CN101705247A - Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors - Google Patents
Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors Download PDFInfo
- Publication number
- CN101705247A CN101705247A CN200910218980A CN200910218980A CN101705247A CN 101705247 A CN101705247 A CN 101705247A CN 200910218980 A CN200910218980 A CN 200910218980A CN 200910218980 A CN200910218980 A CN 200910218980A CN 101705247 A CN101705247 A CN 101705247A
- Authority
- CN
- China
- Prior art keywords
- cell
- gene
- bovine
- nanog
- lin28
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for transfecting bovine somatic cells into inducted pluripotent stem cells (iPSCs) by adopting transcription factors, concretely comprising the following steps: 1) isolation and culture of bovine dermal fibroblasts; 2) cloning of bovine transcription factor genes maintaining pluripotency and construction of retroviral vectors of the transcription factor genes; 3) retrovirus packaging and preparation; and 4) infection of bovine dermal fibroblasts by retrovirus and acquisition of bovine inducted pluripotent stem cells. The invention first adopts the acellular human amniotic membranes as support to replace the mouse embryonic fibroblasts (MEFs) to maintain in vitro proliferation of the bovine iPSCs and keep the bovine iPSCs in undifferentiated pluripotent states for long time. The method which adopts gene inducing to generate the PSCs not only solves the technical problem that the PSCs of the animals such as cattle, sheep, pigs and other livestock are difficult to obtain but also avoids the problem of heterogeneous animal cell pollution caused by the feeder layer which applies the MEFs as the stem cells.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to a kind of method of utilizing the transcription factor transfecting bovine somatic cells to become inductive pluripotent stem cells.
Background technology
2006, Japanese scholar Yamanaka
[1]Reported first is utilized mouse transcription factor Oct4, and Sox2, c-Myc, Klf4 make up common transfection mouse somatocyte, obtained mouse inductive pluripotent stem cells (inducted pluripotent stem cells, iPSCs).Subsequently, started the research boom of inducing pluripotent stem cell in the world wide.All done research from animal varieties, transcription factor kind and quantity, transcription factor array mode and foreign gene introduction method or the like many aspects.Yamanaka in 2007
[2]Utilize same transcription factor successfully to obtain human iPSCs again; The same year, Yu (Yu Junying) and Thomson
[3]Utilize Deng the people that (Nanog Lin28) has also obtained human iPS cell for Oct3/4, Sox2 with other four kinds of transcription factors.Rhesus monkey is arranged again subsequently
[4], rat
[5], pig
[6]Report (Li et al., 2009 Deng animal iPSCs achieving success; Liao et al., 2009; Liu et al., 2008).Because iPSCs and embryonic stem cell (ESCs) have closely similar biological characteristics, so culture condition of all having used for reference the ES cell in the process of setting up at existing iPSCs, for example use the nutrient solution of ESCs, using mouse embryo fibroblasts (MEF) provides multiple somatomedin to keep the versatility of iPSCs as feeder layer.But domestic animal, for example animals such as pig, ox, sheep also do not have the generally acknowledged embryonic stem cell that is of building
[7], from body early embryo, separate very difficulty of these embryonic stem cells, and culture system is not definite fully.Existing embryonic stem cell culture condition all is to adopt mouse embryo fibroblasts (MEF) as culture layer, just can keep ESCs and be in undifferentiated state.Use mouse embryo fibroblasts in the ESCs culture system, directly introduced the heterogenous animal cell, the result has directly influenced the clinical application of ESCs cell, has also increased workload and the difficulty in the culturing process.Since mouse embryo stem cell in 1981
[8]With hESC in 1998
[9]Build be since, over and done with so far two more than ten years, but to be difficult to so far build be to illustrate that then domestic animal will obtain embryonic stem cell from the body early embryo material separation and also exist many technical and theoretic restraining factors to the livestock embryo stem cell.Therefore, utilize Principles of Gene Engineering, the versatility key gene is imported somatocyte, making its reprogrammed is the stem cell with versatility, having solved not only that stem cell builds is technical barrier, having enriched that reprogramming of somatic cells and stem cell build is theory, and to build for other stem cell animals be that theoretical foundation and experiment basis are provided.
Reference
[1]Takahashi，K.，and?Yamanaka，S.(2006).Induction?of?pluripotent?stemcells?from?mouse?embryonic?and?adult?fibroblast?cultures?by?defined?factors.Cell126，663-676.
[2]Takahashi，K.，Tanabe，K.，Ohnuki，M.，Narita，M.，Ichisaka，T.，Tomoda，K.，and?Yamanaka，S.(2007).Induction?of?pluripotent?stem?cells?from?adult?humanfibroblasts?by?defined?factors.Cell?131，861-872.
[3]Yu，J.Y.，Vodyanik，M.A.，Smuga-Otto，K.，Antosiewicz-Bourget，J.，Frane，J.L.，Tian，S.，Nie，J.，Jonsdottir，G.A.，Ruotti，V.，Stewart，R.，et?al.(2007).Induced?pluripotent?stem?cell?lines?derived?from?human?somatic?cells.Science?318，1917-1920.
[4]Liu，H.S.，Zhu，F.F.，Yong，J.，Zhang，P.B.，Hou，P.P.，Li，H.G.，Jiang，W.，Cai，J.，Liu，M.，Cui，K.，et?al.(2008).Generation?of?Induced?Pluripotent?StemCells?from?Adult?Rhesus?Monkey?Fibroblasts.Cell?Stem?Cell?3，587-590.
[5]Li，W.L.，Wei，W.，Zhu，S.，Zhu，J.，Shi，Y.，Lin，T.，Hao，E.，Hayek，A.，Deng，H.，and?Ding，S.(2009).Generation?of?Rat?and?Human?Induced?PluripotentStem?Cells?by?Combining?Genetic?Reprogramming?and?Chemical?Inhibitors(vol?4，pg?16，2009).Cell?Stem?Cell?4，370-370.
[6]Esteban，M.A.，Xu，J.，Yang，J.，Peng，M.，Qin，D.，Li，W.，Jiang，Z.，Chen，J.，Deng，K.，Zhong，M.，et?al.(2009).Generation?of?Induced?Pluripotent?Stem?CellLines?from?Tibetan?Miniature?Pig.Journal?of?Biological?Chemistry?284，17634-17640.
