CN101698673A - Prawn white spot syndrome virus VP37p polypeptide fragment and application thereof - Google Patents

Abstract

The invention utilizes prawn white spot syndrome virus (WSSV) gene expression technology to obtain a segment which is coded by a prawn white spot bacilliform virus WSV254 gene and is named as VP37p. The invention also relates to a method for manufacturing the VP37p, application of polynucleotide and polypeptide of the VP37p, and an antibody specifically bound with the polypeptide of the VP37p. The invention identifies the function of the VP37p through a biological method for the first time; the VP37p is one of WSSV attachment protein fragments; and the inhibition on the gene and expression products thereof may be one of effective ways of preventing and controlling prawn white spot disease and expects to be applied to the prevention and control of the prawn white spot disease.

Description

Shrimp white spot syndrome virus VP37p polypeptide fragment and application

Technical field

The present invention relates to the nucleotide sequence of a kind of shrimp white spot syndrome virus (WSSV) gene.Specifically, the present invention relates to the nucleotide sequence fragment (VP37p) of shrimp white spot syndrome virus VP37, also relate to a kind of polypeptide with adhesive activity by this nucleotide segment sequence encoding.The invention still further relates to the application of these polynucleotide and polypeptide, and the production method of described polynucleotide and polypeptide.

Background technology

White spot syndrome baculovirus (WSSV) is to endanger China in recent years and the Asia-Pacific region propagates one of main diseases toxogen of prawn artificially, the prawn that the high lethality rate of its energy ground infects most kinds, can infect Crustaceanses such as multiple crab class, lobster class, amphipoda, ephydrid class in fresh water and the Marine ecosystems in addition, has host range more widely, therefore its serious harm prawn culturing has not only also caused influence to marine ecology.WSSV is a double-stranded DNA virus, and genome total length 305Kb is the animal virus (J Virol 200175:11811-11820) of the maximum found up to now.Genome sequence heredity and morphological feature show that all WSSV is a kind of new virus, it does not belong to known any virus family at present, therefore ICTV belongs to Nimaviridae kind (www.ncbi.nlm.nih.gov/ICTVdb/Ictv/index.htm) with the WSSV ownership for new Whispovirus.Because this is a brand-new virus, and the WSSV genome is bigger, so most WSSV virus structural proteins and other virus do not have homology, therefore these proteic functions can't be by predicting with the homology analysis of other viral proteins, thereby make the WSSV functional study have great difficulty.A gene is tentatively proved conclusively its function surplus in the of existing 20, and the Unknown Function of many genes is still arranged.Also be difficult to into prevention and control at present, on the one hand, the more important thing is that people to the understanding of this viruses molecule level also seldom in physical environment because WSSV can be survived for a long time to WSSV.Adhesion is the cohesive process of virus attachment protein and cell receptor, and the interaction of cell adhesion promoter virus and host cell is an inevitable approach of setting up infection, damaging cells.Identification before the poisoning intrusion host cell and adhesion are to cause the committed step that infects, and virus has only to combine just with cell receptor and can enter amplification cycles.Recent result of study shows, the initial stage of WSSV host cells infected, must have complete cyst membrane structure, and show that the WSSV host cells infected initial stage must be at first through affine absorption and interactional process.Block this process, may reach and suppress the purpose that WSSV infects.The at present existing WSSV envelope protein of using prevents from the patent of WSSV to comprise the VP28 that utilizes WSSV, VP26, VP24, VP19 etc. as vaccine.The activation analysis of WSV254 encoded polypeptides fragment shows that VP37p is not only a kind of envelope protein of WSSV, and the attachment proteins fragment that infects the shrimp body for WSSV, further point out be the RGD site in action.Innovation of the present invention be in, use the attachment proteins polypeptide fragment and interact from blocking-up WSSV and host and control the infection of WSSV.

Summary of the invention

Coding VP37p sequence among the present invention is so to obtain.With the WSSV genomic dna of purifying as template.As primer, obtained the sequence of the partial sequence SED ID No.1 of WSV254 according to the sequence of synthetic SEQ ID No.3 of the part (133bp-299bp) of WSV254 sequence design and SEQ ID No.4 through pcr amplification.By recombinant expressed VP37p gene, purifying VP37p expression of gene product by ELISA method and fluorescently-labeled method, determines that it is active with combining of prawn cell then, and it infects the effect that suppresses at the anti-WSSV of crustacean the living animal experimental analysis.Before the present invention came forth, still nobody disclosed the VP37p sequence that relates among the application.

