CN101705233A - Recombinant human herpes simplex virus I protein HSV I gG and application thereof - Google Patents
Recombinant human herpes simplex virus I protein HSV I gG and application thereof Download PDFInfo
- Publication number
- CN101705233A CN101705233A CN200910217887A CN200910217887A CN101705233A CN 101705233 A CN101705233 A CN 101705233A CN 200910217887 A CN200910217887 A CN 200910217887A CN 200910217887 A CN200910217887 A CN 200910217887A CN 101705233 A CN101705233 A CN 101705233A
- Authority
- CN
- China
- Prior art keywords
- hsv
- herpes simplex
- simplex virus
- human herpes
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a recombinant human herpes simplex virus I protein HSV I gG and application thereof. In the invention, a computer is used for analyzing all amino acid sequences of the human herpes simplex virus I so as to screen out the dominant antigen epitopes of the type-specific proteins gG of the human herpes simplex virus I, and the recombinant human herpes simplex virus I protein HSV I gG, which is produced by the genetic engineering method and simply named as HSV IgG, can avoid the problem that the specificity detection is lowered due to false positive caused by low purity of protein antigens or poor specificity, and provide more specific and accurate raw materials to detect the infection of the human herpes simplex virus. Compared with the similar kits, the diagnosis kit prepared by using the recombinant human herpes simplex virus I protein HSV I gG as the antigen has the advantages of strong specificity, high sensitivity and the like, and better meets the needs of clinically diagnosing the infection of the human herpes simplex virus; and when inoculated as a vaccine, the recombinant human herpes simplex virus I protein HSV I gG can prevent virus infection.
Description
Technical field
The present invention relates to biological technical field, relate to particularly a kind of recombinant human herpes simplex virus I albumen and with it as the detection of antigens test kit and the preparation vaccine application.
Background technology
(Herpes simplex virus, HSV) spherical in shape, genome is a linear DNA molecule to hsv, is made up of covalently bound long segment (L) and short-movie section (S).The different albumen of kind more than 30 are formed virus structural protein (as capsid protein, envelope protein), and the DNA of protection HSV is at the pathogenic effects of HSV with induce in the immune response and play an important role.
Patient is a contagium, and is main by directly contact and transmission through sex closely.HSV through the oral cavity, number of ways such as respiratory tract, reproductive tract mucous membrane and damaged skin invade body.The people infects very general, and infection rate reaches 80%～90%, and common clinical manifestation is the bleb that mucous membrane or local skin gather, and also serious systemic disease can take place occasionally, involves internal organ.
HSV also can pass through placental infection, influences embryonic cell mitotic division, easily miscarries, causes congenital disorders such as fetal anomaly, mental retardation.About 40%～60% newborn infant can be infected when the birth canal that infects by HSV, high heat, expiratory dyspnea and central nervous system pathological change occur, wherein 60%～70% be contaminted the newborn infant can be therefore and dead, sequela can reach 95% among the survivor.Some investigation show that HSV may relevant (Kriebs JM.Understanding herpes simplex virus:transmission with lip cancer, carcinoma vulvae and cervical cancer in addition, diagnosis, and considerations in pregnancymanagement.J Midwifery Womens Health.2008May-Jun; 53 (3): 202-8).Quick, the accurate detection method of setting up the HSV infection is the key point that prevention HSV infects.
The human herpes simplex vicus is divided into I type and II type, the herpesvirus infection diagnostic method has virus to separate (Tanchev S, Shentov B.Herpes simplex virus infection in pregnancy and transmission to neonatal.AkushGinekol (Sofiia) .2005 at present; 44 (6): 31-5.), (Kimberlin DW.Diagnosis of herpes simplex virus inthe era of polymerase chain reaction.Pediatr Infect Dis is Sep J.2006 for the PCR method; 25 (9): 841-2.) and Serological testing (Eing BR, Lippelt L, Lorentzen EU, et al.Evaluation of confirmatory strategies for detectionof type-specific antibodies against herpes simplex virus type 2.Journal of ClinicalMicrobiology.2002,40 (2): 407-413; Strick L, Wald A.Type-specific testing for herpessimplex virus[J] .Expert Rev Mol Diagn, 2004,4 (4): 443-453; Martins TB, Welch RJ, HillHR, Litwin CM.Comparison of a Multiplexed HSV Type-specific IgM Serology Assay toELISA, Immunoblot and Western Blot.Clin Vaccine Immunol.2008 Nov 19.).The simple and rapid characteristic of Serological testing is used widely it clinically.
In the world, lack under the situation of effectively treating virus infective medicament at present, become a kind of important medical intervention means by the vaccination prophylaxis of viral infections.Simultaneously, the development of HSV vaccine also is to carry out one of key areas of HSV research.Have the HSV proteantigen of high specific, strong immunogenicity and the complete antigenic determinant of trying one's best, have important application value in diagnosis and the vaccine development field of HSV.
Summary of the invention
The purpose of this invention is to provide the gene fragment of a kind of recombinant human herpes simplex virus I protein HSV I gG, its nucleotide sequence is shown in SEQ ID NO:1.
Another object of the present invention provides a kind of recombinant human herpes simplex virus I protein HSV I gG, and its aminoacid sequence is shown in SEQ ID NO:2.
