CN101717744B - Gene recombination bacillus amyloliquefaciens and microbial inoculum preparation method - Google Patents
Gene recombination bacillus amyloliquefaciens and microbial inoculum preparation method Download PDFInfo
- Publication number
- CN101717744B CN101717744B CN2009102271971A CN200910227197A CN101717744B CN 101717744 B CN101717744 B CN 101717744B CN 2009102271971 A CN2009102271971 A CN 2009102271971A CN 200910227197 A CN200910227197 A CN 200910227197A CN 101717744 B CN101717744 B CN 101717744B
- Authority
- CN
- China
- Prior art keywords
- vgb
- bacillus amyloliquefaciens
- sterilization
- pcr
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses gene recombination bacillus amyloliquefaciens and a microbial inoculum preparation method. A bacillus amyloliquefaciens FZB42 strain is taken as a host bacterium to construct the gene recombination bacillus amyloliquefaciens XLV09-1 with transparent vitreoscilla hemoglobin which is regulated and controlled by a P43 strong promoter by contrasting a gene recombination vector. The produced spore number of microbial inoculum prepared by fermenting the bacillus amyloliquefaciens can reach more than 100 hundred millions per milliliter, the overall yield of antibacterial lipopeptid reaches more than 1 gram per liter and prevention effect on various fungal plant diseases is improved by over 30 percent. The microbial inoculum is a green microecological preparation, of no toxic residue, safe to human and livestock, and favorable for protecting the ecological environment.
Description
Technical field
The present invention relates to short engineering bacteria and the bacterial preparation process of giving birth to of a kind of plant disease-resistant, especially relate to a kind of recombination bacillus amyloliquefaciens and bacterial preparation process that contains Vitreoscilla hemoglobin gene.
Background technology
In the agriculture prodn, the usage quantity of chemical pesticide and chemical fertilizer increases year by year, causes problems such as environmental pollution, ecological degeneration, soil compaction and Soil degradation, and food safety, human health and agricultural sustainable development have been constituted huge threat and challenge.Therefore, the development sustainability is agriculture, will reduce the usage quantity of chemical pesticide and chemical fertilizer, seeks effective substitute.
Microbial pesticide and microbial fertilizer have long, free from environmental pollution, characteristics such as cost is low of lasting period, are the most effectively substitutes of chemical pesticide and chemical fertilizer.Reasonable development and utilize microbial pesticide and microbial fertilizer is the important channel of China's agricultural sustainable development.
Plant rhizosphere urge endophytic bacteria (Plant Growth Promoting Rhizobacteria, be called for short PGPR) be a kind of existence in roots of plants circle scope, plant-growth is had the general designation that promotes or pathogenic bacteria had the beneficial bacteria of antagonistic action.PGPR can strengthen the decomposition of organic substance in the soil in the gathering of plant rhizosphere, promotes the mineralising of plant nutrient, strengthens the supply to crop alimentary.The plant hormone that some PGPR bacterial strain produces can promote plant root growth; Enhance root system absorbs the ability of mineral nutrition and moisture; Thereby reach the regulation and control plant growth, strengthen resistance, reach the purpose that improves output, improves quality, reduces the chemical fertilizer use, increases soil fertility.Simultaneously, PGPR decides to grow the generation and the propagation that can suppress crop pathogens to a certain extent at rhizosphere.
Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) is a kind of sick bacterium of the short biological and ecological methods to prevent plant disease, pests, and erosion of many plant rhizospheres of studying.It can promote the growth of plant root, and enhancing crop improves the output of crop to the tolerance of abiotic factor (for example high salinity and lack of water etc.) and biotic factor (biopathogen body).Its operation mechanism is, based on through discharging growth hormone and other plant hormone, like indole-3-acetic acid (IAA), stimulates and promotes plant growth; The phytic acid that can produce simultaneously in the outer Sumizyme PHY decomposition of the born of the same parents soil is that plant provides growth essential phosphorus; Can also produce and have a liking for iron element (Siderophore) and provide iron-have a liking for iron plain complex body to plant; Thereby increase the absorption of plant, can also produce nitrogenase, can the nitrogen of rhizosphere be supplied with crop iron nutrition; In addition; Can also be to making deposits yields inducible system resistance (Induced systemic resistance; ISR); Raising can also be secreted lipopeptide antibiotics such as chitinase, LSD and secondary metabolite surfactivity plain (surfcatin), iturin (iturin), fragrant shepherd's purse plain (fengycin) and bacillomycin Bacillomycin D simultaneously to the resistance of plant pest, plays the prevention Plant diseases and suppresses the phytopathogen effect.
Bacillus amyloliquefaciens is a kind of high aerobic bacteria, in its industrial fermentation middle and later periods, causes oxygen supply not enough because cell density is excessive, influences the growth of thalline and synthesizing of secondary lipopeptide antibiotic.In addition, after being manured into soil,, can influence the growth and the colonization ability of this thalline, and then influence its disease prevention growth-promoting effect if oxygen content is low in the soil.
