CN101736010B - Stress resistance NAC transcription factor gene derived from loosehead Chinese cabbage - Google Patents

Abstract

The invention discloses a stress resistance NAC transcription factor gene derived from loosehead Chinese cabbage, which has the function of enhancing plant stress resistance in culturing transgenic plants. The tolerance of transgenic BrNAC arabidopsis plant and wild arabidopsis plant to low temperature stress is compared, the frost resistance of transgenic plant is obviously better than that of wild arabidopsis plant, which shows transcription of BrNAC improves the capacity of arabidopsis plant in resisting low temperature.

Description

A kind of degeneration-resistant NAC transcription factor gene that derives from Chinese cabbage

Technical field

The present invention relates to field of crop genetic breeding, be specifically related to a kind of degeneration-resistant NAC transcription factor gene that derives from Chinese cabbage, have application in the resistance transgenic plant in cultivation.

Background technology

It is to influence growth and development of plants that biology is coerced with abiotic stress, causes one of important factor of economic yield inferior quality difference.Improve the problems in the farm crop production, need to rely on diversified genetic resources, have only excavation and utilize excellent gene, could realize the breakthrough and the progress of crop breeding.Occurring in nature, plant-growth often run into the influence of severe environment in open system, mainly contain coercing of adverse circumstances such as high light, high temperature, arid, waterlogging and high salt.In order to adapt to these environment, plant all has corresponding reaction (biology circular, 2003,38,3-4 in physiology, biochemical level and molecular cell level; Current Science, 2001,80,206-215).People are with regard to understanding and the research of adverse circumstance to the plant influence, at first be to describe from apparent physical signs is general, next studies Physiology and biochemistry, ecologic change and Physiological Mechanism in Regulation that plant produces under various adverse circumstances, develop into molecular level at last, further inquire into induction, signal conduction, genetic expression and regulation and control, protein assembling and the cell membrane function acquisition of plant different adverse circumstances.For more understanding plant in depth the molecule mechanism of different adverse circumstance responses and the aspects such as biotechnology of research artificial regulatory are shown good prospect.

Chinese cabbage (Brassica campestris L.SSP.Chinensis Makino) is that Papaverales (Rhoeadales) Cruciferae (Cruciferae) rape belongs to (Brassica) crop, originate in China, have another name called Plantula Brassicae chinensis, be commonly called as green vegetables, cabbage heart, the north also claims little rape, be a kind of main vegetables of China middle and lower reach of Yangtze River and areas to the south thereof, its cultivated area accounts for more than 30% of the vegetables total area, occupies critical role in China's " vegetable basket project ".In recent years, in northern China provinces and cities larger area introducing culture and popularization are arranged also.Thereby the research of the resistance of Chinese cabbage had great importance.

The NAC transcription factor be newfound plant specific transcription factor with multiple biological function over past ten years (the northwest Botany Gazette, 2007,27,1915-1920).Aida etc. have at first reported the NAC structural domain, find petunia NAM gene, Arabidopis thaliana ATAF1/2 and CThe N of UC2 gene coded protein end comprises one section conservative aminoacid sequence, get initial called after NAC (The Plant Cell, 1997,9,841-857).Though compare with the transcription factor of other type, NAC class transcription factor research less studies show that the NAC transcription factor is built up (Cell, 1998,92,93-103 at growth and development of plants, organ; Development, 2001,128,1127-1135; Plant Cell, 2003,15,1563-1577) with the multiple biology of defence opposing (Plant Mol.Biol., 1999,39,647-656; Plant Cell, 2000,12,1917-1925) and abiotic stress (Plant Cell, 2004,16,2481-2498; Plant J., 2004,39,863-876) etc. the aspect plays a significant role.And the research of degeneration-resistant mechanism finally can be used for improving the resistance of plant, has important significance for theories and realistic meaning.The NAC genoid is for the anti-adversity that cultivates plants, and it is extremely important particularly to cultivate disease-resistant, anti-salt and cryophylactic plant variety.

Summary of the invention

One object of the present invention is to provide a kind of degeneration-resistant NAC transcription factor gene that derives from Chinese cabbage, and this gene can be used for improving the resistance of plant.

Another object of the present invention is to provide a kind of construction process that derives from the degeneration-resistant NAC transcription factor gene of Chinese cabbage.

Another purpose of the present invention is to provide a kind of degeneration-resistant NAC transcription factor gene that derives from Chinese cabbage, is cultivating the application that improves in the stress resistance of plant.

The degeneration-resistant NAC transcription factor gene sequence that derives from Chinese cabbage of the present invention is SEQ ID No 1.

Described transcription factor gene encoded protein matter has the aminoacid sequence shown in the SEQ ID NO 2.

A kind of construction process that derives from the degeneration-resistant NAC transcription factor gene of Chinese cabbage of the present invention comprises the steps:

1) structure in Chinese cabbage cDNA RACE library

The Chinese cabbage seedling of getting robust growth adopts cold phenol method (buying in Shanghai traditional Chinese medicines chemical company) extracted total RNA.Use the magnetic bead separation system of Promega company to carry out the separation of mRNA.Utilize SMART technology (Clontech company) to synthesize cDNA first chain, the primer of use is R11464 and R11466 (GAC, CAG, TGG, TAT, CAA, CGC, AGA, GTA, CGC, GGG and GCA, GGA, CTG, CAG, CTG, ACT, GAC, TAC, TTT, TTT, TTT, TTT, TTT, TTT, TTT, TTT, TTT, TTT, VN), wherein V represents " A, G or C ", and N represents " A, T, C or G ", and VN is the arbitrary combination of its represented thymus nucleic acid.The SMART technology is operated with reference to the Clontech specification sheets.Synthetic good Chinese cabbage cDNA storehouse is stored in-70 ℃.