A kind of recombinant human herpes simplex virus I of the present invention protein HSV I gG is prepared by following method:
A, synthetic primer:
P1：5’ACCATATGCAACCCCAACTCCAGACCACCG3’
P2：5’ACCTCGAGCCCGCGTTCGGACGGCAGG3’
B, be template with human herpes simplex vicus's culture, pcr amplification obtains gene fragment HSV I gG;
C, gene fragment HSV I gG is inserted among the expression vector pET-28a, obtain plasmid pET-28a-HSV I gG;
In d, the plasmid pET-28a-HSV I gG transfection dust Xi Shi e. coli bl21 (DE3);
F, bacteria breaking, protein purification gets recombinant protein HSV I gG.
Another object of the present invention provides a kind of recombinant human herpes simplex virus I protein I gM antibody assay kit, be to be antigen with HSV I gG, marker is the IgM antibody colloidal gold detection kit of Radioactive colloidal gold or the IgM antibody ELISA detection kit that marker is horseradish peroxidase;
Described a kind of recombinant human herpes simplex virus I protein I gM antibody colloidal gold detection kit is prepared by following method:
1) gets the HAuCl of 1.0g
4.H
2O is dissolved in the 100ml purified water, is made into 1% chlorauric acid solution; Get 1% chlorauric acid solution 1ml and add in the 100ml boiling water, add 1% trisodium citrate 2ml, continue to boil 30min, synthetic Radioactive colloidal gold;
2) get 6ml synthetic colloidal gold solution, carry out scanning inspection at the 400-700nm place; Get the about 30nm Radioactive colloidal gold of synthetic 406ml, use 0.1M K
2CO
3Transfer PH to 7, measure 5mg/ml HSV I gG2.65ml and be diluted to 40ml, add colloidal gold solution while stirring with the 20mM Tris-Cl of PH8.2, continue to stir 10min, measure 1%BSA 40ml, add while stirring, continue to stir 10min, 4 ℃ of centrifugal 10min of 3000r/min, go precipitation, supernatant is (transferring to PH to 7) after the balance again, 4 ℃ of centrifugal 45min of 12000r/min, remove supernatant, repeat 2 times; With quality controlled serum colloidal gold composite is tested, after the assay was approved, HSV I gG colloidal gold composite stoste to dilute between one times, the metal spraying amount is that 25.0 μ l/cm bag is carried the gold pad, behind 37 ℃, relative humidity 30% following air seasoning 16-22 hour, cut then;
3) precut NC film (source Shanghai Jin Biao company; Model HF12002), adhesive back, by anti-human IgM antibody, the line amount is 1.0 μ l/cm with concentration 2.0mg/ml bag; With by bag by concentration be 5.0mg/ml, package amount be 1.0 μ l/cm rabbit anti-herpes simplex virus I type antibody line bag by on the NC film, drying is 1.0 hours under 37 ℃, the condition of relative humidity 30% below.
4) tear the paper film that the band backboard NC film that wraps tested survey line and nature controlling line detects line end, HSV I gG Radioactive colloidal gold binding substances pad is sticked on the Quality Control line end of NC film, intersect about 1mm, compacting, the load sample pad that sanction is good sticks on the lower end of HSV I gG Radioactive colloidal gold binding substances pad, compacting, the Quality Control line end that good absorbent pad sticks on the NC film will be cut out, the check-out console two ends that post are cut remove 1cm, it is wide to be cut into 4mm with slitting shear machine, encapsulation.
Another object of the present invention is the application of a kind of recombinant human herpes simplex virus I protein HSV I gG at preparation human herpes simplex vicus I vaccine.
The present invention filters out the dominant antigen epi-position of the type specificity albumen gG of human herpes simplex vicus I by whole aminoacid sequences of Computer Analysis human herpes simplex vicus I, comprise 208 amino acid of human herpes simplex vicus gG from terminal the 295th to the 502nd of N-. wherein, gG purpose peptide segment DNA sequence is the 883rd to the 1506th Nucleotide of gG.
According to the segmental dna sequence dna of purpose, promptly the gG of HSVI goes up the cDNA sequence of purpose peptide section and the restriction enzyme site on the plasmid, has designed PCR primer P1, P2; The 883rd to the 1506th Nucleotide of gG is used to increase.Primer P1 and P2 have the restriction enzyme site of NdeI and XhoI respectively, and jointly corresponding to gG above-mentioned segmental 5 ' terminal 3 ' end.Produced a kind of recombinant human herpes simplex virus I protein HSV I gG, its Nucleotide series sequence is shown in SEQ ID No.1, and aminoacid sequence is shown in SEQ ID NO:2.
A kind of recombinant human herpes simplex virus I of the present invention protein HSV I gG, be called for short HSV I gG, can avoid that low or poor specificity causes false positive to reduce problems such as detection specificity owing to proteantigen purity, for the detection of people's herpes simplex infections provides more special, raw material accurately.Utilize a kind of recombinant human herpes simplex virus I of the present invention protein HSV I gG to be antigen, the diagnostic kit of preparation, compare with the similar test kit on the market, have advantages such as high specificity, sensitivity height, the needs that the herpes virus hominis infects clinical diagnosis have been satisfied well, as vaccine inoculation, can prophylaxis of viral infections.
Description of drawings
The structure schema of Fig. 1 expression plasmid pET-28a-HSV I gG.
The gel electrophoresis figure of Fig. 2 pcr amplification product HSV I gG, HSV is HSV I gG.
Fig. 3 induces back thalline 12%SDS-PAGE electrophorogram, and wherein M represents Marker, 1 expression target protein.