Vitreoscilla hemoglobin (Vitreoscilla hemoglobin; VHb) be a kind of solubility oxyphorase that produces by Vitreoscilla (Vitreoscilla sp.); This oxyphorase can be induced synthetic under the oxygen deprivation condition in a large number, and Vitreoscilla can be survived under little oxygen condition well.Vitreoscilla hemoglobin successfully is cloned in the various bacteria, and the expression of VHb has improved host's hypoxia-resistant capacity, has improved the density of thalline and the output of meta-bolites.After the Feng Liang of 2008 time middle peasant agriculture universities etc. change the vgb gene over to bacillus thuringiensis; Its thalline quantity and insecticidal crystal protein output have improved 1.59 times and 3.13 times respectively under the hypoxemia fermentation condition; 1996; After Pa μ li etc. changed the vgb gene over to product glycase subtilis 1012M15, its fermentation back thalline quantity and amylase activity had improved 30% and 17% respectively.2000, the Wen Ying of China Agricultural University etc. changed the vgb gene in Avid kyowamycin (S.avermiti lis) and the Chinese cassia tree ground streptomycete (S.cinnamonensis) over to, have improved antibiotic output.2003, Bhave etc. confirmed that the expression of VHb in yeast (Y.lipolytica) makes cell have higher growth rate, strengthened the oxygen effciency of respiratory, and improved breathing usefulness.
Summary of the invention
The object of the present invention is to provide a kind of utilization ratio to oxygen high, spore number and high recombination bacillus amyloliquefaciens and the bacterial preparation process of antibacterial lipopeptid output are produced in fermentation.
The objective of the invention is to realize through following technical scheme:
The present invention's recombination bacillus amyloliquefaciens obtains through following method: with Vitreoscilla hemoglobin gene vgb, place strong promoter P through overlap extension pcr
43Regulation and control under; Be building up among the recombination integrative vector pDGP43-vgb; Upstream and downstream two ends homology arm through the bacillus amyloliquefaciens alpha-amylase gene amyE that contains among the recombination integrative vector pDGP43-vgb;-P43-vgb-fragment is incorporated on the karyomit(e) of the sick bacterium bacillus amyloliquefaciens of the short biological and ecological methods to prevent plant disease, pests, and erosion of wild-type plant FZB42, obtains recombination bacillus amyloliquefaciens XLV09-1 (Bacillus amyloliquefaciens XLV09-1); Said recombination bacillus amyloliquefaciens XLV09-1 preservation date: on December 10th, 2009, depositary institution: Chinese typical culture collection center (being called for short CCTCC); The depositary institution address: Wuhan, Luo Jiashan is in the Wuhan University; Deposit number: CCTCC M209299.
The present invention's bacterial preparation process is: utilize recombination bacillus amyloliquefaciens XLV09-1 in production and application process; Express activated VHb albumen; The main technique flow process comprises actication of culture, first class seed pot fermentation culture, secondary seed jar fermentation culture and produces and use fermentor cultivation, specifically may further comprise the steps:
(1) actication of culture
With the bacillus amyloliquefaciens XLV09-1 streak inoculation of preservation on solid seed culture medium inclined-plane; The flat bottle that substratum will be housed before the inoculation was sterilized 30 minutes under 121 ℃ of conditions; 30～48h is cultivated in the inoculation back under 28～35 ℃ of conditions; Be made into spore liquid, the inoculum size with 5% is used for the seeding tank inoculation;
(2) seeding tank fermentation
With the first class seed pot sterilization, sterilization again is cooled to 30 ℃ behind the substratum of packing into, and spore liquid is inserted in the nutrient solution earlier, feeds sterile air and cultivates, and can get the first class seed pot zymocyte liquid; With secondary seed jar sterilization 30min under 121 ℃; The sterilization again behind the substratum of packing into is cooled to 30 ℃, and the first class seed pot fermented liquid is inserted the secondary seed jar by 5%～8% inoculum size; Feed sterile air and stirring and cultivate, can get secondary seed jar zymocyte liquid;
(3) production fermentor cultivation
With the fermentor tank sterilization, sterilize behind the substratum of packing into earlier, pressurize is cooled to 25 ℃～30 ℃ again, and the inoculum size by 5%～8% inserts secondary seed jar fermented liquid in the fermentor tank and cultivates, through sterile air;
(4) concentrate
Fermentation cylinder for fermentation concentrates, adds Synergistic additives, subsequent bottling with bacterium liquid through ultrafiltration after finishing;
High pressure steam sterilization is adopted in sterilization, promptly at 121 ℃, and pressure 0.3～0.5kg/cm
2The 30min that sterilizes under the condition after the fermentor tank inoculation, cultivated 36～48 hours air flow 1～2Vols/vol/min, oxygen content 30～40% under 28～35 ℃ of conditions;
The seed tank culture liquid formula: Carnis Bovis seu Bubali cream 0.3～0.8%, peptone 0.7～1.2%, glucose 0.1～0.6%, NaCl 0.1～0.6%, MgSO
47H
2O 0.01～0.06%, K
2HPO
40.01%～0.06%, MnSO
40.02%～0.08%, Yu Weishui, pH value sterilization is preceding 7.0～7.8, and sterilization is pH6.8～7.5 afterwards;
Fermentor cultivation based formulas: glucose 2～8%, L-Sodium Glutamate 0.3～1.5%, KH
2PO
40.08～0.22%, K
2HPO
40.10～2.2%, CaCO
30.1～2.20%, FeSO
47H
2O 0.001～0.005%, Yu Weishui, and pH value sterilization is preceding 8.5～11.0, sterilization afterwards 6.5～9.5;
Fermented liquid requires: fermented liquid contains brood cell's number alive and reaches more than 8,000,000,000 for every milliliter, puts jar during biomass less than 5%, pH value 7.0-8.0, no living contaminants;
Said per-cent is weight percentage.