The purpose of this invention is to provide a kind of new WSSV polypeptide, it comprises: have the polypeptide of SEQ ID No.2 aminoacid sequence, perhaps its active fragments, or its reactive derivative.Preferable, this polypeptide is to have SEQ ID No.1 polypeptide of sequence.This albumen is named as VP37p.

Another object of the present invention provides a kind of method of utilizing recombinant technology to produce described VP37p.

The present invention also provides the application of VP37p, i.e. protein vaccine, and it contains the VP37p encoding sequence, and pharmaceutically acceptable carrier.Clearer and more definite, this vaccine of the present invention contains the aminoacid sequence described in the SEQ ID No.2 or its derived sequence.

In addition, nucleotide sequence of the present invention can be used to make nucleic acid vaccine, and crustacean is inoculated, and infects with anti-WSSV.Carrier bacterin comprises attenuated bacteria alive or virus vaccines, and pharmaceutically acceptable carrier.

In a specific embodiments of the present invention, isolating polynucleotide total length is 167 Nucleotide among the present invention, and its detailed sequence is seen SEQID No.1, and wherein open reading frame is positioned at 1-167 position Nucleotide.

On the other hand, the present invention also comprise to VP37p DNA or the polypeptide of its fragment coding can the interactional polyclonal antibody of specificity, monoclonal antibody and other can suppress VP37p gene product or fragment.

Technical scheme of the present invention is as follows:

1.WSSV-VP37p the preparation of gene:

(1) the virus genomic preparation of WSSV: the virus that will purify places 0.2mg/ml Proteinase K and 1% sodium lauroyl sareosine, leaves standstill 2h in 65 ℃.With after chloroform and the phenol extracting product that obtains being dissolved in 50 μ l TE.-20 ℃ of preservations are as the pcr amplification template.

(2) pcr amplification VP37p gene: with the viral DNA is template, pcr amplification goal gene VP37p.The PCR reaction conditions is: contain 50 μ L 10xPCR buffer in the 50 μ l reaction systems, 4 μ L 25mmol/L MgC12,1 μ L dNTPs, each 0.5 μ L of upstream and downstream primer, 0.5 μ L Taq archaeal dna polymerase (5U/L), 0.5 μ L template.PCR reaction conditions: 94 ℃ of 10min, 94 ℃ of 30s, 72 ℃ of 1min of 51.0 ℃ of 30s (8 circulations), 94 ℃ of 30s, 56.2 ℃ of 30s, 72 ℃ of 1min (30 circulations), 72 ℃ of 10min.Get 2 μ l PCR products and make 1% agarose gel electrophoresis, the PCR product should have an amplified band at about 170bp place.

2. the structure of recombinant chou:

(1) structure of expression vector: VP37p gene fragment and plasmid pBAD/gIIIA are carried out double digestion with Xho I and Hind III, endonuclease bamhi spends the night through 16 ℃ of connections, be transformed into then among the intestinal bacteria Top10, the screening recombinant chou, extract transfer vector plasmid, carry out double digestion and the evaluation of checking order of this transfer vector plasmid.

(2) expression of purpose product VP37p: choose single colony inoculation in the fresh LB of the enriching liquid nutrient medium that contains Amp, cultivate 8～10h for 37 ℃, be inoculated in the fresh LB liquid nutrient medium by 1% afterwards, 37 ℃ are cultivated the OD value is that to add final concentration at 0.6 o'clock be that the pectinose of 0.4mmol/L is induced centrifugal collection thalline.Go up cleer and peaceful precipitation with collecting respectively behind the cellular lysate, carry out SDS-PAGE and Western-blot.

(3) purifying VP37p: the lysate precipitation that obtains is collected, nickel sepharose dress post, with 2-5 bed volume of damping fluid balance, with resuspended (the 50mM PBS of precipitation that collects, pH7.4,0.5M NaCl) 0.45 μ m membrane filtration, last sample flow velocity 1ml/min, the stage that is chosen in the imidazole buffer of 50mM is selected wash-out, collects.