Embodiment
The preparation of one one kinds of recombinant human herpes simplex virus I of embodiment protein HSV I gG
1. screening of human herpes simplex vicus I proteantigen epi-position and goal gene are cloned
Artificial sequence synthesized primer is as follows:
P1：ACCATATGCAACCCCAACTCCAGACCACCG
P2：ACCTCGAGCCCGCGTTCGGACGGCAGG
Above primer is synthetic by magnificent Bioisystech Co., Ltd;
With human herpes simplex vicus's culture (Inst. of Viruses, China Preventive Medicine Science Academy gives) is template, obtains goal gene recombinant fragment: gG with primer P1 and P2 amplification.Amplified production detects through agarose gel electrophoresis, and the result as shown in Figure 1.Cutting contains the blob of viscose of target DNA band, (lead to-Beijing TAKARA company with DNA fast purifying test kit available from the six directions, name of product: TAKARA MiniBEST Plasmid purification) reclaim goal gene HSV I gG, operation is undertaken by product description.
2. the structure of expression vector pET-28a-HSVI and evaluation
PET-28a carrier (available from magnificent Bioisystech Co., Ltd) and pcr amplification product gG target DNA fragment are through NdeI and XhoI double digestion, product purification (adopt TAKARA MiniBEST Plasmid purification test kit, lead to-Beijing TAKARA company available from the six directions) is after T
4Dna ligase is connected with carrier, connect product and be transformed into e. coli bl21 (DE3) competence (available from magnificent Bioisystech Co., Ltd), coat the LB that contains kantlex and be inverted overnight incubation for dull and stereotyped last 37 ℃, select the dull and stereotyped bacterium colony of going up growth next day, alkaline lysis extracting plasmid, agarose gel electrophoresis selects suspicious recombinant plasmid to carry out pcr amplification as template, recon plasmid that amplified production is arranged through restriction endonuclease NdeI and EcoRI double digestion, evaluation, wherein there are 3 positive recons of recon.Select a positive recombinant to send match hundred victory companies order-checking to identify from 3 positive recombinants, the result shows and has inserted goal gene on this plasmid really, and direction of insertion is correct, with this recombinant plasmid called after expression plasmid pET-28a-HSV I gG.
3. the structure of the engineering bacteria of a recombinant human herpes simplex virus I protein HSV I gG
With expression plasmid pET-28a-HSV I gG chemical transformation ((U.S.) J. Sa nurse Brooker (JosephSambrook), (U.S.) D.W. Russell (DavidW.Russell) work, Huang Peitang etc. translate. the molecular cloning experiment guide. and Science Press, 2002.) change colon bacillus BL21 (DE3) bacterial strain (available from magnificent Bioisystech Co., Ltd) over to, coat the LB that contains kantlex and be inverted overnight incubation for dull and stereotyped last 37 ℃, select the dull and stereotyped bacterium colony LB culture medium culturing that contains kantlex that goes up growth next day, with IPTG abduction delivering 5 hours, thalline after inducing is analyzed (the same document) with 12%SDS-PAGE, the result as shown in Figure 3, the bacterial strain of expressing human hsv protein is required engineering strain with 8% glycerine-70 ℃ preservation.
4. the expression and purification of a recombinant human herpes simplex virus I protein HSV I gG
A kind of recombinant human herpes simplex virus I protein HSV I gG colon bacillus CGMCC No. strain bacterium of the expression that inducing culture has made up, with IPTG abduction delivering 5 hours, centrifugal collection thalline, add cellular lysate liquid (50mm pH8.0Tris-Cl with 1: 10 (W/V), 50mm NaCl, 50% glycerine), adding the magnetic agitation rotor stirred 30 minutes, through carrying out ultrasonic bacteria breaking (ice bath, power 200W, ultrasonic 3 seconds, 5 seconds at interval, ultrasonic 80 times), (Glutathione Sepharose4B post material 50ml adorns post to the Histidine affinity column, and 400mlPBS damping fluid balance is crossed post, flow velocity 5ml/min; Ultrasonic supernatant liquor after centrifugal is gone up sample, flow velocity 3ml/min with 200mlPBS dilution back; The 400mlPBS damping fluid is washed post, flow velocity 5ml/min; 250ml elution buffer wash-out, flow velocity 3ml/min, Ultraviolet Detector 280nm detect, and collect elution peak) and ion-exchange chromatography (100mlChelating Sepharose FF adorns post, the NiCl of 300ml200mm
2Cross post, flow velocity 5ml/min; The 500ml level pad is washed notes, flow velocity 10ml/min; Histidine affinity column purifying is collected the liquid upper prop, flow velocity 3ml/min, the 500ml level pad is washed notes, flow velocity 5ml/min; With the elution buffer wash-out that contains imidazoles 20mm, 50mm, 100mm, each 100ml of 200mm respectively, Ultraviolet Detector 280nm detects absorption value, collects elution peak; SDS-PAGE electrophoresis detection purified components) obtains the recombinant protein of purifying.
5. recombinant human herpes simplex virus I protein HSV I gG Western-blot checking
For verifying that a kind of recombinant human herpes simplex virus I protein HSV I gG protein and anti-HSV I antiserum(antisera) are reactive and the goal gene of recombinating obtains to express and have antigenicity, test with the Western-blot method.Positive serum is: the 10 parts of anti-HSVI antibody positive of rabbit serum (available from Beijing hundred peace world Pharmaceutical Technology Co., Ltd) and the 30 parts of anti-HSVI antibody positive of people serum (detecting confirmation through the ELISA method).Negative serum is: 10 parts contrast normal rabbit serum and the 30 parts of anti-HSVI negative antibody of people serum (detecting confirmation through the ELISA method).Result such as table 1.