2) preparation of Chinese cabbage NAC gene conservative fragments

The a pair of degenerate primer R16162 of aminoacid sequence characteristic Design and R16163 (CCN, MGN, GAY according to the NAC gene conservative structural domain of the species such as Arabidopis thaliana close with the Chinese cabbage sibship, MGN, AAR, TAY, CCN, AAY, GG and TAR, NCK, RTA, YTC, RTG, CAT, DAT, CCA), be template with synthetic Chinese cabbage cDNA RACE library, carry out pcr amplification (PCR reaction system: 10 * PCR buffer, 5.0 μ L; DNTPs (each 2.5mM) 4 μ L; Chinese cabbage cDNA template 1 μ L (20ng); Primer R161620.5 μ L; Primer R16163 0.5 μ L; Ex-Taq 0.4 μ L (adding after the pre-sex change); Add sterilized water and be settled to 50 μ L.PCR response procedures: 94 ℃ of pre-sex change 10 minutes; 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 52 ℃; 72 ℃ were extended 50 seconds; Totally 35 circulations; 72 ℃ were extended 10 minutes).Obtain the fragment (Fig. 3) of a treaty 200bp, this amplified production is reclaimed rear clone go into T-carrier (buying in Dalian Bao Bio-Engineering Company), order-checking obtains the dna sequence dna of conservative fragments, is the NAC gene conservative fragments through the Blast comparison.Sequence is:

TGGGAGCTTTCCCAGCGTAGAACACGAGCGCCTTCTTAATACCCAGC

GTCTTCGGTTTACCGATCGGTTTATCAGCTCCGGTGGCTTTCCAATA

ACCGGTTCCCGCCGCCCGGTTAGGACGCGAACCGTTGGGATACTTTC

GATCACGCGG

3) the RACE method obtains Chinese cabbage NAC gene fragment

Inboard and outside nest-type PRC (Nest-PCR) according to synthetic respectively 5 ' and 3 ' the RACE amplification of the Chinese cabbage NAC gene conservative fragments sequence of having cloned.Primer is respectively R19647, R19648 and R19649, R19650.

Described primer is specially,

R19647：5’-GGA，AAG，CTC，CTA，AAG，GGA，TTA，AAA，CG-3’；

R19648：5’-CGA，ATT，GGA，TCA，TGC，ACG，AGT，ACA，GG-3’；

R19649：5’-GGA，GCT，TTC，CCA，GCG，TAA，AAG，ACT，AG-3’；

R19650：5’-CGG，TGG，CTT，TCC，AAT，AAC，CAG，TTC-3’。

4) make Chinese cabbage NAC full length sequence

By sequencing and analysis, obtain the sequence that total length is 1196bp to 5 ' and 3 ' RACE amplified fragments.According to the concrete primer of this sequences Design be,

R20215：ATG，AAT，GCA，GAG，CTG，AAC，TTA，CCT，GC；

R20216：CCC，CTG，TGG，AGC，AAA，ACT，CCA，ATT，C

This is increased from Chinese cabbage cDNA library to primer obtains the Chinese cabbage NAC gene of total length, carries out the sequencing analysis.Described design two ends primer is specially