[7]Keefer，C.L.，Pant，D.，Blomberg，L.，and?Talbot，N.C.(2007).Challenges?and?prospects?for?the?establishment?of?embryonic?stem?celllines?ofdomesticated?ungulates.Animal?Reproduction?Science?98，147-168.
[8]Martin，G.R.(1981).Isolation?of?a?pluripotent?cellline?from?early?mouseembryos?cultured?in?medium?conditioned?by?tera-tocarcinoma?stem?cells.Proc?NatlAcad?Sci?USA?78，7634-7638.
[9]Thomson，J.A.，Itskovitz-Eldor，J.，Shapiro，S.S.，Waknitz，M.A.，Swiergiel，J.J.，Marshall，V.S.，and?Jones，J.M.(1998).Embryonic?stem?celllinesderived?from?human?blastocysts.Science?282，1145-1147.
Summary of the invention
Building at the domestic animal stem cell is that a middle above-mentioned prior art difficult problem that exists is with not enough, the object of the present invention is to provide the method for a kind of acquisition inductive pluripotent stem cells (iPSCs), with this method obtain cell at cell colony form, growth characteristics, stem cell surface mark, express dryness gene, main dryness gene promoter sequence zone methylation patterns, embryoid forms and vitro differentiation ability, teratoma form ability, and it is all closely similar with the embryonic stem cell characteristic to participate in eight aspects such as mosaic formation.
Realize that foregoing invention purpose technical scheme is a kind of method of utilizing the transcription factor transfecting bovine somatic cells to become inductive pluripotent stem cells, it is characterized in that, comprise the steps:
1) fibroblastic separation of ox-hide skin and cultivation
Ox-hide skin inoblast (BDFs) and new born bovine skin flbroblast (NDFs) obtain a large amount of adult ox-hide skin inoblast and new born bovine skin flbroblast respectively through the routine cultivation to grow up;
2) ox is kept the clone and the Expressed by Retrovirus Vector thereof of versatility transcription factor gene
From 50-60 age in days ox fetus, separate sex-ridge, extract total RNA, obtain cDNA through reverse transcription reaction; With cDNA is template, reaction obtains ox Oct4, Sox2, Nanog and four gene amplification products of Lin28 and correctly then goal gene is inserted among the retroviral vector pMSCVneo through the sequence verification sequence through PCR, makes up the retrovirus expression vector of these 4 kinds of genes;
3) retroviral packing and preparation
The PT67 packing cell is cultivated in containing the DMEM substratum of 15% foetal calf serum according to ordinary method, used liposome the retroviral vector transfection that makes up is entered packing cell PT67 cell; Using preceding 1 hour of liposome packaging virus particle, the nutrient solution DMEM substratum of packing cell PT67 changes serum-free medium into, 4-8 μ g is included the retroviral plasmid DNA of transcription factor gene and 10-20 μ l liposome to join 500 μ l Opti-MEM-I+GlutaMAX-I transfections respectively and optimizes liquid and dilute, mixing gently, hatched under the room temperature 5 minutes, the diluent that will contain liposome lipofectamine2000 then slowly splashes in the diluent that contains retroviral plasmid, mixing gently, after hatching 20 minutes again under the room temperature, above-mentioned mixed solution is dropwise added in the PT67 packing born of the same parents culture dish; After the transfection 24 hours, change every day contain virion nutrient solution once, for three days on end, collect viral suspension, under 4 ℃ of conditions through 25000 rev/mins, after centrifugal 90 minutes, 10 times of concentrating virus supernatant liquors; To include Oct4, Sox2, Nanog and Lin28 gene viruses supernatant liquor carry out balanced mix, and add the combination of 8 μ g/mlPolybrene composition special genes, and-80 ℃ of preservations are standby;
4) acquisition of the iPS cell of retroviral infection ox-hide skin inoblast and ox
To grow up ox-hide skin inoblast BDFs and newborn bull skin flbroblast NDFs cultivates in the 60mm plastic culture dish according to ordinary method, treats in the culture dish that cell grows into the retrovirus supernatant liquor that will comprise Oct4, Sox2, Nanog and Lin28 gene transcription factor when 70-80% merges and joins respectively in inoblast BDFs and the NDFs culture dish and infect inoblast; Cell goes down to posterity by 1: 3 routine after covering with culture dish, visual cell's growing state 6-10 days with cell with 1 * 10
5The density of cells/well is transferred to and is covered with in advance on people's amnion (HAM) 6 well culture plates, and the personnel selection amnion replaces MEF to cultivate metainfective ox cell as feeder layer, and nutrient solution is replaced with the stem cell nutrient solution simultaneously; Measure and change liquid every day half in the culture hole, observed continuously 20-28 days, till having cell colony to occur, was designated as for 0 generation, is ox iPSCs.
Consisting of of described stem cell nutrient solution: contain in every 100ml solution: the knockout-DMEM of 82.69ml, 15ml FBS, 1ml concentration are that 200mM glutamine, 1ml concentration are that 10mM non-essential amino acid, 200 μ l concentration are that 55mM beta-mercaptoethanol, 10 μ l concentration are that 400ng/ml people's recombination basic fibroblast somatomedin (bFGF), 100 μ l concentration are 10
5U/ml leukaemia inhibitory factor (LIF).
When ox iPSCs goes down to posterity, use the digestion of 0.05%trypsin+0.02%EDTA Digestive system, through neutralization, centrifugal and resuspended being passaged to again on the new HAM upholder, at 37-38 ℃, 5% left and right sides CO
2, amplification cultivation under the saturated humidity condition obtains ox iPS cell strain.Ox iPSCs went down to posterity once every 3-5 days.Liquid nitrogen cryopreservation, the back growth vigor that thaws is better, and the 85%-90% survival rate is arranged approximately.
A further object of the invention provides the recombinant retroviral expression vector pMSCV-Nanog of Nanog gene and the application in genetically engineered.
A further object of the invention provides the recombinant retroviral expression vector pMSCV-Lin28 of Lin28 gene and the application in genetically engineered.