Table 1 HSV I gG Western-blot verifies the result
| Serum sample | Total routine number | Positive routine number | Negative routine number | Positive rate | Negative recall rate |
| The anti-HSV I of rabbit antibody positive serum | ??10 | ??10 | ??0 | ??100％ | ??0 |
| The contrast normal rabbit serum | ??10 | ??0 | ??10 | ??0 | ??100％ |
| The anti-HSV I of people antibody positive serum | ??30 | ??30 | ??0 | ??100％ | ??0 |
| The anti-HSV I of people negative antibody serum | ??30 | ??0 | ??30 | ??0 | ??100％ |
The result shows, 10 parts of rabbit anti-HSVI antibody positive serum and the 30 parts of anti-HSV I of people antibody positive serum with HSV I viral cultures immune rabbit gained all produce positive reaction with antigen expressed, and 10 parts of contrast normal rabbit serums and the 30 parts of anti-HSV I of people negative antibody serum and antigen expressed all produce negative reaction.Results suggest reorganization goal gene obtains to express, and HSV IgG and totivirus protein have tangible cross reactivity, and have very strong specificity, have the practical application meaning.
The preparation of embodiment two, recombinant human herpes simplex virus I protein I gM antibody colloidal gold detection kit and performance calibrating
1. the preparation of recombinant human herpes simplex virus I protein I gM antibody colloidal gold detection kit
The above HSV I gG that makes as the test kit labelled antigen, is measured HSV I IgM antibody with colloidal gold method.
(1) the present invention of test kit principle is according to immunocapture method principle, and by nitrocellulose filter, colloid gold label genetically engineered recombinant herpes simplex virus I type (HSV I) antigen is tracer with anti-human IgM antibody bag.Add serum to be checked during use, as containing anti-HSV1 specific IgM antibodies in the sample, then can combine with the anti-human IgM antibody on film surface and form mixture, this mixture combines with the HSV I antigen of colloid gold label and presents the red-purple band.
(2) the test kit performance optimization (is collected the anti-human herpes simplex vicus I type IgM antibody positive of how tame hospital through clinical verification with positive and negative quality control product, negative serum, recheck screening with the anti-herpes simplex virus I type IgM antibody ELISA test kit that Italian SORIN company provides, the anti-herpes simplex virus I type IgM positive that obtains, negative serum is established as the positive and negative quality control product of enterprises) be specimen, adopt the square formation titration to determine the working concentration of best anti-people IgM and HSV I gG antigen colloidal gold (HSV1-Ag.G) binding substances, result such as table 2, drawn by the result, anti-people IgM (anti-people μ chain) antibody line bag is 2.0mg/ml by concentration, HSV I-HSV I gG mixture is carried gold in concentrated stoste to bag between diluting a times and is filled up.
The selection of best anti-people IgM of table 2 and HSV I gG-Ag.G binding substances working concentration
-: negative reaction (no detection line); ±: probable positive (detection line mays be seen indistinctly); +: positive reaction (detection line occurring); ++: than strong positive reaction (detection line is clear); +++strong positive reaction (the detection line color is dark) (following explanation is together)
Determining that anti-human IgM antibody line bag is that 2.0mg/ml, HSV I gG-Ag.G mixture are carried on the golden basis of filling up to bag between diluting a times in concentrated stoste by concentration, with the inner Quality Control positive and negative quality control product (source and standard are the same) is specimen, and it is 1.0 μ l/cm that best anti-human IgM antibody line amount (the metal spraying amount is 20 μ l/cm) is selected in titration.The results are shown in Table 3.
Determining of the best anti-human IgM antibody line amount of table 3
-: negative reaction; ±: probable positive; +: positive reaction; ++: than strong positive reaction; +++strong positive reaction
Determining that anti-human IgM antibody line concentration is 2.0mg/ml, the line amount is that 1.0 μ l/cm and HSV I gG antigen colloidal gold mixture specking concentration are to concentrate stoste to the basis between diluting a times, with the inner Quality Control positive and negative quality control product (source and standard are the same) is specimen, and adopting the square formation titration to select best Radioactive colloidal gold binding substances metal spraying amount is 25.0 μ l/cm.The results are shown in Table 4.
Determining of the best HSV I of table 4 gG antigen colloidal gold mixture metal spraying amount
-: negative reaction; ±: probable positive; +: positive reaction; ++: than strong positive reaction; +++strong positive reaction
On the basis of determining antigen colloidal gold mixture package amount, select the bag of nature controlling line rabbit anti-herpes simplex virus HSV I gG type antibody by concentration.Rabbit anti-herpes simplex virus HSV I gG type antibody sandwich amount is 1.0 μ l/cm, and bag is 5.0mg/ml by concentration.The results are shown in Table 5.
The selection of table 5 nature controlling line rabbit anti-herpes simplex virus I type antibody sandwich concentration
±: nature controlling line mays be seen indistinctly; +: nature controlling line appears; ++: nature controlling line is clear; +++: nature controlling line is clear thick
Anti-people μ chain line bag by after, seal with following buffering system respectively, the comparison sealing effect, the result shows and contains PEG
20000Sensitivity of closed system sealing back and specificity all descend to some extent, other sealings and the results that do not seal are as broad as long, so select not seal nitrocellulose filter.The results are shown in Table 6.