3. the effect of fluorescence microscope VP37p and prawn hemocyte:

(1) fluorescein-labelled purifying VP37p: be mixed in 1mg VP37p albumen after fluorescein FITC is dissolved among the DMSO.Mixture is at room temperature slightly vibrated behind the 2h, cross the G-50 sephadex column, making does not have the fluorescein of mark and separates with the protein bound fluorescein of VP37p.Organize in contrast with identical method mark BSA.

(2) the prawn hemocyte former be commissioned to train foster: the Procambius clarkii of health is wiped with 75% ethanol, adopts heart extracting blood.After the centrifugation, get hemocyte and be resuspended in the L-15 substratum.The Tissue Culture Plate sealing is placed on 28 ℃ up to the monolayer adherence cell appearance that 70%-80% is arranged.With the hemocyte after separating of substratum and cultivation, with PBS damping fluid washed cell.

(3) microscopy: add the 100 μ l good VP37p (about 5 μ g) of FITC mark in each hole, at room temperature wash 2 times with PBS, use DAPI (4 ', 6 '-diamidino-2-phenylindole simultaneously through behind the 1h, Invitrogen) dye nuclear, fluorescence microscope.FITC-BSA does contrast.

4. living animal experimental analysis VP37p infects the effect that suppresses at the anti-WSSV of crustacean: the VP37p polypeptide fragment of expressing is evenly made pharmaceutical chemistry in the common bait of adding with the ratio of 2-5% (W/W), select the healthy crayfish of body weight 15-20g, be divided into 4 treatment group at random, (a.VP37p group, b. empty carrier group, c. positive controls, d. negative control group), each experimental group all feeds of throwing something and feeding respectively, fed 3 or 9 days continuously, (except that the negative control group) WSSV that throws something and feeds respectively then infects the lethal crayfish that shreds, and mortality ratio respectively organized in record.

In the present invention, term " coding VP37p sequence " is meant that coding has the part (133bp-299bp) of nucleotide sequence of the polypeptide of WSV254 protein-active.

This term also comprises encoding to have variant form with proteic, the SEQ ID NO.1 sequence of VP37p identical function.These forms comprise: several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and 5 ' and/or 3 ' add several and (be generally in 60, preferably be in 30, more preferably in 10, in best 5) Nucleotide.

In the present invention, " purifying " VP37p is meant that it accounts at least 50% of the total material of sample at least, preferably at least 75%, and at least 90% (by dry weight or weight in wet base) more preferably.Purifying can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC.

In the present invention, term " VP37p " refers to have the polypeptide of the active SEQ ID of gene regulating NO.2.This term also comprises having the variant form gene regulating function, SEQ ID NO.2 sequence.These variant forms include, but is not limited to: several (are generally 1-50, preferably 1-30, more preferably 1-20, best 1-10) disappearance, insertion and/or the replacement of Nucleotide, and add one or several at C-terminal and/or N-terminal and (be generally in 30, preferably be in 10, more preferably in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises the active fragments and the reactive derivative of VP37p polypeptide.

In the present invention, term " WSSV infects inhibition " is meant in the animal of susceptible WSSV, and the incidence that WSSV infects and the reduction of severity are as reducing animal dead quantity.If with respect to control population, VP37p reduces infectivity at least 10%, usually at least 20%, better at least 50% or reach WSSV when higher and infect and suppress.

In the present invention, term " crustacean " is often referred to " shrimp ", " crab " and " lobster " crustacean.

The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, modified forms, under high or low rigorous degree condition can with the coded albumen of the DNA of WSV254 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-VP37p polypeptide to obtain.The present invention also provides other polypeptide, as comprises VP37p polypeptide or segmental fusion rotein.

The present invention also provides the analogue of VP37p protein polypeptide, and the difference of these analogues and natural VP37p polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic mutant, and the induce variation body can obtain by various technology, as by radiation or be exposed to the random mutagenesis that mutagenic compound produce, also can pass through site-directed mutagenesis method or other known Protocols in Molecular Biologies.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has that non-natural exists or synthetic amino acid (as-amino acid) analogue.Should be understood that polypeptide of the present invention is not limited to the above-mentioned representative polypeptide of enumerating.