The Vitreoscilla hemoglobin functional verification:
1.Western-Blot detect the expression of Vitreoscilla hemoglobin gene
With the target Vitreoscilla hemoglobin immune rabbit of purifying, obtain to be connected with horseradish peroxidase behind the antibody formation enzyme len antibody; With the bacterium of cultivating with ultrasonication after, with change film behind the total protein electrophoresis, with antibody hybridization, wash-out, colour developing have determined whether that VHb expresses.
2. the biological activity of Vitreoscilla hemoglobin
Whether the VHb that detect to express through carbon monoxide differential spectra method biologically active.
3. the detection of engineering bacteria growing state
Be coated with the product spore number after flat band method is measured fermentation through blood counting chamber and dilution.
4, the mensuration of antibacterial lipopeptid output and anti-mycotic activity thereof
Adopt HPLC to measure the output of antibacterial lipopeptid, adopt dull and stereotyped bacteriostatic test to measure the anti-mycotic activity of antibacterial lipopeptid simultaneously.
The present invention utilizes the expression of Vitreoscilla hemoglobin gene in bacillus amyloliquefaciens, has improved the utilization ratio of bacillus amyloliquefaciens to oxygen.
The present invention's plant growth-promoting diseases prevention engineering bacteria recombination bacillus amyloliquefaciens microbial inoculum is a kind of bacillus amyloliquefaciens preparation that produces Vitreoscilla hemoglobin, is environment friendly agricultural, no residual hazard, and to people, animal safety, favourable preserving the ecological environment.
The present invention compares with existing short biological and ecological methods to prevent plant disease, pests, and erosion germ microbial inoculum and has the following advantages:
(1), produce spore quantity height: brood cell's content of the recombination bacillus amyloliquefaciens of said preparation has improved 14.49% than original strain, reaches more than 10,000,000,000/ml;
(2), antibacterial lipopeptid output is high: the antibiotic total lipopeptid output of engineering bacteria reaches more than the 1g/L, and good anti-bacterial effect improves 30%～60% than conventional biocontrol strain;
(3), genetic stability is higher: because foreign gene is to be integrated directly on the karyomit(e) of host bacterium, thus produce with use in, heredity that foreign gene can be stable and expression.The entrained hemoglobin gene of engineering bacteria is all harmless to people, animal.
Bacillus amyloliquefaciens XLV09-1 preservation date, depositary institution's full name and abbreviation, deposit number
Preservation date: on December 10th, 2009;
Depositary institution: Chinese typical culture collection center, be called for short CCTCC;
Deposit number: CCTCC M209299.
Description of drawings
Fig. 1 is P
43The structure schema of the overlapping extension splicing of promotor and vgb and intermediate carrier pMD-P43vgb and recombination and integration carrier pDGP43-vgb;
Fig. 2 is pcr amplification and the overlapping extension PCR collection of illustrative plates of P43 promotor and vgb;
Fig. 3 cuts the evaluation collection of illustrative plates for the enzyme of intermediate carrier pMD-P43vgb;
Fig. 4 cuts the evaluation collection of illustrative plates for the enzyme of reorganization integrative vector pDGP43-vgb;
Fig. 5 is the part order-checking collection of illustrative plates of reorganization integrative vector pDGP43-vgb;
Fig. 6 is P
43Promotor and vgb merge the synoptic diagram that fragment is incorporated into genetic stability on the bacillus amyloliquefaciens karyomit(e);
Fig. 7 identifies collection of illustrative plates for the PCR of recombination bacillus amyloliquefaciens of the present invention;
Fig. 8 measures figure for the amylase activity of recombination bacillus amyloliquefaciens of the present invention and starting strain;
Fig. 9 is a recombination bacillus amyloliquefaciens fermentation manufacturing technique schema of the present invention;
Figure 10 expresses SDS-PAGE and the Western-Blot collection of illustrative plates of VHb for recombination bacillus amyloliquefaciens of the present invention;
Figure 11 is the carbon monoxide differential spectra figure of recombination bacillus amyloliquefaciens of the present invention;
Figure 12 produces the HPLC detection figure of antibacterial lipopeptid for recombination bacillus amyloliquefaciens of the present invention and starting strain.
Embodiment
Below in conjunction with embodiment and accompanying drawing the present invention is done further explain.