1 CCACGCACCG?ACGATGCTGA?AGAAGCAGTG?GTATCAACGC?AGAGTCACGC?GGGGGATTAC

61 AATCTTCAGC?AGACGAAAGG?AGAAGGAAAA?AAAAAAATTG?AACGAAGAGA?TTTGAAGAGA

121 GAAAAGAGAA?AAGAATGAAT?GCAGAGCTGA?ACTTACCTGC?AGGATTCCGA?TTCCATCCAA

181 CGGACGAAGA?GCTTGTGAAA?TTCTACTTGT?GCCGGAAATG?CGCATCGGAG?GAGATCTCAG

241 CTCCGGTTAT?CGCCGAAATC?GATCTTTACA?AGTTCAATCC?TTGGGAGCTT?CCAGAGATGT

301 CTCTGTACGG?AGAGAAAGAG?TGGTATTTTT?TCTCACATAG?AGACCGGAAG?TACCCAAACG

361 GTTCGCGTCC?AAACCGGGCA?GCTGGAACTG?GTTATTGGAA?AGCCACCGGA?GCTGATAAAC

421 CGATCGGTAA?ACCGAAGACG?TTGGGTATAA?AGAAAGCGCT?AGTCTTTTAC?GCTGGGAAAG

481 CTCCTAAAGG?GATTAAAACG?AATTGGATCA?TGCACGAGTA?CAGTCTCGCT?AATGTTGACA

541 GATCAGCTTC?TGTTAACAAA?AAGAACAACC?TTCGACTTGA?TGATTGGGTG?TTATGTCGAG

601 TCTACAACAA?GAAAGGGACC?ATGGAGAAGT?ACTACCCTGC?TGATGAGAAA?CCGATGACCA

661 TGACGGCGGC?TTCATCGCCT?TTCGATGCGT?CGGACTCGAC?TTACCCGACG?TTGCAAGAGG

721 ATGACTCGAG?CAGCTCGGGG?GGTCGCGTGG?TGTCACCGGA?TGCGCGGGAG?GTTCAGAGCG

781 AGCCTAAATG?GGGGGAGTTT?GAGAATGCTT?TTGATGCTTC?CATGTTCGGT?GGTGGCTCCA

841 TGGACTTGCT?GCAGAGTGAA?GATTTTGTGC?CTCAGTTCTT?GTACCAGCCT?TTTTATGATT

901 TCAACTCCTG?GCAGGAGGAT?CCGCCGGAGC?AGAAACCGTT?CTTGAATTGG?AGTTTTGCTC

961 CACAGGGGTG?ATAAAAAGGA?TAAGAGGGAA?AGGTTTTTGG?TCTGTGTTGT?GATGTGTTAG

1021?AGAGAAGTTT?TCAATCATCT?TTTGTTTTTT?AGTAGTGAGA?GAAAGATTGT?AGAGTGTTGA

1081?TAGTTTTTTA?GCATCTTCAA?TGTTTCATTG?GTAGGTGAAT?TCTTGTTATT?TCATCAGATA

1141?TTTATATGAA?AAATTATACA?TTTTTCAAGA?AAAAAAAAAA?AAAAAAAAAA?AAAAAA

Transcription factor gene BrNAC of the present invention can be used for Plant Transformation, is cultivating the application that improves in the stress resistance of plant.

The beneficial effect that the present invention realizes:

The present invention has cloned Chinese cabbage anti-reverse transcription factor gene BrNAC.Compared the Arabidopis thaliana plant that changes the BrNAC gene and wild-type Arabidopis thaliana plant tolerance to low temperature stress.The result shows, wild-type and change BrNAC gene Arabidopis thaliana plant very big difference is arranged on survival rate, and transfer-gen plant has tangible freezing tolerance than wild-type Arabidopis thaliana, and this shows that also changing over to of BrNAC improved the cryophylactic ability of Arabidopis thaliana plant.

Description of drawings

Fig. 1 identifies the agarose gel electrophoresis figure of total RNA product;

Fig. 2 identifies the agarose gel electrophoresis figure of isolating mRNA product;

Fig. 3 detects the agarose gel electrophoresis figure of amplification conservative fragments;

Fig. 4 detects the agarose gel electrophoresis figure of 5 ' RACE amplified production;

Fig. 5 detects the agarose gel electrophoresis figure of 3 ' RACE amplified production;

Fig. 6 detects the agarose gel electrophoresis figure of the dna fragmentation of amplification total length.

Embodiment

Describe technical scheme of the present invention in detail below in conjunction with accompanying drawing.Should be noted that, described embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can make amendment or be equal to replacement the technical scheme of invention, and not breaking away from the spirit and scope of technical solution of the present invention, it all should be encompassed in the claim scope of the present invention.

Test materials and source thereof that the present invention is used comprise:

Chinese cabbage (Brassica campestris L.SSP.Chinensis Makino) seedling, 27 ℃ of phytotrons are cultivated 16h illumination cultivation fortnight.

Intestinal bacteria (Escherichia coli) DH5 α is preserved by Academy of Agricultural Sciences, Shanghai City biotechnology research institute plant genetic engineering research department.Cloning vector pMD-18-Simple T, all kinds of restriction enzyme, Taq polysaccharase, ligase enzyme, dNTP, 10 * PCR buffer and DNA marker are available from precious biotechnology Dalian company limited.All chemical reagent are all bought from U.S.'s sigma chemical company and Shanghai traditional Chinese medicines chemical reagent.ABI PRIAM Big-Dye Terminator dna sequencing kit is available from U.S. application system company.SMARTTM RACE cDNA amplification kit is bought the Clontech company in the U.S..

Molecular biology operation conventional among the present invention is specifically referring to " molecular cloning " (Molecular Cloning.2nd ed.Cold Spring Harbor Laboratory Press, 1989).

The used reagent of the present invention is not if clearly indicate, then all available from Sigma-aldrich (Sigma-Aldrich).

The extracting of embodiment 1 Chinese cabbage seedling RNA and mRNA separate

(1) test method:

The extracting of RNA:

1, grind away: in the 250mL centrifuge tube, add the 100mL extraction buffer.Take by weighing the 50g material, liquid nitrogen flash freezer is transferred to after the grinding in the extracting solution, and concuss 10min leaves standstill 15min on the vibrating machine, layering.

2, remove impurity: 4 ℃, the centrifugal 10min of 4000r/min shifts transparent supernatant homogenate to another test tube.

3, RNA precipitation

1. add in the centrifuge tube of the dehydrated alcohol of two volumes and above-mentioned supernatant liquor, mixing leaves standstill 30min on ice;

2. 4 ℃, the centrifugal 10min of 5000r/min, liquid inclines;

3. add an amount of 70% ice ethanol and suspend, 4 ℃, the centrifugal 10min of 5000r/min;

4. outwell supernatant, centrifuge tube is upside down in dry 20min on the paper of no enzyme, be dissolved in the 30mL icy water.