Among the present invention, can select various carrier known in the art for use, as commercially available carrier.

Among the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.

In the application's specification sheets and accompanying drawing, be used to represent base (Nucleotide), the abbreviation of amino acid etc. is commonly used those in those and this area of being recommended by the biochemistry name IUPAC-IUB council, is described as follows:

DNA: thymus nucleic acid; A: VITAMIN B4; T: thymus pyrimidine; G: guanine; C: cytosine(Cyt);

G, Gly: glycosides propylhomoserin; A, Ala: L-Ala; V, Val: Xie Ansuan; L, Leu: leucine; I, Ile: Isoleucine; S, Ser: Serine; T, Thr: Threonine; C, Cys: halfcystine; M, Met: methionine(Met); E, Glu: L-glutamic acid; D, Asp: aspartic acid; K, Lys: Methionin; R, A:g: arginine; H, His: Histidine; F, Phe: phenylalanine; Y, Tyr: tyrosine; W, Trp: tryptophane; P, Pro: proline(Pro); N, Asn: l-asparagine; Q, Gin: glutamine.

Description of drawings:

Fig. 1 pcr amplification WSSV-VP37p

Fig. 1 is described as follows: Lane 1, the 2.PCR VP37p that increases; Lane M:DNA Marker

The double digestion nucleic acid electrophoresis figure of Fig. 2 recombinant plasmid

Fig. 2 is described as follows: Lane M ₁, M ₂, be respectively DNA marker DL15000 and DL2000

1, empty plasmid; 2, recombinant plasmid; 3, the recombinant plasmid double digestion;

The recombinate SDS-PAGE collection of illustrative plates of VP37p and expression and purification of Fig. 3

Fig. 3 is described as follows: 1, and empty carrier; 2. recombinant chou supernatant; 3,4. recombinant chou; 5, Marker; 6. purifying VP37p;

Fig. 4 FITC-VP37p and prawn hemocyte specific combination FITC-VP37. fluorescein border note VP37; The fluorescein-labelled bovine serum albumin of FITC-BSA

The inhibition that Fig. 5 uses the VP37p protein fragments that WSSV is infected

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition such as Sambrook etc., molecular cloning: laboratory manual New York:Cold Spring Harbor Laboratory Press, 2001) experiment condition described in, or the condition of advising according to manufacturer.

The clone and the order-checking of embodiment 1 WSV254 gene fragment

With the WSSV genomic dna is template, with primer P1, the P2 WSV254 Gene Partial fragment (133bp-299bp) that increases.

P1：5’-AGA CTCGAGATGAGACGTCAAGTTG-3’；

P2：5’-GAG AAGCTTGTCAATGAGGGAGTTA-3’；

Line portion C TCGAG is the Xhol restriction enzyme site, and AAGCTT is the Hind restriction enzyme site, and the PCR reaction conditions is:

94 ℃ 10 minutes

94 ℃ 30 seconds

44.2 ℃ 30 seconds

72 ℃ 1 minute (8 circulations)

94 ℃ 30 seconds

51.7 ℃ 30 seconds

72 ℃ 1 minute (30 circulations)

72 ℃ 10 minutes

Behind the agarose gel electrophoresis purifying amplified fragments, be cloned into prokaryotic expression plasmid vector pBADg A, obtain recombinant expression plasmid pBADg A-rVP37p, check order, order-checking gained WSV254 portion gene sequence sees SEQIDNo.1. for details

The aminoacid sequence of the WSV254 that derives according to the nucleotide sequence that obtains, totally 55 amino-acid residues, its aminoacid sequence sees SEQIDNo.2. for details

Fig. 1 pcr amplification WSSV-VP37p Fig. 1 is described as follows: Lane 1, the 2.PCR VP37p that increases; Lane M DNA Marker