The embodiment of the invention utilizes plant rhizosphere to urge biological and ecological methods to prevent plant disease, pests, and erosion germ-bacillus amyloliquefaciens (Bacillus amyloliquefaciens) FZB42 as recipient bacterium; With Vitreoscilla hemoglobin gene vgb; Through making up recombination integrative vector pDGP43-vgb; Vgb is incorporated into realizes high expression level in the bacillus amyloliquefaciens; Structure is produced spore number and the higher plant growth-promoting diseases prevention engineering bacteria bacillus amyloliquefaciens engineering bacterial strain XLV09-1 of antibacterial lipopeptid output, and preparation bacillus amyloliquefaciens bacterium agent of engineering bacterium.
One, the construction process embodiment of recombination bacillus amyloliquefaciens engineering bacteria
(1) pcr amplification P43 promotor
Extract total DNA of subtilis B.subtilis 168 bacterial strains; Method reference [Isolation of Bacillus subtilis chromosomal DNA.Recombinant DNA Techniques.Addison-Wesley Publishing Co., Inc., Reading; Mass; 1983, pp.162-163], according to the B.subtilis P that logins among the GenBank
43Fragment (ACCESSION No.K02174.1) sequence, design primer, P
43-F:CCC
AAGCTTGATAGGTGGTATGTTTTCGCTTG, underscore are Hind III restriction enzyme site; P43-R:GGTTTGCTGGTCTAACATGTGTACATTCCTCTCTT.With the total DNA of B.subtilis bacterial strain is template, P
43-F/P
43-R is a primer, and amplification length is the P of 0.37kb
43Promotor.Reaction conditions is: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 45sec, 58 ℃ of annealing 30sec, 72 ℃ are extended 30sec; 30 circulations; 72 ℃ are extended 10min;
(2) pcr amplification Vitreoscilla hemoglobin gene vgb
According to the Vitreoscilla hemoglobin gene of logining among the GenBank (ACCESSION No.M27061) sequence, be that template is with vgb-F:AAGAGAGGAATGTACACATGTTAGACCAGCAAACC and vgb-R:CCC with plasmid pRK404-VHb
GAATTCTTATTCAACCGCTTGAGCG, underscore are the EcoRI restriction enzyme site, are template with plasmid pRK404-VHb, and Vgb-F/Vgb-R is a primer, the Vitreoscilla hemoglobin gene vgb of amplification 0.44kp; Reaction conditions is: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 45sec, 58 ℃ of annealing 30sec, 72 ℃ are extended 30sec, 30 circulations; 72 ℃ are extended 10min;
(3) overlapping extension splicing P
43Promotor and vgb
Reclaim the product that test kit reclaims said twice PCR with PCR, and to reclaim products with two kinds be template, with P
43-F/Vgb-R is a primer, adopts the fusion gene of the method amplification 0.81kb of overlapping extension splicing, and reaction conditions is: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 45sec, 58 ℃ of annealing 1min, 72 ℃ are extended 1min, 30 circulations; 72 ℃ are extended 10min; Idiographic flow is with reference to Fig. 1, and the PCR detailed results is seen Fig. 2.
(4) structure of intermediate carrier pMD-P43vgb
Reclaim test kit with PCR and reclaim overlapping PCR product, will reclaim product and connect the pMD18-T carrier, linked system is 2 μ l PCR products; 2.5 μ l Solution I; 0.5 μ l pMD18-T carrier, 16 ℃ of connections are spent the night, and connect product and all are used for Transformed E .coli Top10 competent cell; Select the line of resistance spot next day, with bacterium colony PCR preliminary screening positive transformant; Then bottle is shaken in the positive transformant switching for a short time, 37 ℃ of shaking table overnight cultures are extracted plasmid, and extract plasmid and use Hind III/EcoRI double digestion to identify the transformant plasmid,, further confirm transformant, enzyme is cut qualification result and is seen Fig. 3; Enzyme is cut the correct plasmid pMD-P43vgb order-checking of evaluation;
(5) structure of recombination integrative vector pDGP43-vgb
Extract gene recombination plasmid pMD-P43vgb and integrative vector pDG1730; Plasmid pMD-P43vgb and integrative vector pDG1730 are used Hind III/EcoR I double digestion simultaneously; Reclaim its purpose fragment; Both are connected to form plasmid pDGP43-vgb Transformed E .coli Top10 competent cell, Amp resistance screening positive transformant.Transformant is cut evaluation through cracking fast, bacterium colony PCR and enzyme, screens correct positive transformant pDGP43-vgb.Its idiographic flow is with reference to Fig. 1, and enzyme is cut qualification result and seen Fig. 4; The plasmid pDGP43-vgb that enzyme is cut evaluation send order-checking to identify that the part sequencer map is seen Fig. 5;
(6) structure of recombination bacillus amyloliquefaciens XLV09-1
The preparation reference literature of bacillus amyloliquefaciens competent cell [Extracell μ lar phytase activity of Bacillus amyloliquefaciens FZB45 contributes to its plant-growth-promoting effect.J.Microbiology; 2002,148:2097-2109] carry out; The concrete flow process of integrating is carried out with reference to Fig. 6,, cuts glue and reclaims recombination integrative vector pDGP43-vgb linearizing with Xho I, and 100ng DNA adds in the 200 μ l competence subsequently, hatches 20min; Add LB and microbiotic, cultivate 90min, be coated with the spectinomycin resistant panel then.Be inverted for 37 ℃ and cultivate 12-16h; Select the resistance bacterium colony, be scoring to another flat board; Picking transformant from the spectinomycin flat board; Streak culture on another flat board then; While picking part bacterial strain is done template and is carried out bacterium colony PCR, to confirm whether the vgb expression cassette really is incorporated on the karyomit(e) of bacillus amyloliquefaciens FZB42, and the PCR detected result is seen Fig. 7; Then; Use the amylorrhexis circle to test to verify amyE gene locus that whether goal gene correctly be incorporated into bacillus amyloliquefaciens with the amyE gene disruption, concrete operations are following: the positive bacteria drop point kind that PCR is filtered out to the LB flat board that contains 2% starch, with original strain as contrast; Be inverted and cultivated three days; In flat board, add iodine liquid then and dye, see whether periphery of bacterial colonies the hydrolysis circle occurred, concrete detected result is seen Fig. 8; Filter out the bacterium colony that does not have the hydrolysis circle, obtain correct recombination bacillus amyloliquefaciens strain X LV09-1.