The present invention utilizes inductive pluripotent stem cells and its preparation method compared with prior art, has the following advantages:
1, among the present invention 4 of application autonomous clened cows kinds keep stem cell versatility key gene, utilize the several genes array mode, lead as ox-hide skin inoblast with the stem cell retrovirus-mediated method, make its reprogrammed for having the multipotent stem cells of embryonic stem cell biological nature fully.Many strains multi-functional stem cell of setting up by this method surpassed for 25 generations external having gone down to posterity, and growth characteristics are all acted normally.Frozen and thawing test shows that they still have good versatility.
2, the present invention adopts first in culture condition and takes off cell people amnion (HAM) and replace mouse embryo fibroblasts (MEF) to keep ox iPSCs in-vitro multiplication as upholder and keep undifferentiated versatility state for a long time, and has avoided using the heterogenous animal cell contamination problem that feeder layer brought of rat embryo fibroblast cell as stem cell.
3, the present invention adopts the method for gene induced generation multipotent stem cells, has solved the particularly ox multipotent stem cells technical barrier that is difficult to obtain of domestic animal, and to build for other stem cell animals be that theoretical foundation and experiment basis are provided.
Description of drawings
Fig. 1 cow skin flbroblast (BDFs) 50 * microscope figure that grows up.
Newborn bull skin flbroblast (NDFs) 50 * microscope of Fig. 2 figure.
Fig. 3 PT67 packing cell 50 * microscope figure.
100,000 times of Electronic Speculum figure of retroviral particle under Fig. 4 Electronic Speculum.
Fig. 5 colony alkaline phosphatase staining 100 * microscope figure.
Fig. 6 colony alkaline phosphatase staining 200 * microscope figure.
Fig. 7 TRA-1-60 bright field microscope figure.
Fig. 8 TRA-1-60 dyeing (+++) microscope figure.
Fig. 9 Nanog bright field microscope figure.
Figure 10 Nanog dyeing (+++) microscope figure.
Figure 11 blister cavities sample embryoid structure microscope figure.
Figure 12 represents the β III-Tubulin of the ectoderm cell system positive microscope figure that dyes.
Figure 13 represents the α-actin stained positive microscope figure of mesoblastema system.
Figure 14 represents the alpha-fetoprotein that the endoderm cell is (the stained positive microscope figure of α-fetoprotein).
Figure 15 body of gland spline structure (entoderm) 400 * microscope figure.
Figure 16 structure of skeletal muscles (mesoderm) 400 * microscope figure.
Figure 17 archineuron structure (ectoderm) 400 * microscope figure.
The RT-PCR detected result gel electrophoresis figure of Figure 18 EB.
The PCR detected result gel electrophoresis figure of each tissue of Figure 19 mosaic goat.
Embodiment
Below the acquisition ox iPSCs that provides by the applicant concrete grammar and all have and the embryonic stem cell similar biological in all many-sides such as colony form, growth characteristics, stem cell surface sign, inside and outside differentiation capability and mosaic formation through multiple evidence ox iPSCs.
Embodiment fibroblastic separation of 1 ox-hide skin and cultivation
Growing up, (female bovine dermal fibroblasts BDFs) separates from female Holstein milk the ears of an ox or cow edge skin ox-hide skin inoblast.Be cut into the fine tissue piece after will organizing cleaning and sterilizing, under conventional culture condition, with cultivating among the high sugared DMEM (Gibco company product) that contains 15%-20% foetal calf serum (FBS) (Gibco company product).Changed in every 2-3 days and support liquid 1 time, just have inoblast to shift out from the tissue block edge after 7-10 days, a large amount of inoblasts closely are arranged in around the tissue block after 12-16 days.With trypsinase and EDTA mixture slaking liquid had digestive transfer culture, promptly obtain a large amount of adult ox-hide skin cells, see Fig. 1.(male newborn bovine dermal fibroblasts NDFs) from the newborn bull ear of Holstein kind edge skin, sees Fig. 2 to newborn bull skin flbroblast, and separation is identical with above-mentioned cow skin flbroblast method with cultural method.In order to guarantee cell viability, the present invention adopt 2～6 generations with interior cell as inducing preceding target cell.
2 Ns of clone and Expressed by Retrovirus Vector thereof of keeping versatility key gene transcription factor of embodiment
In the fetus body of 50-60 age in days He Sitan (Holstein) kind milk cow, separate sex-ridge, extract total RNA with TRIzol LS Reagent behind the tissue homogenate, handle to remove the genomic dna pollution through DNaseI (RNase free). obtaining cDNA. through reverse transcription reaction is template then with cDNA, through open frame (ORF) complete sequence of reading of pcr amplification Oct4, Sox2, Nanog and four kinds of transcription factor genes of Lin28, gene clone the primer sequence is shown in Table 1 respectively.
Table 1 amplification ox Oct4, Sox2, Nanog and four gene RT-PCR of Lin28 amplimer information
Wherein Oct4 gene PCR amplification parameter is: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 45sec, 60 ℃ of annealing 45sec, 72 ℃ are extended 1min, circulate 35 times, and 72 ℃ are extended 10min again, and expection PCR product length should be 1083bp.
The amplification parameter of Sox2 gene is: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 45sec, 54 ℃ of annealing 30sec, 72 ℃ are extended 1min, circulate 35 times, and 72 ℃ are extended 10min again, and expection PCR product length should be 963bp.
Nanog gene amplification parameter is: 94 ℃ of pre-sex change 4min, and 94 ℃ become 35s, 58 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 35 circulations, 72 ℃ are extended 10min again, and expection PCR product length should be 903bp.
Lin28 gene amplification parameter is 94 ℃ of pre-sex change 4min, 94 ℃ of sex change 30s, and 56 ℃ of annealing 45s, 72 ℃ are extended 1min, totally 30 circulations, 72 ℃ are extended 10min again, and expection PCR product length should be 618bp.