The segmental expression and purification of embodiment 2 reorganization VP37p

The recombinant expression plasmid pBADg A-rVP37p transformed into escherichia coli TOP 10 that will contain the WSV254 gene, choose positive colony in the LB substratum that contains 100mg/L ammonia benzyl mycin 37 ℃ shake and train to OD ₆₀₀=0.6 o'clock, add L-arabinose and after 0.2%, 37 ℃ of final concentration is induced 5h, collect thalline.Add ice-cold lysis buffer (1 * PBS, 10mM NaHPO ₄, 140mM NaCl, 2.7mM KCL, 1.8mM KH ₂HPO ₄), ultrasonic degradation bacterium (300W * 10s * 10 time), 4 ℃ 15, the centrifugal 20min of 000rpm, dress tweezer post (Ni-nitriloaceticacid resins) is with lavation buffer solution (1 * PBS) the flush away foreign protein of 5-10 column volume; Elution buffer (50mM Tris-HCL, 100mM, the rice azoles, pH 8.0) the wash-out target protein.Proteic molecular weight with the SDS-PAGE purification Identification is about 12.09kD, and purity reaches more than 90%.The results are shown in Figure 1.

The double digestion nucleic acid electrophoresis figure of Fig. 2 recombinant plasmid, Fig. 1 is described as follows: Lane M ₁, M ₂, be respectively DNA marker DL15000 and DL20001, empty plasmid; 2, recombinant plasmid; 3, the recombinant plasmid double digestion;

The recombinate SDS-PAGE collection of illustrative plates of VP37p expression and purification of Fig. 3, Fig. 1 is described as follows: 1, the unloaded plasmid bacterial strain of pectinose inductive; 2, the soluble proteins of inducing cell; 3 and 4, the insolubility albumen of inducing cell; 5, Marker; 6, through the resulting target protein of Ni-nitriloacetic acid resins column purification;

Embodiment 3 reorganization VP37p fragments combine activity with the shrimp cell

Select adherent good cell to place 4 ℃ of precooling 1h, outwell substratum, with the careful washing of cold PBS damping fluid 2 times, add fluorescein-labeled VP37p, under 4 ℃ of conditions in conjunction with 2h, then with the careful washing of PBS damping fluid 2 times, behind the DAPI transfect cell nuclear, direct (0lympus) observations under fluorescent microscope.Simultaneously do blank with the bovine serum albumin (BSA) of unlabelled VP37p and FITC mark.

After the VP37p of FITC mark and the attached cell effect, visible green fluorescence under fluorescent microscope, the same visual field can be observed the nucleus of the painted blueness of DAPI, lucky and the blue-fluorescence stack of stack back, two visuals field visible green fluorescence, and the blue-fluorescence of nucleus dyeing is only observed in contrast, do not observe green fluorescence, show the FITC mark VP37p can with prawn hemocyte specific combination.

Fig. 4 FITC-VP37p and prawn hemocyte specific combination

The segmental Antibody Preparation of embodiment 4 reorganization VP37p

The recombinant protein of the purifying that obtains among the embodiment 2 with isopyknic complete Freund ' s adjuvant emulsion, is carried out subcutaneous injection to mouse, every 0.2mL with the albumen of 0.25-0.5mg/mL emulsification.The same antigen of same dosage of full Freund ' s adjuvant emulsion of toing many or too much for use after 2 weeks is injected with booster immunization again and is produced antibody, afterwards every 10 days booster immunizations once, carries out at least 2 times.Analyze sero-fast titre and the specificity of obtaining.

After having read foregoing of the present invention, those skilled in the art can do various changes and modification to the present invention, and these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Embodiment 5: the inhibition of using the VP37p protein fragments that WSSV is infected

(1) pharmaceutical chemistry is made: the VP37p polypeptide fragment of expressing is evenly made pharmaceutical chemistry in the common bait of adding with the ratio of 2-5% (W/W), seal up for safekeeping after drying, and standby.

(2) laboratory animal grouping: a VP37p group, b. empty carrier group adds 2-5% empty carrier fermented liquid in the bait; C. positive controls, the common bait of throwing something and feeding; D. negative control group, the common bait of throwing something and feeding.Select the healthy crayfish of body weight 15-20g, be divided into 4 treatment group at random, 3 repetitions of each experimental group, every group 10 tail supported 7 days before the experiment temporarily.

(3) experimentation on animals: each experimental group all feeds of throwing something and feeding respectively, fed 3 or 9 days continuously, (except that the negative control group) WSSV that throws something and feeds respectively then infects the lethal crayfish that shreds, and writes down and respectively organizes mortality ratio.