Two, the production zymotechnique embodiment of bacillus amyloliquefaciens XLV09-1 microbial inoculum
Bacillus amyloliquefaciens XLV09-1 bacteria fermentation technology of the present invention (with reference to Fig. 9) comprises that mainly actication of culture, first class seed pot fermentation culture, secondary seed jar fermentation culture and production uses fermentor cultivation.
1. actication of culture
With the bacillus amyloliquefaciens XLV09-1 streak inoculation of preservation on solid seed culture medium inclined-plane; The flat bottle that substratum will be housed before the inoculation was sterilized 30 minutes under 121 ℃ of conditions; 48h is cultivated in the inoculation back under 30 ℃ of conditions, be made into spore liquid, and the inoculum size with 5% is used for the seeding tank inoculation;
2. seeding tank fermentation
With the first class seed pot sterilization, sterilization again is cooled to 30 ℃ behind the substratum of packing into, and spore liquid is inserted in the nutrient solution earlier, feeds sterile air and cultivates, and can get the first class seed pot zymocyte liquid; At 121 ℃ of 30min that sterilize down, sterilization again is cooled to 30 ℃ behind the substratum of packing into, and the first class seed pot fermented liquid is inserted the secondary seed jar by 5% inoculum size, feeds sterile air and stirring and cultivates, and can get secondary seed jar zymocyte liquid with the secondary seed jar;
3. production fermentor cultivation
With the fermentor tank sterilization, sterilize behind the substratum of packing into earlier, pressurize is cooled to 25 ℃～30 ℃ again, and the inoculum size by 5% inserts secondary seed jar fermented liquid in the fermentor tank and cultivates, through sterile air;
4. concentrate
Fermentation cylinder for fermentation concentrates, adds Synergistic additives, subsequent bottling with bacterium liquid through ultrafiltration after finishing;
High pressure steam sterilization is adopted in sterilization, promptly at 121 ℃, and pressure 0.5kg/cm
2The 30min that sterilizes under the condition after the fermentor tank inoculation, cultivated 48 hours air flow 2Vols/vol/min, oxygen content 40% under 30 ℃ of conditions.
The seed tank culture liquid formula: Carnis Bovis seu Bubali cream 0.8%, peptone 1.2%, glucose 0.6%, NaCl 0.6%, MgSO
47H
2O 0.06%, K
2HPO
40.06%, MnSO
40.02%, Yu Weishui, pH value sterilization is preceding 7.5, and sterilization is pH 7.2 afterwards;
Fermentor cultivation liquid formula: glucose 2%, L-Sodium Glutamate 0.5%, KH
2PO
40.08%, K
2HPO
40.10%, CaCO
30.1%, FeSO
47H
2O 0.001%, Yu Weishui, and pH value sterilization is preceding 7.5, and sterilization is pH 7.2 afterwards.
Fermented liquid requires: fermented liquid contains brood cell's number alive and reaches more than 10,000,000,000 for every milliliter, puts jar during biomass less than 5%, pH value 6.8, no living contaminants.
The Vitreoscilla hemoglobin functional verification
1.Western-Blot detect the expression of Vitreoscilla hemoglobin gene
With the target Vitreoscilla hemoglobin immune rabbit of purifying, obtain to be connected with horseradish peroxidase behind the antibody formation enzyme len antibody; With the bacterium of cultivating with ultrasonication after, with change film behind the total protein electrophoresis, with antibody hybridization, wash-out, colour developing confirm that said preparation expressed VHb albumen (Figure 10).
2. the biological activity of Vitreoscilla hemoglobin
Whether the VHb that detect to express through carbon monoxide differential spectra method biologically active (Figure 11); The absorption peak that has special 419nm in the carbon monoxide spectrum of said preparation; And this absorption peak not in the carbon monoxide spectrum of original bacteria preparation, it is active to prove that VHb albumen that said preparation is expressed has an oxyphorase life.