4, lithium chloride selective precipitation

1. the RNA aqueous solution is of short duration centrifugal, remove insolubles;

2. add the 10mL8mol/L lithium chloride, shake up, place 4 ℃ of refrigerator overnight;

3. next day, 4 ℃, 10, the centrifugal 10min of 000g;

4. carefully remove supernatant, the RNA precipitation is washed once with 70% ethanol, under the same conditions recentrifuge.

5, phenol chloroform extracting

1. with the above-mentioned RNA of exsiccant 2mL water dissolution, be sub-packed in two 1.5mL eppendorf pipes, at 4 ℃, the centrifugal 2min of 5000r/min;

2. carefully draw supernatant, to another pipe, add isopyknic phenol chloroform mixing, 4 ℃, 12, the centrifugal 10min of 000g;

3. carefully draw supernatant, to another pipe, add isopyknic chloroform mixing, 4 ℃, 12, the centrifugal 10min of 000g;

4. carefully draw supernatant, to another pipe, add the 3mol/L NaAc of 1/10 volume, the dehydrated alcohol mixing of 2 times of volumes, is placed 1h by-70 ℃.

6, the acquisition of RNA

1. from refrigerator, take out RNA, at 4 ℃, the centrifugal 15min of 12000g;

2. carefully outwell supernatant, after adding an amount of 70% ethanol precipitation being suspended, 4 ℃, 10, the centrifugal 8min of 000g;

3. dry on the paper with the no enzyme of centrifuge tube inversion;

4. add 100 μ LDEPC treated waters

Fully dissolving ,-70 ℃ of preservations.

7, detect: measure concentration and purity: get 1 μ L and be diluted to 100 μ L ultraviolet spectrophotometers survey purity and concentration; The integrity of electrophoresis detection RNA.

The removal of genomic dna:

With reference to DNase I (RNase Free) specification sheets.

1. 20-50 μ g RNA are soluble in water, add 10 * DNase buffer, 5 μ L, 5u/ μ L RNAfree DNase 2 μ L, 40u/ μ L RNase Inhibitor 0.5 μ L adds RNA free H ₂O to 50 μ L.

2. 37 ℃ are reacted 20-30min.

3. the DEPC treating water that adds 50 μ L.

4. phenol/chloroform/the primary isoamyl alcohol (25:24:1) that adds 100 μ L (equivalent), fully mixing.

5. centrifugal, get upper strata (water layer) and move in another Eppendorf tube.

6. chloroform/the primary isoamyl alcohol (24:1) that adds 100 μ L (equivalent), fully mixing.

7. centrifugal, get upper strata (water layer) and move in another Eppendorf tube.

8. the 3M NaAC (pH5.2) that adds 10 μ L (1/10 amount).

9. the dehydrated alcohol that adds 250 μ L (2.5 times of amounts) precooling is placed 30～60min for-20 ℃.

10. centrifugal recovery precipitation is washed precipitation, vacuum-drying with 70% cold dehydrated alcohol.After an amount of DEPC water treatment water dissolution, carry out agarose electrophoresis and confirm whether to remove genomic dna.

The separation of mRNA:

The polyATtract mRNA Isolation Systems purified mRNA of utilizing promega company to produce.

1, the annealing of probe

1. the total RNA with 0.1-1.0mg adds in the centrifuge tube of 1.5mL, is settled to 500 μ L with the water of no RNA enzyme;

2. 65 ℃ of water-bath 10min;

3. in RNA, add 3 μ L Biotinylated-Oligo (dT) probes and 13 μ L20 * SSC, slowly shake up, place under the room temperature up to cooling down fully.Prepare 0.5 * SSC and 0.1 * SSC (that is, sodium chloride/sodium citrate is provided by promega company) during this time.

2, the preparation of mother liquor

1. prepare 1.2mL0.5 * SSC (30 μ L20 * SSC add 1.170mL water);

2. prepare 1.4mL0.1 * SSC (7 μ L20 * SSC add 1.393mL water);

3, the magnetic bead of streptavidin mark (SA-PMPS) cleans

Magnetic bead must clean 3 times with 0.5 * SSC solution of same amount and use in 30min.

1. the thrum 0.6mL centrifuge tube bottom of adorning SA-PMPS makes it to suspend again up to disperseing fully lightly, and being put into then on the magnetic force frame magnetic bead is collected on the centrifuge tube tube wall (needs 30s) approximately;

2. carefully remove supernatant, it is centrifugal to must guard against use;

3. 0.5 * SSC solution cleans 3 times, uses 300 μ L0.5 * SSC at every turn, all uses the magnetic force frame to collect magnetic bead and the careful supernatant of removing at every turn;

4. use 100 μ L0.5 * SSC solution magnetic bead that suspends again at last.

4, collect and clean annealed Oligo (dT)/mRNA hybrid molecule

1. will hybridize among good total RNA516 μ L SA-PMPs that all adding 100 μ L handled;

2. place 10min under the room temperature, and every 1-2min puts upside down mixing 1 time lightly;

3. collect magnetic bead and the careful supernatant of removing with the magnetic force frame, do not touch and rock the SA-PMPs bead;

4. (at every turn thrum centrifuge tube bottom) lightly suspends all magnetic beads to use 300 μ L, 0.1 * SSC solution to clean magnetic bead 4 times, and last cleaning is as often as possible removed supernatant and do not touched magnetic bead.