Get each 5 μ l of above-mentioned PCR product, to identify its size, remain ℃ preservation of PCR product-20 at 1% agarose gel electrophoresis.Electrophoresis detection result shows that 4 kinds of transcription factor gene sizes of pcr amplification product length and expection milk cow are in full accord, the Pass Test design requirements.Then 4 kinds of PCR product remainders are passed through dna fragmentation Gel Extraction kit purifying, recovery respectively; Reclaim product and be connected with solution I mixing with cloning vector pMD18-T, 16 ℃ of connections are spent the night.To connect product is transformed in the competent cell TG I and clones.Dull and stereotyped last 37 ℃ of screening and culturing 14-16 hours of LB through containing Ampicillin (80 μ g/ml), X-gal and IPTG.Picking 6-10 white colony inoculated and shaken bacterium in the LB nutrient solution that contains penbritin (Ampicillin) in a small amount respectively from 4 kinds of cultures, and according to plasmid extraction test kit specification sheets step extracting trace plasmid.Comprise Oct4, Sox2, Nanog, the plasmid of 4 kinds of genes such as Lin28 is identified through double digestion, single endonuclease digestion and plasmid PCR.Wherein 3 kinds of plasmids are through BglII+EcoRI double digestion and EcoRI single endonuclease digestion and plasmid PCR evaluation, to obtain pMD-18T-Oct4, pMD-18T-Sox2, the positive colony of three kinds of plasmids of pMD-18T-Lin28.Because the restriction endonuclease kind difference of introducing in the primer, the plasmid that comprises the Nanog gene is through HapI+BglII double digestion and BglII single endonuclease digestion and plasmid PCR evaluation, to obtain pMD-18T-Nanog plasmid positive colony.Selecting and recommending the positive plasmid of qualification result checks order to biotech firm.Reference sequences carries out the homology comparative analysis among sequencing result application DNAstart 7.10 softwares and the GenBank.Analytical results shows, Oct4, and Sox2, Nanog and Lin28 gene order and reference sequences homology are respectively 99.4%, 99.6%, and 100% and 100%.
The pMD-18T-Oct4 that above-mentioned order-checking is correct; pMD-18T-Sox2; after reclaiming purifying, three kinds of plasmids of pMD-18T-Lin28 pass through Bgl II+EcoRI double digestion respectively with retrovirus pMSCVneo carrier; plasmid pMD-18T-Nanog and retrovirus process BglII+HapI double digestion, purifying and the target gene fragment and the linearizing pMSCVneo carrier that reclaim after enzyme is cut.Retrovirus vector pMSCVneo after the linearizing is connected at 16 ℃ with DNALigation Kit Version 2.0 with the purpose fragment of recovery spends the night, after 14-16 hour, connect product and be transformed into the JM109 competent cell, through filtering out the positive colony of retroviral plasmid on penbritin (Ampicillin, 50 μ g/mL) the LB flat board.From 4 culture plates, each recombinant plasmid picking 6-10 bacterium colony respectively shakes bacterium in a small amount, and micro-method is extracted the retroviral plasmid of reorganization.Identify and the sequencing analysis evaluation through the two enzymic digestion evaluations of BglII+EcoRI (perhaps BglII+HapI), plasmid pcr amplification.Four kinds of recombinant retrovirus plasmids can obtain the target gene fragment and the retroviral vector fragment of known dimensions through behind the double digestion, illustrate that our constructed recombinant retroviral expression vector structure is correct.Detect by order-checking, the sequence and the pcr amplification sequence of 4 goal gene that comprised in all recombinant retrovirus plasmids are in full accord, also with GenBank in reference sequences in full accord, show that in this patent goal gene in constructed 4 kinds of recombinant retrovirus plasmid processes do not read situations such as the frameshit of frame and base mutation, illustrate that applied 4 kinds of gene orders are entirely true.4 kinds of constructed in this patent recombinant retroviral expression vectors are distinguished called after: pMSCV-Oct4, pMSCV-Sox2, pMSCV-Nanog and pMSCV-Lin28.
The PT67 packing cell is cultivated in the DMEM substratum according to ordinary method, when treating that cell reaches 70%-80% and converges, use liposome with 4 kinds of retroviral vectors respectively transfection enter packing cell PT67 cell, carry out virus packing and have infectious retroviral particle with acquisition.Preceding 1 hour of transfection, the DMEM substratum changes serum-free medium into, 4-8 μ g retroviral plasmid DNA and 10-20 μ l liposome join 2 part of 500 μ l Opti-MEM-I+GlutaMAX-I (Gibco company product) respectively and optimize in the transfection liquid, soft mixing, incubated at room, then with plasmid DNA and the soft mixing of liposome, the incubated at room again of diluting.After 20 minutes, mixed solution is dropwise added in the PT67 Tissue Culture Dish.Cell is at 37 ℃, 5%CO
2With cultivate 4-6h under the saturated humidity condition.Afterwards, transfection liquid changes the new DMEM nutrient solution that contains 15%FBS into.After transfection in 24 hours, collect PT67 cell culture fluid supernatant, just comprise infectious retroviral particle in this supernatant.Supernatant liquor is through the membrane filtration in 0.45 μ m aperture.Collected once, collected continuously 3 days in per 24 hours.Viral suspension under 4 ℃, through 25,000 rev/mins, centrifugal 90 minutes, 10 times of concentrating virus supernatant liquors ,-80 ℃ of preservations.Oct4, Sox2, Nanog and four kinds of gene viruses supernatant liquors of Lin28 are carried out balanced mix, and add 8 μ g/ml polybrene, prepare transfection ox-hide skin inoblast.
The acquisition of the iPS cell of embodiment 4 retroviral infection ox-hide skin inoblasts and ox and going down to posterity
Ox-hide skin inoblast (BDFs) and the newborn bull skin flbroblast (NDFs) of will growing up cultivated in the 60mm plastic culture dish according to ordinary method, treats in the culture dish that cell grows into the mixed solution that will comprise the retrovirus supernatant liquor of Oct4, Sox2, Nanog and Lin28 gene transcription factor when 70-80% merges and joins respectively in inoblast BDFs and the NDFs culture dish and infect inoblast; Cell goes down to posterity by 1: 3 routine after covering with culture dish, visual cell's growing state 6-10 days with cell with 1 * 10
5The density of cells/well is transferred to and is covered with in advance on people's amnion 6 well culture plates, replaces MEF to cultivate metainfective ox cell as feeder layer with HAM, and nutrient solution is replaced with the stem cell nutrient solution simultaneously; Measure and change liquid every day half in the culture hole, observed continuously 20-28 days, till having ES cell sample colony to occur, was designated as for 0 generation, is ox iPSCs.