3. the detection of engineering bacteria growing state
Be coated with the product spore number after flat band method is measured fermentation through blood counting chamber and dilution, brood cell's content of said preparation recombination bacillus amyloliquefaciens has improved 14.49% than original strain, reaches 10,300,000,000/ml;
4, the mensuration of antibacterial lipopeptid output and anti-mycotic activity thereof
Adopt HPLC to measure the output (Figure 12) of antibacterial lipopeptid, the content of antibacterial lipopeptid fengycin has improved 1.74 times than original strain microbial inoculum in the present embodiment microbial inoculum, reaches 769.8mg/L, and the content of suffactin has improved 3.14 times, reaches 197.8mg/L; Adopt bacteriostatic test to measure the anti-mycotic activity of antibacterial lipopeptid simultaneously; The thick solution of said preparation antibacterial lipopeptid has the good restraining effect to dry thread Pyrenomycetes Rhizitoconia solani; Improved 61.54% than the thick solution of original bacterium antibacterial lipopeptid; Inhibition effect to seedling blight of red pepper Sclerotiumrolfsi has improved 36.4%, and the inhibition effect of tobacco brown spot pathogen Alternaria alternata has been improved 38.9%.
Claims (3)
1. recombination bacillus amyloliquefaciens; It is characterized in that; Be integrated with Vitreoscilla hemoglobin gene vgb on this recombination bacillus amyloliquefaciens karyomit(e); Its classification called after bacillus amyloliquefaciens (Bacillus amyloliquefaciens) XLV09-1, deposit number: CCTCC M209299.
2. the construction process of the said recombination bacillus amyloliquefaciens of claim 1 is characterized in that, comprises following concrete steps:
(1) pcr amplification P
43Promotor
Extracting total DNA of subtilis B.subtilis v168 bacterial strain, is the B.subtilis P of No.K02174.1 according to the registration number of logining among the GenBank
43The fragment sequence, design primer P
43-F:CCC
AAGCTTGATAGGTGGTATGTTTTCGCTTG, underscore are Hind III restriction enzyme site; P
43-R:GGTTTGCTGGTCTAACATGTGTACATTCCTCTCTT is a template with the total DNA of B.subtilis bacterial strain, P
43-F/P
43-R is a primer, and amplification length is the P of 0.37kb
43Promotor, reaction conditions is: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 45sec, 58 ℃ of annealing 30sec, 72 ℃ are extended 30sec; 30 circulations; 72 ℃ are extended 10min;
(2) pcr amplification Vitreoscilla hemoglobin gene vgb
According to the registration number of logining among the GenBank is the Vitreoscilla hemoglobin gene sequence of No.M27061, is template with plasmid pRK404-VHb, with vgb-F:AAGAGAGGAATGTACACATGTTAGACCAGCAAACC and vgb-R:CCC
GAATTCTTATTCAACCGCTTGAGCG, underscore are the EcoRI restriction enzyme site, are template with plasmid pRK404-VHb, and Vgb-F/Vgb-R is a primer, the Vitreoscilla hemoglobin gene vgb of amplification 0.44kp; Reaction conditions is: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 45sec, 58 ℃ of annealing 30sec, 72 ℃ are extended 30sec, 30 circulations; 72 ℃ are extended 10min;
(3) overlapping extension splicing P
43Promotor and vgb
Reclaim the product that test kit reclaims twice PCR with PCR, and two kinds to reclaim products be template, with P
43-F/Vgb-R is a primer, adopts the fusion gene of the method amplification 0.81kb of overlapping extension splicing, and reaction conditions is: 94 ℃ of preparatory sex change 4min; 94 ℃ of sex change 45sec, 58 ℃ of annealing 1min, 72 ℃ are extended 1min, 30 circulations; 72 ℃ are extended 10min;
(4) structure of intermediate carrier pMD-P43vgb
Reclaim test kit with PCR and reclaim overlapping PCR product, will reclaim product and connect the pMD18-T carrier, linked system is 2 μ l PCR products; 2.5 μ l Solution I; 0.5 μ l pMD18-T carrier, 16 ℃ of connections are spent the night, and connect product and all are used for Transformed E .coli Top10 competent cell; Select the line of resistance spot next day, with bacterium colony PCR preliminary screening positive transformant; Then bottle is shaken in the positive transformant switching for a short time, 37 ℃ of shaking table overnight cultures are extracted plasmid, extract plasmid and use Hind III/EcoRI double digestion to identify the transformant plasmid, further confirm transformant, enzyme is cut identified correct plasmid pMD-P43vgb order-checking;
(5) structure of recombination integrative vector pDGP43-vgb
Extract gene recombination plasmid pMD-P43vgb and integrative vector pDG1730; Plasmid pMD-P43vgb and integrative vector pDG1730 are used Hind III/EcoR I double digestion simultaneously; Reclaim its purpose fragment; Both are connected to form plasmid pDGP43-vgb, Transformed E .coli Top 10 competent cells, Amp resistance screening positive transformant; Transformant is cut evaluation through cracking fast, bacterium colony PCR and enzyme, screens correct positive transformant pDGP43-vgb; The plasmid pDGP43-vgb that enzyme is cut evaluation send order-checking to identify;
(6) structure of gene recombination bacillus amyloliquefaciens engineering bacteria XLV09-1
Preparation bacillus amyloliquefaciens competent cell; , cut glue and reclaim recombination integrative vector pDGP43-vgb linearizing with Xho I, 100ng DNA adds in the 200 μ l competence subsequently, hatches 20min; Add LB and microbiotic, cultivate 90min, be coated with the spectinomycin resistant panel then, be inverted for 37 ℃ and cultivate 12-16h; Select the resistance bacterium colony, be scoring to another flat board; Picking transformant from the spectinomycin flat board; Streak culture on another flat board then; While picking part bacterial strain is done template and is carried out bacterium colony PCR, to confirm whether the vgb expression cassette really is incorporated on the karyomit(e) of bacillus amyloliquefaciens FZB42, and three pairs of primers of PCR are respectively P
43-F/P
43-R, Vgb-F/Vgb-R and P
43-F/Vgb-R; Then; Use the amylorrhexis circle to test to verify amyE gene locus that whether goal gene correctly be incorporated into bacillus amyloliquefaciens with the amyE gene disruption; Concrete operations are following: the positive bacteria drop point kind that PCR is filtered out, is inverted and was cultivated three days as contrast with original strain to the LB flat board that contains 2% starch; In flat board, add iodine liquid then and dye, see whether periphery of bacterial colonies the hydrolysis circle occurred; Filter out the bacterium colony that does not have the hydrolysis circle, be recombination bacillus amyloliquefaciens XLV09-1.