5, the wash-out of mRNA

1. adding 100 μ L does not have the water of RNase, flicks the centrifuge tube bottom SA-PMPs magnetic bead is suspended again;

2. the magnetic force frame is collected SA-PMPs, collects wash-out mRNA in new centrifuge tube;

3. adding 150 μ L does not have the water of RNase, repeats 1. and 2., merges elutriant and amount to 250 μ L.

6, the acquisition of mRNA

1. the 3mol/L NaAc that in the centrifuge tube of elutriant, adds 1/10 volume, dextran 10 μ L, 2 times of volume dehydrated alcohols;

2. be placed on-70 ℃ of 2h;

3. 4 ℃, 12, the centrifugal 18min of 000g outwells supernatant, adds 70% ethanol, 400 μ L mixings, and 4 ℃, 12, the centrifugal 8min of 000g;

4. outwell supernatant, drying is with 10 μ L water dissolution.

(2) test-results:

That 1, adopts that agarose gel electrophoresis identifies total RNA product the results are shown in Figure 1, visible significantly RNA band among the figure.

2, employing agarose gel electrophoresis evaluation mRNA product the results are shown in Figure 2, visible significantly mRNA band among the figure.

The method of embodiment 2 PCR obtains Chinese cabbage NAC gene conservative fragments

(1) test method:

The a pair of degenerate primer R16162 of aminoacid sequence characteristic Design and R16163 (5 '-CCN, MGN, GAY according to the NAC gene conservative structural domain of the species such as Arabidopis thaliana close with the Chinese cabbage sibship, MGN, AAR, TAY, CCN, AAY, GG-3 ' and 5 '-TAR, NCK, RTA, YTC, RTG, CAT, DAT, CCA-3 '), be template with synthetic Chinese cabbage cDNA RACE library, carry out pcr amplification.

PCR reaction system: 10 * PCR buffer, 5.0 μ L; DNTPs (each 2.5mM) 4 μ L; Chinese cabbage cDNA template 1 μ L (20ng); Primer R16162 0.5 μ L; Primer R16163 0.5 μ L; Ex-Taq 0.4 μ L (adding after the pre-sex change); Add sterilized water and be settled to 50 μ L.PCR response procedures: 94 ℃ of pre-sex change 10 minutes; 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 52 ℃; 72 ℃ were extended 50 seconds; Totally 35 circulations; 72 ℃ were extended 10 minutes.

(2) test-results:

Adopting agarose gel electrophoresis to detect amplified production is the fragment (Fig. 3) of a treaty 200bp, this amplified production is reclaimed rear clone go into the T-carrier, and order-checking obtains the dna sequence dna of conservative fragments

TGGGAGCTTTCCCAGCGTAGAACACGAGCGCCTTCTTAATACCCAGC

GTCTTCGGTTTACCGATCGGTTTATCAGCTCCGGTGGCTTTCCAATAA

CCGGTTCCCGCCGCCCGGTTAGGACGCGAACCGTTGGGATACTTTCG

ATCACGCGG。

Embodiment 3 RACE methods obtain the full length fragment of Chinese cabbage NAC gene

(1) test method:

According to inboard and the outside nest-type PRC primer R19647 that synthetic respectively 5 ' and the 3 ' RACE of the NAC gene conservative fragments sequence of the Chinese cabbage of having cloned increases, R19648 and R19649, R19650.Concrete sequence is R19647:5 '-GGA, AAG, CTC, CTA, AAG, GGA, TTA, AAA, CG-3 '; R19648:5 '-CGA, ATT, GGA, TCA, TGC, ACG, AGT, ACA, GG-3 '; R19649:5 '-GGA, GCT, TTC, CCA, GCG, TAA, AAG, ACT, AG-3 '; R19650:5 '-CGG, TGG, CTT, TCC, AAT, AAC, CAG, TTC-3 '.

1) first round PCR (5 ' RACE).PCR reaction system: 10 * PCR buffer, 5.0 μ L; DNTPs (each 2.5mM) 4 μ L; Chinese cabbage cDNA template 1 μ L (20ng); Primer R16325 (GGT, GGT, AGG, ATC, CGA, CCA, GTG, GTA, TCA, ACG, CAG) 0.5 μ L; Primer R196490.5 μ L; Ex-Taq 0.4 μ L (adding after the pre-sex change); Add sterilized water and be settled to 50 μ L.PCR response procedures: 94 ℃ of pre-sex change 10 minutes; 94 ℃ of sex change 30 seconds; Annealed 45 seconds for 55 ℃; 72 ℃ were extended 90 seconds; Totally 35 circulations; 72 ℃ were extended 10 minutes.

2) second take turns nest-type PRC amplification (5 ' RACE).PCR reaction system: 10 * PCR buffer5.0 μ L; DNTPs 4 μ L (each 2.5mM); First round PCR product (diluting 10 times) 1 μ L; Primer R16323 (AGG, ATC, CGA, CCA, GTG, GTA, TCA, ACG, CAG, AGT, AC) 0.5 μ L; Primer R196500.5 μ L; Ex-Taq0.4 μ L; Add sterilized water and be settled to 50 μ L.PCR response procedures: 94 ℃ of sex change 30 seconds; Annealed 45 seconds for 52 ℃; 72 ℃ were extended 90 seconds; Totally 35 circulations; 72 ℃ were extended 10 minutes.