The inhibition that Fig. 5 uses the VP37p protein fragments that WSSV is infected.

Fig. 5 is described as follows: VP37p organizes (*), empty carrier group (▲), positive controls (■), negative control group (◆).

Sequence table

1.SEQ the information of ID No.1

(1) sequence signature

A. length: 167bp

B. type: nucleic acid

C. chain: two strands

D. topological framework: linearity

(2) molecule type: DNA

(3) sequence description: SEQ ID No.1

1 atgagacgtc?aagttgaagc?tgcattatat?gaagcaatat?ccaaaaagaa?agaaaaggcc

61 ataaaggcat?tcgatgagct?catacaagaa?agaggtgatg?aaattacacc?tttgactaca

121?atgcagtatg?aagagtgggt?aaaccgtaca?ataactccct?cattgac

2.SEQ the information of ID No.2

(1) sequence signature

A. length: 55 amino acid

B. type: amino acid

C. topological framework: linearity

(2) molecule type: protein

(3) sequence description: SEQ ID No.2

1 MRRQVEAALY?EAISKKKEKA?IKAFDELIQE?RGDEITPLTT

41?MQYEEWVNRT?ITPSL

3.SEQ the information of IDNo.3

(1) sequence signature

E. length: 25bp

F. type: nucleic acid

G. chain: strand

H. topological framework: linearity

(2) molecule type: oligonucleotide

(3) sequence description: SEQ ID No.3

AGACTCGAGATGAGACGTCAAGTTG

4.SEQ the information of ID No.4

(1) sequence signature

I. length: 25bp

J. type: nucleic acid

K. chain: strand

L. topological framework: linearity

(2) molecule type: oligonucleotide

(3) sequence description: SEQ ID No.4

GAGAAGCTTGTCAATGAGGGAGTTA

Claims (12)

1. WSSV attachment proteins is characterized in that: expressing protein has with the prawn cell and combines activity.

2. isolated dna molecular, it is characterized in that, it comprises: the nucleotide sequence part of coding VP37 active polypeptide, the nucleotides sequence of 1-167 position is shown at least 70% similarity among perhaps described nucleotide sequence and the SEQ ID NO.1, perhaps described nucleotide sequence can be under medium rigorous condition with SEQ ID NO.1 in the nucleotide sequence hybridization of 1-167 position.

3. the dna molecular described in claim 2 is characterized in that, polypeptide of described sequence encoding, and this polypeptide has the sequence shown in the SEQ ID NO.2.

4. the dna molecular described in claim 2 is characterized in that, this sequence has among the SEQID NO.1 nucleotide sequence from Nucleotide 1-167 position.

5. an isolating VP37p polypeptide is characterized in that, it comprises having the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2, or its active fragments, or its reactive derivative.

6. polypeptide as claimed in claim 5 is characterized in that, this polypeptide is to have SEQ ID NO.2 polypeptide of sequence.

7. a generation has the method for the polypeptide of VP37p protein-active, it is characterized in that this method comprises:

1) will the encode nucleotide sequence of VP37p polypeptide fragment is operably connected to expression regulation sequence, forms VP37p gene fragment expression carrier, and the nucleotides sequence of 1-167 position is shown at least 70% similarity among described nucleotide sequence and the SEQ ID NO.1;

2) change the expression vector in the step 1) over to host cell, form the reconstitution cell of expressing the VP37p active polypeptide;

3) reconstitution cell under condition that be fit to express the VP37p active polypeptide, culturing step 2);

4) isolate the VP37p active polypeptide.

8. method as claimed in claim 7 is characterized in that, the nucleotides sequence of the coded polypeptide of this reorganization is classified as among the SEQID NO.1 from Nucleotide 1-167 position.

9. the expressing protein according to claim 5 and 7 is used for vaccine, it is characterized in that described protein vaccine comprises albumen or its immunogenic fragments according to claim 5 and 7, and pharmaceutical acceptable carrier.

10. energy and the described VP37p polypeptid specificity of claim 7 bonded antibody.

11. comprise the vaccine of pharmaceutically acceptable carrier and at least a antibody according to claim 10.

12. vaccine and pharmaceutically acceptable carrier according to the nucleotide sequence of claim 2 and 4.

Images