3. the preparation method of a recombination bacillus amyloliquefaciens microbial inoculum is characterized in that, may further comprise the steps:
(1), actication of culture
With being preserved in Chinese typical culture collection center deposit number is that the recombination bacillus amyloliquefaciens XLV09-1 streak inoculation of CCTCC M209299 is on solid seed culture medium inclined-plane; The flat bottle that substratum will be housed before the inoculation was sterilized 30 minutes under 121 ℃ of conditions; 30～48h is cultivated in the inoculation back under 28～35 ℃ of conditions; Be made into spore liquid, the inoculum size with 5% is used for the seeding tank inoculation;
(2) seeding tank fermentation
With the first class seed pot sterilization, sterilization again is cooled to 30 ℃ behind the substratum of packing into, and spore liquid is inserted in the nutrient solution earlier, feeds sterile air and cultivates, and can get the first class seed pot zymocyte liquid; With secondary seed jar sterilization 30min under 121 ℃; The sterilization again behind the substratum of packing into is cooled to 30 ℃, and the first class seed pot fermented liquid is inserted the secondary seed jar by 5%～8% inoculum size; Feed sterile air and stirring and cultivate, can get secondary seed jar zymocyte liquid;
(3) production fermentor cultivation
With the fermentor tank sterilization, sterilize behind the substratum of packing into earlier, pressurize is cooled to 25 ℃～30 ℃ again, and the inoculum size by 5%～8% inserts secondary seed jar fermented liquid in the fermentor tank and cultivates, through sterile air;
(4) concentrate
Fermentation cylinder for fermentation concentrates bacterium liquid after finishing through ultrafiltration, add Synergistic additives, subsequent bottling;
High pressure steam sterilization is adopted in said sterilization, and promptly at 121 ℃, the 30min that sterilizes under the pressure 0.3-0.5kg/cm2 condition after the fermentor tank inoculation, cultivated 36～48 hours air flow 1～2Vols/vol/min, oxygen content 30～40% under 28～35 ℃ of conditions;
The seed tank culture liquid formula: Carnis Bovis seu Bubali cream 0.3～0.8%, peptone 0.7～1.2%, glucose 0.1～0.6%, NaCl 0.1～0.6%, MgSO
47H
2O 0.01～0.06%, K
2HPO
40.01%～0.06%, MnSO
40.02%～0.08%, Yu Weishui, pH value sterilization is preceding 7.0～7.8, and sterilization is pH6.8～7.5 afterwards;
The fermentor cultivation based formulas is: glucose 2～8%, L-Sodium Glutamate 0.3～1.5%, KH
2PO
40.08～0.22%, K
2HPO
40.10～2.2%, CaCO
30.1～2.20%, FeSO
47H
2O 0.001～0.005%, Yu Weishui, and pH value sterilization is preceding 8.5～11.0, sterilization afterwards 6.5～9.5;
Fermented liquid requires: fermented liquid contains brood cell's number alive and reaches more than 8,000,000,000 for every milliliter, puts jar during biomass less than 5%, pH value 7.0-8.0, no living contaminants;
Said per-cent is weight percentage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102271971A CN101717744B (en) | 2009-12-11 | 2009-12-11 | Gene recombination bacillus amyloliquefaciens and microbial inoculum preparation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102271971A CN101717744B (en) | 2009-12-11 | 2009-12-11 | Gene recombination bacillus amyloliquefaciens and microbial inoculum preparation method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101717744A CN101717744A (en) | 2010-06-02 |
| CN101717744B true CN101717744B (en) | 2012-05-23 |
Family
ID=42432383
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102271971A Expired - Fee Related CN101717744B (en) | 2009-12-11 | 2009-12-11 | Gene recombination bacillus amyloliquefaciens and microbial inoculum preparation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101717744B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103275907A (en) * | 2013-06-18 | 2013-09-04 | 武汉科前动物生物制品有限责任公司 | Bacillus amyloliquefacien and preparation method and application thereof |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102172249B (en) * | 2011-03-24 | 2012-12-26 | 南京农业大学 | Marine bacteria 2BS12 preventing and controlling banana fusarium wilt |
| CN102515951B (en) * | 2011-12-14 | 2013-10-16 | 湖南省微生物研究所 | Tobacco composite microbial fertilizer and its preparation method |
| CN102776147B (en) * | 2012-04-16 | 2017-03-08 | 杨凌绿都生物科技有限公司 | Gene recombinaton Pierre auspicious Russia series bacillus and its construction method and application |