When ox iPSCs goes down to posterity, use the digestion of 0.05%trypsin+0.02%EDTA Digestive system, through neutralization, centrifugal and resuspended being passaged to again on the new HAM upholder, at 37-38 ℃, 5% left and right sides CO
2, amplification cultivation under the saturated humidity condition obtains ox iPS cell. and the ox iPSCs liquid nitrogen cryopreservation that went down to posterity a time every 3-5 days, the back growth vigor that thaws is better, nearly 85%-90% survival rate.
The evaluation of the ox iPSCs system that test example 1 is set up
Embryonic stem cell has very similarly biological characteristics on ox iPSCs that sets up in order to identify among the present invention and the traditional sense, and the contriver identifies the iPS cell of the ox that the present invention set up in a plurality of different aspect designs,
1. as the ox-hide skin inoblast form of target cell, see Fig. 1-2.
2.PT67 the retroviral particle form after packing cell and the packing is seen Fig. 3-4.
3.iPSCs colony form and AP stained positive (redness) are identified, are seen Fig. 5-6.
4.iPSCs the immunofluorescence cell chemical staining of colony is identified, is seen Fig. 7-10.
5. the vitro differentiation that is formed at of embryoid is identified
Utilize the external suspension culture of ox iPSCs just can form after 7 days a plurality of spheries and blister cavities sample embryoid (Embryoid Body, EB) structure is seen Figure 11, wherein A is shown as spheric embryoid structure, what B showed is blister cavities sample embryoid structure.
The embryoid (EB) that utilizes ox iPSCs to form passed through adherent culture 14-21 days again, and made its directed differentiation by the method for adding inducing culture, formed the different cellular fories of representing 3 germinal layers.3 germinal layers are represented clone, see shown in Figure 12-14.
6. the differentiation of teratoma formation and three germinal layer cells
It is subcutaneous that ox iPSCs is expelled to the nude mice buttocks, grows through the 6-9 time-of-week, then can be in the nude mice injection site subcutaneous formation tumour, be teratoma.Be prepared into tissue slice with the teratoma collection, after fixing, dyeing back microscopic examination can be observed 3 germinal layer cellular fories and exist in the teratoma simultaneously and cut into slices, and illustrates that ox iPSCs has the totipotency of growth.Can observing clearly through the teratoma tissue preparation section microscopically after the H.E. dyeing, three germinal layer cells exist simultaneously.Shown in observations following Figure 15-17 (arrow).In addition, to the total RNA of teratoma tissue extraction, use three germinal layer cells and represent gene primer to carry out the RT-PCR augmentation detection, the result has also shown the existence of three germinal layer cells, and the ox iPSCs that same explanation is set up has totipotency.On behalf of the Gene RT-PCR detected result, three germinal layer cells of embryoid see Figure 18, and swimming lane 1 among the figure: β-Actin is confidential reference items; Swimming lane 2:Nestin, swimming lane 3: β-tubulin (ectoderm); Swimming lane 4:GATA4, swimming lane 5:Actin alpha 2 (mesoderm); Swimming lane 6:Keratin-14, swimming lane 7:PDX-1, swimming lane 8:AFP (entoderm), the primer sees Table 2.
Table 2. detects noble cells and represents the gene PCR the primer
Test example 2 utilizes ox iPSCs to set up and " ox-goat " mosaic
Use 58 days Sas of gestation and can do the acceptor sheep by milk goat, adopt laparotomy ventrotomy to touch fetus, a strain ox iPSCs (about 1.1 * 10 through Uterus wall
6Individual cell) is expelled in the fetus abdominal cavity.Behind the goat full-term pregnancy, common property is given birth to 4 lambs, and wherein 1 male lamb whole body fur finds that big area is chimeric, is judged to be ox-sheep mosaic from the body surface feature, and regrettably this lamb was born back 2 hours because cardiorespiratory failure and death.Corpse is not found the organs abnormality phenomenon through after cuing open inspection.Goat fetus abdominal injection ox iPS cell is made the mosaic goat, and the mosaic lamb fur of giving birth to has many places black decorative pattern, and these decorative patterns and Holstein milk cow are closely similar.This chimeric lamb has in flakes at a plurality of positions of body surface, the black fur of slivering, comprising chest, back, lip, nose, eye face, auricle, four hoof, eyeball, tail point, positions such as scrotum.The D-LOOP hypervariable region sequences Design primer of using the Mitochondrial DNA of ox carries out Mitochondrial DNA to the mosaic goat and detects, there is the tissue of ox iPS cell chimerism to comprise: a plurality of tissues such as the heart, liver, spleen, lung, kidney, blood, blood vessel, testis, pancreas, small intestine and bone do not detect chimeric, confirm that this lamb is a cattle and sheep cytochimera goat.Inject Niu Chengti skin cells (BDFs) and (NDFs) contrast sheep simultaneously and the chimerism of ox cell do not occur.
Among electrophoresis Figure 19, the 1-30 swimming lane represents each histoorgan of chimera goat: 1 heart, 2 blood vessels, 3 external membranes of heart, 4 lymph nodes, 5 blood, 6 livers, 7 pancreas (-), 8 spleens, 9 oesophaguses, 10 stomaches, 11 small intestines (-), 12 large intestines, the 13BDF cell, 14BDF-iPSO cell, 15 acceptor fetus mothers (-), 16 brains, 17 spinal cords, 18 corneas, 19 lungs, 20 tracheaes, 21 kidneys, 22 testis, 23 casting skins, 24 pale skins, 25 skeletal muscle, 26 cartilages (-), 27 smooth muscles, the 28BDF cell, 29BDF-iPSO cell, 30 acceptor fetus mothers (-).