Carry out the amplification of 3 ' RACE nest-type PRC according to follow procedure:

1) first round PCR (3 ' RACE).PCR reaction system: 10 * PCR buffer, 5.0 μ L; DNTPs (each 2.5mM) 4 μ L; Chinese cabbage cDNA template 1 μ L (20ng); Primer R16326 (GGT, GGT, AGA, GCT, CGC, AGG, ACT, GCA, GCT, GAC, TG) 0.5 μ L; Primer R196470.5 μ L; Ex-Taq0.4 μ L (adding after the pre-sex change); Add sterilized water and be settled to 50 μ L.PCR response procedures: 94 ℃ of pre-sex change 10 minutes; 94 ℃ of sex change 30 seconds; Annealed 45 seconds for 55 ℃; 72 ℃ were extended 90 seconds; Totally 35 circulations; 72 ℃ were extended 10 minutes.

2) second take turns nest-type PRC amplification (3 ' RACE).PCR reaction system: 10 * PCR buffer5.0 μ L; DNTPs 4 μ L (each 2.5mM); First round PCR product (diluting 10 times) 1 μ L; Primer R16324 (AGA, GCT, CGC, AGG, ACT, GCA, GCT, GAC, TGA, CTA, C) 0.5 μ L; Primer R19648 0.5 μ L; Ex-Taq 0.4 μ L; Add sterilized water and be settled to 50 μ L.PCR response procedures: 94 ℃ of sex change 30 seconds; Annealed 45 seconds for 52 ℃; 72 ℃ were extended 90 seconds; Totally 35 circulations; 72 ℃ were extended 10 minutes.

(2) test-results:

Adopt agarose gel electrophoresis to detect 5 ' RACE amplification and obtain an about 750bp band (Fig. 4).

Adopt agarose gel electrophoresis to detect 3 ' RACE amplification and also obtain an about 700bp band (Fig. 5).

Embodiment 4 Chinese cabbage NAC full length gene sequences obtain and analyze

(1) test method:

Above-mentioned amplified production is reclaimed rear clone respectively go into the T-carrier, splice after the order-checking.According to the Chinese cabbage NAC gene order of splicing, (sequence is respectively: ATG, AAT, GCA for design two ends primer R20215 and R20216, GAG, CTG, AAC, TTA, CCT, GC and CCC, CTG, TGG, AGC, AAA, ACT, CCA, ATT, C), the performing PCR of going forward side by side amplification obtains the Chinese cabbage NAC gene fragment of total length.Above-mentioned amplified production is reclaimed rear clone respectively go into the T-carrier, carry out sequencing analysis.

(2) test-results:

Adopt agarose gel electrophoresis to detect the about 1200bp of dna fragmentation (Fig. 6) that amplification obtains total length.

The sequencing analysis result shows that Chinese cabbage NAC genes encoding reads frame and be made of 278 the amino acid whose protein of encoding 837bp.Concrete gene order and aminoacid sequence are as follows:

The NAC gene order in Chinese cabbage source:

1 CCACGCACCG?ACGATGCTGA?AGAAGCAGTG?GTATCAACGC?AGAGTCACGC?GGGGGATTAC

61 AATCTTCAGC?AGACGAAAGG?AGAAGGAAAA?AAAAAAATTG?AACGAAGAGA?TTTGAAGAGA

121 GAAAAGAGAA?AAGAATGAAT?GCAGAGCTGA?ACTTACCTGC?AGGATTCCGA?TTCCATCCAA

181 CGGACGAAGA?GCTTGTGAAA?TTCTACTTGT?GCCGGAAATG?CGCATCGGAG?GAGATCTCAG

241 CTCCGGTTAT?CGCCGAAATC?GATCTTTACA?AGTTCAATCC?TTGGGAGCTT?CCAGAGATGT

301 CTCTGTACGG?AGAGAAAGAG?TGGTATTTTT?TCTCACATAG?AGACCGGAAG?TACCCAAACG

361 GTTCGCGTCC?AAACCGGGCA?GCTGGAACTG?GTTATTGGAA?AGCCACCGGA?GCTGATAAAC

421 CGATCGGTAA?ACCGAAGACG?TTGGGTATAA?AGAAAGCGCT?AGTCTTTTAC?GCTGGGAAAG

481 CTCCTAAAGG?GATTAAAACG?AATTGGATCA?TGCACGAGTA?CAGTCTCGCT?AATGTTGACA

541 GATCAGCTTC?TGTTAACAAA?AAGAACAACC?TTCGACTTGA?TGATTGGGTG?TTATGTCGAG

601 TCTACAACAA?GAAAGGGACC?ATGGAGAAGT?ACTACCCTGC?TGATGAGAAA?CCGATGACCA

661 TGACGGCGGC?TTCATCGCCT?TTCGATGCGT?CGGACTCGAC?TTACCCGACG?TTGCAAGAGG

721 ATGACTCGAG?CAGCTCGGGG?GGTCGCGTGG?TGTCACCGGA?TGCGCGGGAG?GTTCAGAGCG

781 AGCCTAAATG?GGGGGAGTTT?GAGAATGCTT?TTGATGCTTC?CATGTTCGGT?GGTGGCTCCA

841 TGGACTTGCT?GCAGAGTGAA?GATTTTGTGC?CTCAGTTCTT?GTACCAGCCT?TTTTATGATT

901 TCAACTCCTG?GCAGGAGGAT?CCGCCGGAGC?AGAAACCGTT?CTTGAATTGG?AGTTTTGCTC

961 CACAGGGGTG?ATAAAAAGGA?TAAGAGGGAA?AGGTTTTTGG?TCTGTGTTGT?GATGTGTTAG

1021?AGAGAAGTTT?TCAATCATCT?TTTGTTTTTT?AGTAGTGAGA?GAAAGATTGT?AGAGTGTTGA

1081?TAGTTTTTTA?GCATCTTCAA?TGTTTCATTG?GTAGGTGAAT?TCTTGTTATT?TCATCAGATA

1141?TTTATATGAA?AAATTATACA?TTTTTCAAGA?AAAAAAAAAA?AAAAAAAAAA?AAAAAA

The amino acid sequence coded of the NAC gene in Chinese cabbage source, represent with single-letter:

MNAELNLPAG?FRFHPTDEEL?VKFYLCRKCA?SEEISAPVIA?EIDLYKFNPW?ELPEMSLYGE

KEWYFFSHRD?RKYPNGSRPN?RAAGTGYWKA?TGADKPIGKP?KTLGIKKALV?FYAGKAPKGI

KTNWIMHEYS?LANVDRSASV?NKKNNLRLDD?WVLCRVYNKK?GTMEKYYPAD?EKPMTMTAAS

SPFDASDSTY?PTLQEDDSSS?SGGRVVSPDA?REVQSEPKWG?EFENAFDASM?FGGGSMDLLQ

SEDFVPQFLY?QPFYDFNSWQ?EDPPEQKPFL?NWSFAPQG

Embodiment 5: Arabidopis thaliana transforms

(1) test method:

1. electric shocking method transforms Agrobacterium

1) preparation Agrobacterium GV3101 competence, method is with reference to MicroPulser ^TMElectroporationApparatus Operating Instructions and Application Guide (BIO-RAD company) (Raineri et al., Bio.Tech., 1990,8:33-38).

2) get 50 μ L GV3101 competent cells, add 1 μ L DNA, change 0.2cm electric shock cup over to and transform (400 Ω, 2.5KV, 25 μ f).Add LB substratum that 1mL contains 1% N.F,USP MANNITOL recover to cultivate 2 hours (28 ℃, 250rpm).Get 10 μ L, 100 μ L respectively and be coated with LB flat board (Rifampin 50 μ g/mL, gentamicin 50 μ g/mL, paraxin 100 μ g/mL).

2. vegetable material

The environmental Arabidopis thaliana Columbia of wild-type Arabidopis thaliana (Arabidopsis thaliana).

3. the cultivation of Arabidopis thaliana

1) the Arabidopis thaliana seed is 4 ℃ of vernalization treatment of carrying out 2-3 days, purpose be help seed consistent sprout and the florescence in advance.

2) vermiculite, black earth, perlite are mixed thoroughly in 9: 3: 0.5 ratio, behind high-temperature sterilization, be loaded on the little basin of plastics of 10cm, soak stand-by with nutritive medium PNS.

3) with toothpick Arabidopis thaliana seed point is sowed on the moistening matrix, preservative film seals.Be positioned over 22 ℃ of dark cultivations 2-3 days, treat seed germination after, open preservative film, place 22 ℃ of culturing room to carry out 16 hours illumination cultivation.

4) behind the Arabidopis thaliana bolting and behind the bolting two weeks and transform after need soak once with the PNS nutritive medium again.Can suitably water according to circumstances midway.Need cut off mossy just first behind the bolting, be beneficial to the growth of time mossy, can be used for transforming (carefully running the biology magazine, 1991,13,97-101) when inferior mossy grows to 2-10cm (minority is bloomed).

4. Arabidopis thaliana dips in colored method conversion

1) the colored tongue of Arabidopis thaliana is immersed in the penetrating fluid, stirred gently after about 5～10 seconds and take out, after all conversion finishes, add the PNS nutritive medium in the pallet, seal, keep moist environment with black plastic bag flower-pot cover, place under the low light intensity of 22 ℃ of culturing room and grew 24 hours, can normally cultivate.

2) transform four days for the first time after, can once transform again, repeat twice, total cotransformation three times can transform at the different times of flower development like this, improves transformation efficiency.

3) growth is collected seed approximately after two months, and 4 ℃ of freezer storages are stand-by.

5. the screening of Arabidopis thaliana transformed plant seed

1) claim 25-30mg seed to put into the 1.5mL centrifuge tube.

2) 1mL 75% ethanol disinfection 1min (not stopping to rock vibration), centrifugal 5 seconds of 8000rpm removes supernatant.

3) the chlorinated lime sterilization 15min (not stopping to rock vibration, sufficiently sterilised) after adding 1mL filters, centrifugal 5 seconds of 8000rpm removes supernatant.

4) the sterilized water washing is 3-4 times.

5) seed is sowed uniformly on the 1/2MS flat board (Hyg50 μ g/mL), the Parafilm film seals, and 4 ℃ of refrigerators were placed two days, and 22 ℃, illumination cultivation was 6 days in 16 hours.

6) resistant plant is transplanted in the basin cultivates, after seedling is big slightly, carry out that GUS is active to be detected, select positive plant (T ₁) continue to cultivate, and collect seed and carry out T ₂Generation and T ₃The generation screening.