The Sptting plate of the different closed systems of table 6 relatively
-: negative reaction; ±: probable positive; +: positive reaction; ++: than strong positive reaction; +++strong positive reaction
(3) preparation of test kit
1) gets the HAuCl of 1.0g
4.H
2O is dissolved in the 100ml purified water, is made into 1% chlorauric acid solution; Get 1% chlorauric acid solution of 1ml and go in the 100ml boiling water, add 2ml, 1% trisodium citrate, continue to boil 30min, synthetic Radioactive colloidal gold;
2) get 6ml synthetic colloidal gold solution, carry out scanning inspection at the 400-700nm place; Get the about 30nm Radioactive colloidal gold of synthetic 406ml, use 0.1M K
2CO
3Transfer PH to 7, measure 5mg/ml HSV I gG antigen 2.65ml, be diluted to 40ml with the 20mMTris-Cl of PH8.2, add colloidal gold solution while stirring, continue to stir 10min, measure 1%BSA 40ml, add aforementioned solution while stirring, continue to stir 10min, 4 ℃ of centrifugal 10min of 3000r/min go precipitation, supernatant is again after the balance, 4 ℃ of centrifugal 45min of 12000r/min remove supernatant, repeat 2 times; With inner quality controlled serum colloidal gold composite is tested, after the assay was approved, press aforementioned definite concentration, metal spraying amount bag, then 37 ℃, wet 30% following air seasoning 16-22 hour (spending the night) back cutting relatively by HSV I gG antigen colloidal gold mixture.
3) precut NC film, adhesive back, by on the NC film, drying is 1.0 hours under 37 ℃, the condition of relative humidity 30% below by mouse-anti people IgM (anti-people μ chain) antibody and rabbit anti-herpes simplex virus I type antibody line bag for concentration of determining by the front and line amount bag.
4) tear the paper film that the NC film (band backboard) that wraps tested survey line and nature controlling line detects line end, antigen colloidal gold binding substances pad is sticked on the Quality Control line end of NC film, intersect about 1mm, compacting, the load sample pad that sanction is good sticks on the lower end of antigen colloidal gold binding substances pad, and compacting will be cut out the Quality Control line end that good absorbent pad sticks on the NC film, the check-out console two ends that post are cut remove 1cm, it is wide to be cut into 4mm with slitting shear machine.Extract 18, detect the work in-process test card with inner quality controlled serum.
5) each test card is encapsulated separately, each independent packaging is 1 person-portion, and 20 person-portions are packaged into 1 box.Sampling inspection.
Each buffer formulation is as follows:
1) anti-human IgM antibody bag is cushioned liquid formula: 20mM Tris-Cl damping fluid (pH8.2) sees Table 7.
Table 7
| Content | ??500ml |
| ??Tris | ??1.2g |
| ??2M?HCl | On demand |
| Purified water | Constant volume is to 500ml |
| 0.45 μ m filtering membrane | On demand |
2) rabbit anti-herpes simplex virus I type antibody sandwich buffer formulation: 20mM Tris-Cl damping fluid (pH8.2) sees Table 8.
Table 8
| Content | ??500ml |
| ??Tris | ??1.2g |
| ??2M?HCl | On demand |
| Purified water | Constant volume is to 500ml |
| 0.45 μ m filtering membrane | On demand |
3) antigen colloidal gold mixture bag is cushioned liquid formula: 20mM TBS damping fluid (pH8.2) sees Table 9.
Table 9
| Content | ??1000ml |
| ??Tris | ??2.4g |
| 0.15M sodium-chlor | ??8.8g |
| ??2M?HCl | On demand |
| ??1→100BSA | ??10g |
| Purified water | Constant volume is to 1000ml |
| 0.45 μ m filtering membrane | On demand |
(4) test kit uses working method:
1) opens the packaging of aluminium foil bag of test card, take out test card.
2) test card being inclined to the application of sample nose end is lower than the other end and is no less than 1.0cm.
3) get 100 μ l serum to be checked and join in the circular sample hole, room temperature (15 ℃～30 ℃) is placed and was observed and the record result in 25 minutes.
4) assay is judged:
Positive: two red-purple lines bands (detection line and nature controlling line position) appear in the interpretation window;
Negative: a red-purple lines band (detection line and nature controlling line position) only appears in the interpretation window.
Invalid: interpretation window nature controlling line position does not have red-purple lines band.
2. test kit Performance Detection experiment
(1) specificity (accuracy) is measured: the Radioactive colloidal gold catch assay method by previous experiments is determined, detect several other serum materials, the observing response specificity.The result shows, uses test kit of the present invention to detect 15 parts of negative serums (clinical definite), and coincidence rate is 100%; Detect 50 parts of Rheumatoid factors, polyclonal positive serum samples, 50 parts of hepatitis C positive serum samples, 50 parts of syphilis positive serum samples etc., none positive shows that Rheumatoid factors, polyclonal etc. can not cause the false positive of test kit substantially, and specificity is fine.
(2) sensitivity (specificity) is measured: by the Radioactive colloidal gold catch assay method that previous experiments is determined, detect the susceptibility of this test kit. and use test kit of the present invention to detect 15 parts of positive serums (clinical definite), coincidence rate is 100%.