＜110〉Xibei Univ. of Agricultural ﹠ Forest Science ﹠ Technology
＜120〉utilize the transcription factor transfecting bovine somatic cells to become the method for inductive pluripotent stem cells
<160>4
<210>1
<211>1083bp
<212>DNA
<213>OCT4
<400>1
ATGGCGGGACACCTCGCTTCTGACTTCGCCTTCTCGCCCCCGCCGGGCGGTGGAGGCGAT 60
GGGCCGGGAGGGCCAGAGCCGGGCTGGGTTGATCCTCGGACCTGGATGAGCTTCCAAGGG 120
CCTCCCGGTGGGTCGGGGATCGGGCCGGGGGTTGTGCCTGGCGCCGAGGTGTGGGGGCTT 180
CCCCCGTGCCCCCCGCCCTATGACTTGTGTGGAGGGATGGCCTACTGTGCGCCGCAGGTT 240
GGAGTGGGGCCGGTGCCCCCAGGCGGCCTGGAGACCCCTCAGCCCGAGGGCGAGGCGGGA 300
GCCGGGGTGGAGAGCAACTCCGAGGGGGCCTCCCCGGACCCCTGCGCCGCACCCGCAGGC 360
GCCCCGAAACTGGACAAGGAGAAGCTGGAGCCGAACCCTGAGGAGTCCCAGGACATCAAA 420
GCTCTTCAGAAAGACCTTGAACAATTTGCCAAGCTCCTAAAGCAGAAGAGGATCACACTA 480
GGATATACCCAGGCCGATGTGGGGCTCACCCTGGGGGTTCTCTTTGGAAAGGTGTTCAGC 540
CAAACGACTATCTGCCGTTTTGAGGCTTTGCAGCTCAGTTTCAAGAACATGCGTAAGCTG 600
CGGCCCCTGCTGCAGAAGTGGGTGGAGGAAGCTGACAACAACGAGAATCTGCAGGAGATA 660
TGCAAGGCAGAGACCCTTGTGCAGGCCCGAAAGAGAAAGCGGACGAGTATCGAGAACCGA 720
GTGAGAGGCAACCTGGAGAGCATGTTCCTGCAGTGCCCGAAGCCCACCCTGCAGCAAATT 780
AGCCACATCGCCCAGCAGCTCGGGCTGGAGAAAGACGTGGTCCGAGTGTGGTTTTGCAAC 840
CGTCGCCAGAAGGGCAAACGATCAAGCAGTGACTACTCCCAACGTGAGGATTTTGAGGCT 900
GCTGGGTCTCCTTTCGCAGGGGGACCCGTATCCTTTCCTCTGGCGCCGGGGCCCCATTTT 960
GGTACCCCAGGCTACGGGGGCCCTCACTTCACTACTCTGTACTCTTCGGTCCCATTCCCT 1020
GAGGGTGAGGCCTTTCCCTCGGTGTCTGTCACCGCTCTGGGCTCCCCTATGCATGCAAAC 1080
TGA 1083
<210>2
<211>963bp
<212>DNA
<213>Sox2
<400>2
ATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGC 60
GGCGGCGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCGGGCGGCAACCAGAAGAACAGC 120
CCGGACCGAGTCAAGCGGCCCATGAACGCCTTCATGGTGTGGTCCCGCGGGCAGCGGCGC 180
AAGATGGCCCAAGAGAACCCTAAGATGCACAACTCGGAGATCAGCAAGCGCTTGGGCGCC 240
GAGTGGAAACTTTTGTCCGAGACGGAGAAGCGGCCGTTCATCGACGAGGCCAAGCGGCTG 300
CGAGCGCTGCACATGAAGGAACACCCGGATTATAAATACCGGCCCCGGCGGAAAACCAAG 360
ACGCTCATGAAGAAGGATAAGTACACACTGCCGGGAGGGCTGCTCGCCCCGGGCGGCAAC 420
AGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTCGGCGCGGGCGTGAACCAACGCATG 480
GACAGCTACGCGCACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGACCAG 540
CTGGGCTACCCGCAACACCCGGGCCTCAACGCGCACGGCGCCGCTCAGATGCAGCCCATG 600
CACCGCTACGACGTGAGCGCCCTGCAGTACAACTCTATGACCAGCTCGCAGACCTACATG 660
AACGGCTCGCCCACCTACAGCATGTCCTATTCTCAGCAGGGCACCCCTGGCATGGCGCTT 720
GGCTCCATGGGCTCGGTGGTGAAGTCCGAGGCCAGCTCCAGCCCCCCCGTGGTTACCTCT 780
TCTTCCCACTCCAGGGCGCCCTGCCAAGCCGGGGACCTCCGGGACATGATCAGCATGTAC 840
CTCCCCGGCGCCGAGGTGCCGGAGCCCGCCGCCCCCAGCAGACTTCACATGTCCCAGCAC 900
TACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCGCACATG 960
TGA 963
<210>3
<211>903bp
<212>DNA
<213>NANOG
<400>3
ATGAGTGTGGGCCCAGCTTGTCCCCAAAGCCTGCTTGGCCCCGAAGCATCCAACTCTAGG 60
GAATCTTCACCCATGCCTGAAGAAAGTTACGTGTCCTTGCAAACGTCATCTGCTGACACC 120
CTCGACACGGACACTGTCTCTCCTCTTCCCTCCTCCATGGATCTGCTTATTCAGGACAGT 180
CCTGATTCTTCCACAAGCCCCAGAGTGAAACCACTGTCCCCGTCTGTGGAGGAGAGCACA 240
GAGAAGGAAGAGACGGTCCCGGTCAAGAAACAAAAGATTAGAACTGTGTTCTCGCAGACC 300
CAGCTGTGTGTGCTCAATGACAGATTTCAGAGGCAGAAATACCTCAGTCTCCAGCAAATG 360
CAAGAACTTTCCAACATCTTGAACCTCAGCTACAAGCAGGTGAAGACCTGGTTCCAGAAC 420
CAGAGAATGAAATGTAAGAAATGGCAGAAAAACAACTGGCCGAGGAATAGCAATGGCATG 480
CCTCAGGGGCCAGCAATGGCAGAATACCCAGGCTTCTATTCCTACCACCAGGGGTGTTTG 540
GTGAACTCTCCTGGAAACCTGCCCATGTGGGGTAACCAGACCTGGAATAACCCCACGTGG 600
AGCAACCAGAGCTGGAACAGTCAGTCTTGGAGCAACCACTCCTGGAACAGTCAGGCCTGG 660
TGCCCCCAAGCCTGGAATAACCAGCCTTGGAACAATCAGTTCAACAACTACATGGAGGAA 720
TTCCTGCAGCCCGGGATCCAGCTCCAGCAGAATTCTCCCGTCTGTGATCTGGAGGCCACC 780
CTGGGAACTGCTGGGGAAAATTATAACGTTATACAGCAAACTGTCAAGTATTTCAATTCC 840
CAGCAGCAAATCACTGATTTATTCCCAAACTACCCTCTCAACATACAGCCTGAAGATTTG 900
TAA 903
<210>4
<211>618bp
<212>DNA
<213>LIN28
<400>4
ATGGGCTCTGTGTCAAACCAGCAGTTCGCAGGTGGCTGCGCTAAGGCGCCGGAGGAGGCG 60
CCGGAGGACGCGGCCCGCGCGGCGGAGGAGCCGCAGCTGCTGCACGGTGCGGGCATCTGT 120
AAGTGGTTCAACGTGCGCATGGGGTTCGGCTTCCTGTCCATGACCGCCCGCGCAGGGGTC 180
GCGCTCGACCCCCCGGTGGATGTCTTTGTGCACCAGAGTAAGCTGCACATGGAGGGCTTC 240
CGGAGCCTGAAGGAGGGGGAGGCCGTGGAGTTCACCTTTAAGAAGTCCGCCAAAGGCCTG 300
GAATCTATCCGAGTCACCGGCCCTGGGGGGGTGTTCTGTATTGGGAGTGAAAGGCGGCCC 360
AAAGGGAAGAATATGCAGAAACGCAGATCAAAGGGAGACAGGTGCTACAACTGTGGAGGT 420
CTAGACCATCATGCCAAGGAGTGCAAACTGCCACCGCAGCCCAAGAAGTGCCATTTCTGC 480
CAGAGCATCAACCATATGGTAGCTTCGTGCCCACTGAAGGCCCAGCAAGCTCCCAGCTCC 540
CAGGGAAAGCCAGCCTACTTTCGGGAGGAGGAAGAAGAGATCCATAGCTCTGCCATGCTC 600
CCAGAGGCCCAGAATTGA 618
Claims (7)
1. a method of utilizing the transcription factor transfecting bovine somatic cells to become inductive pluripotent stem cells comprises the steps:
1) fibroblastic separation of ox-hide skin and cultivation