6. the degeneration-resistant analysis behind the transcription factor gene BrNAC conversion plant

Wild-type and transfer-gen plant 22 ℃ of three weeks of growth are used for the low-temperature resistance experiment, wild-type and transfer-gen plant were cultivated 48 hours under 4 ℃ of refrigerators, be put into-20 ℃ of freezing 20min then, and then put back to 4 ℃ of refrigerators and place the recovery of spending the night, put back to culturing room again and recover to cultivate in second day.The result shows that the survival rate of wild-type and transgenic arabidopsis plant has very big difference.

(2) test-results:

Arabidopis thaliana transforms the back growth approximately after two months, the knot of can normally blooming through dipping in colored method.The transgenosis of the freeze proof processing of process and the survival rate of wild-type Arabidopis thaliana are as shown in table 1.

The freeze proof back survival rate of table 1 transgenosis and wild-type Arabidopis thaliana

Sequence table

＜110〉Academy of Agricultural Sciences, Shanghai City

＜120〉a kind of degeneration-resistant NAC transcription factor gene that derives from Chinese cabbage

<130>0811542

<160>2

<170>PatentIn?version?3.3

<210>SEQ?ID?No?1

<211>1196

<212>DNA

＜213〉come from the degeneration-resistant relevant transcription factor gene of Chinese cabbage BrNAC

<400>1

<210>SEQ?ID?No?2

<211>278

<212>PRT

＜213〉Chinese cabbage BrNAC transcription factor gene encoded protein matter

<400>2

Claims (4)

1. degeneration-resistant NAC transcription factor gene that derives from Chinese cabbage, its concrete sequence is shown in SEQID No 1.

2. the degeneration-resistant NAC transcription factor gene that derives from Chinese cabbage according to claim 1 is characterized in that its protein sequence is shown in SEQ ID No 2.

3. the preparation method who derives from the degeneration-resistant NAC transcription factor gene of Chinese cabbage as claimed in claim 1 comprises the steps:

1) structure in Chinese cabbage cDNA RACE library, the Chinese cabbage seedling of getting robust growth adopts cold phenol method extracted total RNA, uses the magnetic bead separation system to carry out the separation of mRNA, utilizes the SMART technology to synthesize cDNA first chain, the primer that uses is R11464:GAC, CAG, TGG, TAT, CAA, CGC, AGA, GTA, CGC, GGG and R11466:GCA, GGA, CTG, CAG, CTG, ACT, GAC, TAC, TTT, TTT, TTT, TTT, TTT, T TT, TTT, TTT, TTT, TTT, VN, wherein, V represents " A; G or C ", and N represents " A; T; C or G ", and VN is the arbitrary combination of its represented thymus nucleic acid;

2) preparation of Chinese cabbage NAC gene conservative fragments, with synthetic Chinese cabbage cDNA RACE library is template, the a pair of degenerate primer that uses the aminoacid sequence characteristic Design is to R16162:5 '-CCN MGN GAY MGN AAR TAY CCN AAY GG-3 ' and R16163:5 '-TAR NCK RTA YTC RTG CAT DAT CCA-3 ', carry out pcr amplification, this amplified production reclaims rear clone and goes into the T-carrier, be the NAC gene conservative fragments through the Blast comparison, sequence is: TGGGAGCTTTCCCAGCGTAGAACACGAGCGCCTTCTTAATACCCAGCGTCTTCG GTTTACCGATCGGTTTATCAGCTCCGGTGGCTTTCCAATAACCGGTTCCCGCCGC CCGGTTAGGACGCGAACCGTTGGGATACTTTCGATCACGCGG;

Wherein, the reaction system of described pcr amplification is: 10 * PCR buffer, 5.0 μ L, and dNTPs 4 μ L, Chinese cabbage cDNA template 1 μ L, primer R161620.5 μ L, primer R161630.5 μ L, Ex-Taq0.4 μ L adds sterilized water and is settled to 50 μ L; The response procedures of described pcr amplification is: 94 ℃ of pre-sex change 10 minutes, and 94 ℃ of sex change 30 seconds, 52 ℃ of annealing 30 seconds, 72 ℃ were extended 50 seconds, totally 35 circulations, 72 ℃ were extended 10 minutes;

3) the RACE method obtains Chinese cabbage NAC gene fragment, uses inboard and the outside nest-type PRC of two pairs of primers to synthetic respectively 5 ' and 3 ' the RACE amplification of Chinese cabbage NAC gene conservative fragments sequence, obtains the sequence that total length is 1196bp;

Wherein, described two pairs of primers are respectively 5 '-GGA AAG CTC CTA AAG GGA TTA AAA CG-3 '; 5 '-CGA ATT GGA TCA TGC ACG AGT ACA GG-3 ' and 5 '-GGA GCT TTC CCA GCG TAA AAG ACT AG-3 '; 5 '-CGG TGG CTT TCC AAT AAC CAG TTC-3 ';

4) make Chinese cabbage NAC full length sequence, obtaining total length with 5 ' and 3 ' RACE amplification is the Chinese cabbage NAC gene that a pair of primer of sequences Design pcr amplification from Chinese cabbage cDNA library of 1196bp obtains total length, wherein, described primer is 5 '-ATGAATGCAGA GCTGAACTTACCTGC-3 ' and 5 '-CCCCTGTGGAGCAAAACTCCAATTC-3 '.

4. the degeneration-resistant NAC transcription factor gene that derives from Chinese cabbage according to claim 1 and 2 has application in the frost resistance plant in cultivation.

Images