(3) with the comparison test of similar products at home and abroad: the comparative experiments result such as the table 10 of test kit of the present invention and 260 parts of serum samples of Italian SORIN company's test kit detection.
The compare test result of table 10 and Italian SORIN anti-herpesvirus I type IgM antibody kit
Detect total coincidence rate: (49+206)/260=98.1%, show that tentatively this test kit reaches the standard of import reagent box.
The performance calibrating of embodiment three reorganization human herpes simplex vicus I protein I gM antibody ELISA detection kit
The substrate that the HSV I gG albumen that embodiment one is made prepares as the test kit enzyme-labelled antigen is measured HSV1IgM antibody with the ELISA method.
1 this test kit principle and component are as follows:
1) test kit principle: this strain is wrapped the microwell plate of quilt with anti-people IgM, horseradish peroxidase (HRP) marker gene engineering HSV I gG antigen is tracer, the TMB Color Appearance System is used the anti-herpes simplex virus IgM antibody in prize law principle detection human serum or the blood plasma.
2) the main moiety of test kit:
Pre-bag is by plate, enzyme conjugates, negative control, positive control, concentrated washing lotion (20 *), substrate solution A, substrate solution B, termination liquid.
The calibrating of 2 test kit performances
Specificity (accuracy) is measured: by catching the ELISA measuring method, detect several other serum materials, the observing response specificity.The result shows, uses test kit of the present invention to detect 15 parts of negative serums (clinical definite), and coincidence rate is 100%; Detect 50 parts of Rheumatoid factors, polyclonal positive serum samples, 50 parts of hepatitis C positive serum samples, 50 parts of syphilis positive serum samples etc., none positive shows that Rheumatoid factors, polyclonal etc. can not cause the false positive of test kit substantially, and specificity is fine.
Sensitivity (specificity) is measured: by catching the ELISA measuring method, detect the susceptibility of this test kit.Use test kit of the present invention to detect 15 parts of positive serums (clinical definite), coincidence rate is 100%.
Accuracy is measured: by catching the ELISA measuring method, detect the accuracy of this test kit.Use this test kit that positive control, the negative control of 2 parts of anti-HSV1 strong positive serum, 1 part of positive serum, 1 part of negative serum and test kit are carried out every plate diplopore, the detection of totally 10 plates, result such as table 11, the repeatability of visible test kit is good, and the CV that different serum are detected all is lower than 15%.
The accuracy of table 11 test kit
| Serum | Average OD | Maximum OD | Minimum OD | ??CV(％) |
| Strong positive 1 | ??3.823 | ??4.128 | ??3.091 | ??2.6 |
| Serum | Average OD | Maximum OD | Minimum OD | ??CV(％) |
| Strong positive 2 | ??3.221 | ??3.688 | ??2.565 | ??4.5 |
| Positive 1 | ??2.315 | ??2.694 | ??1.612 | ??7.3 |
| Negative | ??0.022 | ??0.113 | ??0.002 | ??6.6 |
| Positive control | ??2.652 | ??3.220 | ??2.102 | ??6.2 |
| Negative control | ??0.030 | ??0.111 | ??0.010 | ??4.9 |
Comparison test with similar products at home and abroad: the comparative experiments result such as the table 12 of test kit of the present invention and 260 parts of serum samples of Italian SORIN company's test kit detection.
The compare test result of table 12 and Italian SORIN anti-herpesvirus I type IgM antibody kit
Detect total coincidence rate=(49+208)/260=98.8%, show that tentatively this test kit reaches the standard of import reagent box.
SEQUENCE?LISTING
＜110〉Jilin University
＜120〉a kind of recombinant human herpes simplex virus I protein HSV I gG and application thereof
<160>2
<170>PatentIn?version?????3.3
<210>1
<211>615
<212>DNA
＜213〉herpes simplex virus I (Herpes simplex virus, HSV)
<400>1
caaccccaac?tccagaccac?cggtcgtccc?tcgcatgaag?cccccaacat?gacccagacc????60
ggcaccaccg?actctcccac?cgccatcagc?cttaccacgc?ccgaccacac?accccccatg????120
ccaagtattg?gactggagga?ggaggaagag?gaggaggggg?ccggggacgg?cgaacatctt????180
gaggggggag?atgggacccg?tgacacccta?ccccagtccc?cgggcccagc?cttcccgttg????240
gctgaggacg?tcgagaagga?caaacccaac?cgtcccgtag?tcccatcccc?cgatcccaac????300
aactcccccg?cgcgccccga?gaccagtcgc?ccgaagacac?cccccaccat?tatcgggccg????360
ctggcaactc?gccccacgac?ccgactcacc?tcaaagggac?gacccttggt?tccgacgcct????420
caacataccc?cgctgttctc?gttcctcact?gcctcccccg?ccctggacac?cctcttcgtc????480
gtcagcaccg?tcatccacac?cttatcgttt?ttgtgtattg?gtgcgatggc?gacacacctg????540
tgtggcggtt?ggtccagacg?cgggcgacgc?acacacccta?gcgtgcgtta?cgtgtgcctg????600
ccgtccgaac?gcggg?????????????????????????????????????????????????????615
<210>2
<211>205
<212>PRT
＜213〉herpes simplex virus I (Herpes simplex virus, HSV)
<400>2
Gln?Pro?Gln?Leu?Gln?Thr?Thr?Gly?Arg?Pro?Ser?His?Glu?Ala?Pro