With ox-hide skin inoblast BDFs and the new born bovine skin flbroblast NDFs of growing up, nutrient does not obtain a large amount of adult ox-hide skin cell and new born bovine skin flbroblast after the routine training;
2) ox is kept the clone and the Expressed by Retrovirus Vector thereof of versatility transcription factor gene
From 50-60 age in days ox fetus, separate sex-ridge, extract total RNA, obtain cDNA through reverse transcription reaction; With cDNA is template, reaction obtains ox Oct4, Sox2, Nanog and four gene amplification products of Lin28 and correctly then goal gene is inserted among the retroviral vector pMSCVneo through the sequence verification sequence through PCR, makes up the retrovirus expression vector of these 4 kinds of genes;
3) retroviral packing and preparation
The PT67 packing cell is cultivated in containing the DMEM substratum of 15% foetal calf serum according to ordinary method, used liposome the retroviral vector transfection that makes up is entered packing cell PT67 cell; 8 μ g are contained Oct4, Sox2, the heterogeneic retrovirus expression vector plasmid of Nanog and Lin28 and 4 part of 20 μ l transfection reagent liposome lipofectamine2000 optimize liquid with 500 μ lOpti-MEM-I+GlutaMAX-I transfections respectively and dilute, mixing gently, hatched under the room temperature 5 minutes, the diluent that will contain liposome lipofectamine2000 then slowly splashes in the diluent that contains retroviral plasmid, mixing gently, after hatching 20 minutes again under the room temperature, above-mentioned mixed solution is dropwise added in the PT67 packing born of the same parents culture dish, change conventional cell culture fluid into after 4-6 hour; After the transfection 24 hours, change every day contain virion nutrient solution once, for three days on end, collect viral suspension, under 4 ℃ of conditions through 25000 rev/mins after centrifugal 90 minutes, 10 times of concentrating virus supernatant liquors; To include Oct4, Sox2, Nanog and Lin28 gene viruses supernatant liquor and carry out balanced mix, and add the specific four factor genes combination of 8 μ g/m1Polybrene composition ,-80 ℃ of preservations are standby;
4) acquisition of the iPS cell of retroviral infection ox-hide skin inoblast and ox
To grow up ox-hide skin inoblast BDFs and newborn bull skin flbroblast NDFs cultivates in the 60mm plastic culture dish according to ordinary method, treats in the culture dish that cell grows into the mixed solution that will comprise the retrovirus supernatant liquor of Oct4, Sox2, Nanog and Lin28 gene transcription factor when 70-80% merges and joins respectively in inoblast BDFs and the NDFs culture dish and infect inoblast; Cell goes down to posterity by 1: 3 routine after covering with culture dish, visual cell's growing state 6-10 days with cell with 1 * 10
5The density of cells/well is transferred to and is covered with in advance on people's amnion (HAM) 6 well culture plates, and the personnel selection amnion replaces mouse embryo fibroblasts (MEF) to cultivate metainfective ox cell as feeder layer, and nutrient solution is replaced with the stem cell nutrient solution simultaneously; Measure and change liquid every day half in the culture hole, observed continuously 20-28 days, till having cell colony to occur, was designated as for 0 generation, is ox iPSCs.
2. method according to claim 1, it is characterized in that: using preceding 1 hour of liposome packaging virus particle, change the nutrient solution DMEM substratum of packing cell PT67 into serum-free medium, retroviral plasmid DNA and 10-20 μ l liposome that 4-8 μ g includes transcription factor gene join respectively in the 500 μ l Opti-MEM-I+GlutaMAX-I optimization transfection liquid, soft mixing, incubated at room, then with the plasmid DNA and the soft mixing of liposome that dilute, incubated at room again, after 20 minutes, the plasmid-lipidosome mixed solution is dropwise added in the PT67 Tissue Culture Dish.
3. method according to claim 1 is characterized in that: the consisting of of described stem cell nutrient solution: contain in every 100ml solution: the knockout-DMEM of 82.69ml, 15ml FBS, 1ml concentration are that 200mM glutamine, 1ml concentration are that 10mM non-essential amino acid, 200 μ l concentration are that 55mM beta-mercaptoethanol, 10 μ l concentration are that 400ng/ml people's recombination basic fibroblast somatomedin, 100 μ l concentration are 10
5The U/ml leukaemia inhibitory factor.
4. the recombinant retroviral expression vector pMSCV-Nanog of the described Nanog gene of claim 1.
5. the application of the described recombinant retroviral expression vector pMSCV-Nanog of claim 4 in the gene genetically engineered.
