ser?Ser?Cys?Trp?Val?Leu?Thr?Ala?Ala?His?Cys?Phe?Gln?Glu

230?????????????????235?????????????????240

Ser?Tyr?Leu?Pro?Asp?Gln?Leu?Lys?Val?Val?Leu?Gly?Arg?Thr?Tyr

245?????????????????250?????????????????255

Arg?Val?Lys?Pro?Gly?Glu?Glu?Glu?Gln?Thr?Phe?Lys?Val?Lys?Lys

260?????????????????265?????????????????270

Tyr?Ile?Val?His?Lys?Glu?Phe?Asp?Asp?Asp?Thr?Tyr?Asn?Asn?Asp

275?????????????????280?????????????????285

Ile?Ala?Leu?Leu?Gln?Leu?Lys?Ser?Asp?Ser?Pro?Gln?Cys?Ala?Gln

290?????????????????295?????????????????300

Glu?Ser?Asp?Ser?Val?Arg?Ala?Ile?Cys?Leu?Pro?Glu?Ala?Asn?Leu

305?????????????????310?????????????????315

Gln?Leu?Pro?Asp?Trp?Thr?Glu?Cys?Glu?Leu?Ser?Gly?Tyr?Gly?Lys

320?????????????????325?????????????????330

His?Lys?Ser?Ser?Ser?Pro?Phe?Tyr?Ser?Glu?Gln?Leu?Lys?Glu?Gly

335?????????????????340?????????????????345

His?Val?Arg?Leu?Tyr?Pro?Ser?Ser?Arg?Cys?Ala?Pro?Lys?Phe?Leu

350?????????????????355?????????????????360

Phe?Asn?Lys?Thr?Val?Thr?Asn?Asn?Met?Leu?Cys?Ala?Gly?Asp?Thr

365?????????????????370?????????????????375

Arg?Ser?Gly?Glu?Ile?Tyr?Pro?Asn?Val?His?Asp?Ala?Cys?Gln?Gly

380?????????????????385?????????????????390

Asp?Ser?Gly?Gly?Pro?Leu?Val?Cys?Met?Asn?Asp?Asn?His?Met?Thr

395?????????????????400?????????????????405

Leu?Leu?Gly?Ile?Ile?Ser?Trp?Gly?Val?Gly?Cys?Gly?Glu?Lys?Asp

410?????????????????415?????????????????420

Val?Pro?Gly?Val?Tyr?Thr?Lys?Val?Thr?Asn?Tyr?Leu?Gly?Trp?Ile

425?????????????????430?????????????????435

Arg?Asp?Asn?Met?His?Leu?Leu

440?????442

Claims (6)

1. a Desmoteplase alpha 1 mutant is characterized in that, changes 195 the amino acid that wild-type DSPA α 1 activates the ring district, and 195 phenylalanine in described wild-type DSPA α 1 peptide chain is replaced to Xie Ansuan, called after DSMa; Or on the DSMa basis, continue to change its amino acid of 210～213,210～213 four amino acid L-glutamic acid, aspartic acid, arginine, arginine in the described peptide chain are replaced to four L-Ala, called after DSMb.

2. Desmoteplase alpha 1 mutant according to claim 1 is characterized in that the nucleotide sequence of described DSMa is shown in SEQ ID NO.1.

3. Desmoteplase alpha 1 mutant according to claim 1 is characterized in that the aminoacid sequence of described DSMa is shown in SEQ IDNO.2.

4. Desmoteplase alpha 1 mutant according to claim 1 is characterized in that the nucleotide sequence of described DSMb is shown in SEQ ID NO.3.

5. Desmoteplase alpha 1 mutant according to claim 1 is characterized in that the aminoacid sequence of described DSMb is shown in SEQ ID NO.4.

6. the application of the described Desmoteplase alpha 1 mutant of claim 1 in the preparation thrombolytic drug.

Images