1???????????????5???????????????????10??????????????????15
Asn?Met?Thr?Gln?Thr?Gly?Thr?Thr?Asp?Ser?Pro?Thr?Ala?Ile?Ser
20??????????????????25??????????????????30
Leu?Thr?Thr?Pro?Asp?His?Thr?Pro?Prp?Met?Pro?Ser?Ile?Gly?Leu
35??????????????????40??????????????????45
Glu?Glu?Glu?Glu?Glu?Glu?Glu?Gly?Ala?Gly?Asp?Gly?Glu?His?Leu
50??????????????????55??????????????????60
Glu?Gly?Gly?Asp?Gly?Thr?Arg?Asp?Thr?Leu?Pro?Gln?Ser?Pro?Gly
65??????????????????70??????????????????75
Pro?Ala?Phe?Pro?Leu?Ala?Glu?Asp?Val?Glu?Lys?Asp?Lys?Pro?Asp
80??????????????????85??????????????????90
Arg?Pro?Val?Val?Pro?Ser?Pro?Asp?Pro?Asn?Asn?Ser?Pro?Ala?Arg
95??????????????????100?????????????????105
Pro?Glu?Thr?Ser?Arg?Pro?Lys?Thr?Pro?Pro?Thr?Ile?Ile?Gly?Thr
110?????????????????115?????????????????120
Leu?Ala?Thr?Arg?Pro?Thr?Thr?Arg?Leu?Thr?Ser?Lys?Gly?Arg?Pro
125?????????????????130?????????????????135
Leu?Val?Pro?Thr?Pro?Gln?His?Thr?Pro?Leu?Phe?Ser?Phe?Leu?Thr
140?????????????????145?????????????????150
Ala?Ser?Pro?Ala?Leu?Asp?Thr?Leu?Phe?Val?Val?Ser?Thr?Val?Ile
155?????????????????160?????????????????165
His?Thr?Leu?Ser?Phe?Leu?Cys?Ile?Gle?Ala?Met?Ala?Thr?His?Leu
170?????????????????175?????????????????180
Cys?Gly?Gly?Trp?Ser?Arg?Arg?Gly?Arg?Arg?Thr?His?Pro?Ser?Val
185?????????????????190?????????????????195
Arg?Tyr?Val?Cys?Leu?Pro?Ser?Glu?Arg?Gly
200?????????????????205
Claims (6)
1. the gene fragment of a recombinant human herpes simplex virus I protein HSV I gG, it is characterized in that: its nucleotide sequence is shown in SEQ ID NO:1.
2. recombinant human herpes simplex virus I protein HSV I gG, it is characterized in that: its aminoacid sequence is shown in SEQ IDNO:2.
3. a kind of recombinant human herpes simplex virus I protein HSV I gG according to claim 2 is prepared by following method:
A, synthetic primer:
P1：ACCATATGCAACCCCAACTCCAGACCACCG
P2：ACCTCGAGCCCGCGTTCGGACGGCAGG
B, be template with human herpes simplex vicus's culture, pcr amplification obtains gene fragment HSV I gG;
C, gene fragment HSV I gG is inserted among the expression vector pET-28a, obtain plasmid pET-28a-HSV I gG;
In d, the plasmid pET-28a-HSV I gG transfection dust Xi Shi e. coli bl21 (DE3);
F, bacteria breaking, protein purification gets recombinant protein HSV I gG.
4. recombinant human herpes simplex virus I protein I gM antibody assay kit, it is characterized in that: be to be antigen with HSV I gG, marker is the IgM antibody colloidal gold detection kit of Radioactive colloidal gold or the IgM antibody ELISA detection kit that marker is horseradish peroxidase.
5. recombinant human herpes simplex virus I protein I gM antibody colloidal gold detection kit, by following method preparation:
1) gets the HAuCl of 1.0g
4.H
2O is dissolved in the 100ml purified water, is made into 1% chlorauric acid solution; Get 1% chlorauric acid solution 1ml and add in the 100ml boiling water, add 1% trisodium citrate 2ml, continue to boil 30min, synthetic Radioactive colloidal gold;
2) get 6ml synthetic colloidal gold solution, carry out scanning inspection at the 400-700nm place; Get the about 30nm Radioactive colloidal gold of synthetic 406ml, use 0.1M K
2CO
3Transfer PH to 7, measure 5mg/ml HSV I gG 2.65ml and be diluted to 40ml, add colloidal gold solution while stirring with the 20mM Tris-Cl of PH8.2, continue to stir 10min, measure 1%BSA 40ml, add while stirring, continue to stir 10min, 4 ℃ of centrifugal 10min of 3000r/min, go precipitation, supernatant is again after the balance, 4 ℃ of centrifugal 45min of 12000r/min, remove supernatant, repeat 2 times; With quality controlled serum colloidal gold composite is tested, after the assay was approved, HSV IgG colloidal gold composite stoste to dilute between one times, the metal spraying amount is that 25.0 μ l/cm bag is carried the gold pad, behind 37 ℃, relative humidity 30% following air seasoning 16-22 hour, cut then;
3) precut NC film, adhesive back, concentration 2.0mg/ml, line amount be 1.0 μ l/cm bag by anti-human IgM antibody and by bag by concentration be 5.0mg/ml, package amount be 1.0 μ l/cm rabbit anti-herpes simplex virus I type antibody line bag by on the NC film, drying is 1.0 hours under 37 ℃, the condition of relative humidity 30% below;
4) tear the paper film that the band backboard NC film that wraps tested survey line and nature controlling line detects line end, HSV I gG Radioactive colloidal gold binding substances pad is sticked on the Quality Control line end of NC film, intersect about 1mm, compacting, the load sample pad that sanction is good sticks on the lower end of HSV I gG Radioactive colloidal gold binding substances pad, compacting, the Quality Control line end that good absorbent pad sticks on the NC film will be cut out, the check-out console two ends that post are cut remove 1cm, it is wide to be cut into 4mm with slitting shear machine, encapsulation.