6. the recombinant retroviral expression vector pMSCV-Lin28 of the described Lin28 gene of claim 1.
7. the application of the described recombinant retroviral expression vector pMSCV-Lin28 of claim 6 in the gene genetically engineered.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102189801A CN101705247B (en) | 2009-11-16 | 2009-11-16 | Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102189801A CN101705247B (en) | 2009-11-16 | 2009-11-16 | Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101705247A true CN101705247A (en) | 2010-05-12 |
| CN101705247B CN101705247B (en) | 2012-06-06 |
Family
ID=42375502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102189801A Expired - Fee Related CN101705247B (en) | 2009-11-16 | 2009-11-16 | Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101705247B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102409022A (en) * | 2010-09-25 | 2012-04-11 | 李凌松 | Method for culturing human artificially induced pluripotent stem cells by using human amnion mesenchyme cells as culture layer |
| CN102965393A (en) * | 2012-11-06 | 2013-03-13 | 上海交通大学 | Method for preparing human induced pluripotent stem cells and use of human induced pluripotent stem cells |
| CN111304157A (en) * | 2020-03-16 | 2020-06-19 | 吉林大学 | Method for obtaining bovine initial state induced pluripotent stem cells |
| CN113430229A (en) * | 2021-06-23 | 2021-09-24 | 温州医科大学 | Construction method of human-derived BAV-TAA disease pluripotent stem cell model |
| CN115569229A (en) * | 2022-08-30 | 2023-01-06 | 中南大学湘雅三医院 | Skin soft tissue protection material carrying multiple metazoan components and preparation method thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009061442A1 (en) * | 2007-11-06 | 2009-05-14 | Children's Medical Center Corporation | Method to produce induced pluripotent stem (ips) cells form non-embryonic human cells |
| CN101250502A (en) * | 2008-04-01 | 2008-08-27 | 中国科学院上海生命科学研究院 | Method for preparing evoked pluripotent stem cell |
-
2009
- 2009-11-16 CN CN2009102189801A patent/CN101705247B/en not_active Expired - Fee Related
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102409022A (en) * | 2010-09-25 | 2012-04-11 | 李凌松 | Method for culturing human artificially induced pluripotent stem cells by using human amnion mesenchyme cells as culture layer |
| CN102409022B (en) * | 2010-09-25 | 2013-08-07 | 李凌松 | Method for culturing human artificially induced pluripotent stem cells by using human amnion mesenchyme cells as culture layer |
| CN102965393A (en) * | 2012-11-06 | 2013-03-13 | 上海交通大学 | Method for preparing human induced pluripotent stem cells and use of human induced pluripotent stem cells |
| CN102965393B (en) * | 2012-11-06 | 2015-08-26 | 上海交通大学 | The preparation method and its usage of people's induced multi-potent stem cells |
| CN111304157A (en) * | 2020-03-16 | 2020-06-19 | 吉林大学 | Method for obtaining bovine initial state induced pluripotent stem cells |
| CN111304157B (en) * | 2020-03-16 | 2023-05-12 | 吉林大学 | Method for obtaining bovine initial state induced pluripotent stem cells |
| CN113430229A (en) * | 2021-06-23 | 2021-09-24 | 温州医科大学 | Construction method of human-derived BAV-TAA disease pluripotent stem cell model |
| CN115569229A (en) * | 2022-08-30 | 2023-01-06 | 中南大学湘雅三医院 | Skin soft tissue protection material carrying multiple metazoan components and preparation method thereof |
| CN115569229B (en) * | 2022-08-30 | 2023-12-22 | 中南大学湘雅三医院 | Skin soft tissue protective material carrying multiple metaelements and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101705247B (en) | 2012-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Verma et al. | Inducing pluripotency in somatic cells from the snow leopard (Panthera uncia), an endangered felid | |
| Wu et al. | Generation of induced pluripotent stem cells from newborn marmoset skin fibroblasts | |
| US9926532B2 (en) | Method of generating induced pluripotent stem cells and differentiated cells | |
| CN101705247B (en) | Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors | |
| US20150072416A1 (en) | Metabolite for improving production, maintenance and proliferation of pluripotent stem cells, composition comprising the same, and method of culturing pluripotent stem cell using the same | |
| US20130295579A1 (en) | Method for preparing induced pluripotent stem cells and medium used for preparing induced pluripotent stem cells | |
| CN102712903A (en) | Generation of induced pluripotent stem cells from cord blood | |
| CN108085299A (en) | A kind of efficient induced multi-potent stem cell reprogramming method of blood cell | |
| CN103333920A (en) | Culture medium for establishing pig iPS cell line and culture method thereof | |
| CN102725399B (en) | Materials and methods for generating pluripotent stem cells | |
| CN112961833B (en) | Method for reprogramming immortalized lymphocyte cell line into induced pluripotent stem cell | |
| Petkov et al. | Long-term culture of porcine induced pluripotent stem-like cells under feeder-free conditions in the presence of histone deacetylase inhibitors | |
| CN101984050B (en) | Cell type used for producing induced pluripotent stem (iPS) cells and preparation method and application thereof | |
| CN101705248B (en) | Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors | |
| CN101492676B (en) | Method for producing derivational pluripotent stem cell with meninges cell and uses thereof | |
| CN101497874A (en) | Method for promoting somatic cell proliferation | |
| CN101735985A (en) | Inductive pluripotent stem cells and preparation method thereof | |
| CN103923877B (en) | A kind of method setting up the porcine somatic cell induction reprogrammed system of DOX regulation and control | |
| Tweedell | New paths to pluripotent stem cells | |
| CN101812480B (en) | Method utilizing transcription factor to transfect bovine body cell into induced pluripotent stem cell | |
| CN110042123A (en) | A method of bovine somatic cells cloning efficiency is improved by inducing expression zfp57 | |
| CN105002134B (en) | Prepare the composition of pluripotent stem cell, method, kit and application thereof | |
| CN103571794A (en) | Method for inhibiting PUMA function and improving iPS (induced Pluripotent Stem) cell construction effect | |
| CN102174466A (en) | Porcine somatic cell mutagensis method | |
| Kang et al. | Adipose stromal cells are a more efficient source than adipose stem cells in retrovirus-mediated iPS induction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120606 Termination date: 20121116 |