| CN103820350B (en) * | 2012-11-16 | 2016-03-30 | 中国科学院生态环境研究中心 | Changing food waste into resources produces bacillus amyloliquefaciens microbial fertilizer |
| CN103820348B (en) * | 2012-11-16 | 2016-03-02 | 中国科学院生态环境研究中心 | The production method of one strain plant growth-promoting bacteria and microbial inoculum thereof and application |
| CN104031960B (en) * | 2014-06-12 | 2017-01-18 | 西安交通大学 | Extracting method and application of extracellular antimicrobial lipopeptides of bacillus amyloliquefaciens |
| CN105349561B (en) * | 2015-11-26 | 2019-02-05 | 清华大学 | A method of fermented cells density is improved using hemoglobin |
| CN106520648B (en) * | 2016-10-28 | 2019-11-26 | 北京市农林科学院 | Recombination hillock monad and its construction method and application to chain sclerotinia sclerotiorum with inhibitory activity |
| CN108373985B (en) * | 2018-04-25 | 2021-03-05 | 华中农业大学 | Bacillus amyloliquefaciens engineering bacterium for degrading caffeine and application thereof |
-
2009
- 2009-12-11 CN CN2009102271971A patent/CN101717744B/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103275907A (en) * | 2013-06-18 | 2013-09-04 | 武汉科前动物生物制品有限责任公司 | Bacillus amyloliquefacien and preparation method and application thereof |
| CN103275907B (en) * | 2013-06-18 | 2014-10-01 | 武汉科前动物生物制品有限责任公司 | Bacillus amyloliquefacien and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101717744A (en) | 2010-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101717744B (en) | Gene recombination bacillus amyloliquefaciens and microbial inoculum preparation method | |
| Pedraza | Recent advances in nitrogen-fixing acetic acid bacteria | |
| CN104603260B (en) | For improving crop production rate and reducing the azotobacteria Inoculant of nitrous oxide emission | |
| CN104789490B (en) | A kind of complex microorganism decomposing microbial inoculum, preparation method and application | |
| CN104542727B (en) | Insecticide and preparation method thereof is controlled a kind of liquid compound bio more | |
| CN104195074B (en) | A kind of deep brown Bacillus strain of Alpine Grasslands herbage endogenetic bacteria, microbial bacterial agent and its preparation method and application | |
| CN100451105C (en) | Bacillus laterosporus and soil inoculation agent prepared from the strain | |
| CN110452832B (en) | Acid-resistant bacillus amyloliquefaciens Kc-5 and application thereof | |
| CN102442849A (en) | Disease-preventing bio-organic fertilizer prepared from straw and its preparation method | |
| CN103952348B (en) | Brevibacterium frigoritolerans as well as microbial inoculant and application of brevibacterium frigoritolerans and microbial inoculant | |
| CN105802893B (en) | A kind of entomopathogenic nematode symbiotic bacteria bacterial strain and its application | |
| CN108865946A (en) | One plant height ground bacillus and its application in prevention and treatment tomato root-knot eelworm | |
| CN101967455A (en) | Bacillus amyloliquefaciens EA19 for controlling wheat root diseases and preparation thereof | |
| CN112795510B (en) | Paenibacillus polymyxa and application thereof | |
| CN114480197B (en) | Brevibacillus laterosporus, microbial inoculum and application thereof in biological pesticide fertilizer | |
| CN106350464A (en) | Microbial agent for preventing and treating cumquat huanglongbing and preparation method thereof | |
| CN106305487A (en) | Biological active padding material of fermentation bed for poultry, preparation method and application | |
| CN112746024A (en) | Trichoderma composite microbial agent and bio-organic fertilizer prepared from same | |
| CN109182219A (en) | One plant of Mo Haiwei bacillus for promoting the growth of Henry David Thoreau grass and its application | |
| CN114437994A (en) | Biological control bacterium Bacillus siamensis HT1 and application thereof in preparation of biological control bacterium agent | |
| CN107628894A (en) | Composite bacteria agent increase soil fertility and its preparation method and application | |
| CN107916237B (en) | Photobacterium Hb1029 and application thereof | |
| CN106397030A (en) | Composite microbial fertilizer and preparation method thereof | |
| CN101935627A (en) | Bromoxynil octanoate degrading bacteria and bacterial agent prepared from same | |
| CN102443559B (en) | Baclillus subtilis used for controlling cotton verticillium wilt and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120523 Termination date: 20211211 |