6. a kind of human herpes simplex vicus I protein HSV I gG according to claim 2 is in the application of preparation human herpes simplex vicus I vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102178879A CN101705233B (en) | 2009-11-20 | 2009-11-20 | Recombinant human herpes simplex virus I protein HSV I gG and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102178879A CN101705233B (en) | 2009-11-20 | 2009-11-20 | Recombinant human herpes simplex virus I protein HSV I gG and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101705233A true CN101705233A (en) | 2010-05-12 |
| CN101705233B CN101705233B (en) | 2011-09-21 |
Family
ID=42375488
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102178879A Expired - Fee Related CN101705233B (en) | 2009-11-20 | 2009-11-20 | Recombinant human herpes simplex virus I protein HSV I gG and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101705233B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102392030A (en) * | 2011-12-13 | 2012-03-28 | 北京英诺特生物技术有限公司 | Recombinant human herpes simplex virus I protein and its application |
| CN112213483A (en) * | 2020-09-18 | 2021-01-12 | 迪瑞医疗科技股份有限公司 | Chemiluminescence immunoassay kit for detecting herpes simplex virus 1+2 IgM antibody and preparation method thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2071038B1 (en) * | 2003-04-25 | 2014-11-26 | Becton Dickinson and Company | Detection of herpes simplex virus types 1 and 2 by nucleic acid amplifiction |
| CN101376893B (en) * | 2007-08-28 | 2011-07-13 | 李小鹏 | Herpes simplex virus vector, recombinant virus, host cell and pharmaceutical composition thereof |
-
2009
- 2009-11-20 CN CN2009102178879A patent/CN101705233B/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102392030A (en) * | 2011-12-13 | 2012-03-28 | 北京英诺特生物技术有限公司 | Recombinant human herpes simplex virus I protein and its application |
| CN112213483A (en) * | 2020-09-18 | 2021-01-12 | 迪瑞医疗科技股份有限公司 | Chemiluminescence immunoassay kit for detecting herpes simplex virus 1+2 IgM antibody and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101705233B (en) | 2011-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104198703B (en) | People's mycoplasma pneumoniae gold label silver stain immunochromatographytest test kit and its preparation method and application | |
| CN111220803B (en) | Novel coronavirus antibody detection reagent, preparation method thereof and novel coronavirus antibody detection card | |
| WO2022032983A1 (en) | Quantum dot microsphere immunochromatography test strip for detection of african swine fever virus mucous membrane siga antibody, and use thereof | |
| Wan et al. | Development and application of a colloidal-gold dual immunochromatography strip for detecting African swine fever virus antibodies | |
| CN108267582A (en) | Infection of Toxoplasma Gondii colloidal gold immuno-chromatography test paper strip and preparation method thereof | |
| Ye et al. | Gold-based paper for antigen detection of monkeypox virus | |
| CN112305218A (en) | Novel coronavirus antibody colloidal gold immune lateral chromatography detection method and application thereof | |
| CN105319359B (en) | Streptococcus pneumoniae quantum dot immunochromatographic assay detection card and preparing method and application thereof | |
| CN114736290B (en) | Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application | |
| CN109307772A (en) | A kind of Pseudorabies virus gE and gB IgG antibody double fluorescent microballoon immunological detection method | |
| CN109900903B (en) | Porcine pseudorabies virus gE blocking ELISA antibody detection kit and application thereof | |
| CN102533795B (en) | Recombinant human cytomegalovirus protein and applications thereof | |
| CN101100673A (en) | Mycobacterium tuberculosis recombination fusion protein and application thereof | |
| CN101705233B (en) | Recombinant human herpes simplex virus I protein HSV I gG and application thereof | |
| CN106279408B (en) | Monoclonal antibody and antibody combination for resisting foot-and-mouth disease type O virus and application of monoclonal antibody and antibody combination in detection of virus antigen and antibody | |
| CN103834668A (en) | Recombination mycoplasma pneumoniae protein and application thereof | |
| CN101914563A (en) | Mycobacterium tuberculosis 38Kd-16Kd-CFP10 recombinant fusion protein and application thereof | |
| CN101508999B (en) | Recombinant toxoplasma protein and uses thereof | |
| CN103820471A (en) | Recombined chlamydia trachomatis protein and application thereof | |
| CN102492699B (en) | Recombination human herpes simplex virus II protein and application thereof | |
| CN101781360A (en) | Recombinant rubella virus protein and application | |
| CN101509002B (en) | Recombinant rubella virus protein and uses thereof | |
| CN112730829B (en) | Colloidal gold test strip for rapidly detecting oyster herpesvirus OsHV-1 and application thereof | |
| CN111912984B (en) | Test strip for detecting African swine fever virus CD2v and MGF360 mucous membrane antibody and application thereof | |
| CN101838660A (en) | Mycobacterium tuberculosis recombinant fusion protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110921 Termination date: 20151120 |
|
| EXPY | Termination of patent right or utility model |