CN101693899B - Cellulose orthogenesis method of ampullaria crossean - Google Patents
Cellulose orthogenesis method of ampullaria crossean Download PDFInfo
- Publication number
- CN101693899B CN101693899B CN 200910191123 CN200910191123A CN101693899B CN 101693899 B CN101693899 B CN 101693899B CN 200910191123 CN200910191123 CN 200910191123 CN 200910191123 A CN200910191123 A CN 200910191123A CN 101693899 B CN101693899 B CN 101693899B
- Authority
- CN
- China
- Prior art keywords
- cellulase
- spiral shell
- pcr
- directed mutagenesis
- crossean
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to a cellulase orthogenesis method of ampullaria crossean. The steps are as follows: step one, acquiring cellulase genes of ampullaria crossean: firstly extracting the total mRNA of ampullaria crossean; secondly conducting reverse transcription to amplify cDNA; then amplifying the cellulase genes of ampullaria crossean through PCR; and obtaining the cellulase gene fragments of ampullaria crossean; step two, cloning and sequencing: cloning PCR products and connecting the PCR products with pMD18-T carrier containing T-end; preparation and conversion of competent cell, and adopting a CaCL 2 method to prepare the competent cell; screening of positive clones, namely using X-ga1 and IPTG to primarily screen clones; extracting plasmid by an alkaline process; and sequencing; and step three: site-mutagenesis: using professional software and websites of molecular biology to conduct analytical prediction of functions and determine amino acid needing transforming; adopting a kit to conduct site-mutagenesis in the direction transformation of cellulase protein; and finally sequencing and determining. The method improves the activity of cellulase of ampullaria crossean, as well as the degradation action of cellulase of ampullaria crossean on cellulose.
Description
Technical field
The present invention relates to biotechnology, be specifically related to the cellulase directed evolution method of Fushou spiral shell.
Background technology
Cellulase (Cellulase) is the general name of the glucogenic one group of enzyme of degraded cellulose, is that a class has the biological activity protein that catalyse cellulose resolves into glucose.The research of cellulase is that Seilliere in 1906 has found the cellulolytic cellulase of energy the earliest in the Digestive system of snail, it can be renewable resource with the useless resource conversion of abundant Mierocrystalline cellulose, solve the deficiency of the energy, feed and food supply, and can use on alcohol, white wine, soy sauce, feed and textile industry.
Mainly stressed in the past microorganisms to cellulosic degraded, conversion.In recent years, the applied research of cellulase is very active, has screened a collection of superior strain.But the cellulase activity that is separated to now is not very high.Fast development along with molecular biology, genetic engineering, people transform and build the highly effective cellulose degradation bacteria in trial using gene engineering DNA extracorporeal recombination, the gene cloning of cellulase research of carrying out as main purpose to obtain the excessive production of cellulase.Very active in 20th century 70, the eighties, the existing approximately gene of 80 components is cloned, but expresses, secretes all very weak.As seen cellulase activity now used is all very low, and is in order to degraded cellulose, necessary with a large amount of enzymes.Mierocrystalline cellulose is renewable resources the abundantest on the earth, is the good renewable energy resources, but has shortcomings such as being difficult for degraded and hard degradation.At present, seek high vigor, can mass-produced cellulase oneself become the focus of research.
Summary of the invention
The cellulase directed evolution method that the purpose of this invention is to provide Fushou spiral shell by molecular modification and the orthogenesis to the cellulase of Fushou spiral shell, improves enzyme activity, makes it be conducive to cellulase hydrolysis.
The cellulase directed evolution method of Fushou spiral shell of the present invention, its step is as follows:
The first step, obtain the cellulose enzyme gene of Fushou spiral shell:
(1) first extract total mRNA-messenger RNA(mRNA) of Fushou spiral shell:
(2) carry out again post transcription cloning cDNA-complementary DNA (cDNA);
(3) then, by the PCR-polymerase chain reaction, amplify the cellulose enzyme gene of Fushou spiral shell;
(4) last, reclaim the PCR product, obtain the cellulose enzyme gene segment of Fushou spiral shell;
Second step, Cloning and sequencing:
(1) clone PCR products is connected the PCR product with the pMD18-T carrier that contains the T end;
(2) CaCL is adopted in the preparation of competent cell and conversion
2The standby competent cell of legal system;
(3) screening of positive colony is carried out preliminary screening with X-gal (5-bromo-4-chloro-3-indoles-β-D-galactoside) and IPTG (isopropyl-β-D-thiogalactoside(IPTG)) to the clone;
(4) extract plasmid, extract plasmid with alkaline process;
(5) order-checking, after the recombinant plasmid sequencing, with the www.ncbi.nlm.nih.gov comparison by Internet, test the exactness of its sequence of positive analysis;
The 3rd step, rite-directed mutagenesis:
(1) carry out the functional analysis prediction with molecular biology professional software and professional website, need to determine the amino acid of transformation;
(2) directional transformation of cellulase protein adopts test kit to carry out rite-directed mutagenesis, then it is definite to check order.
The present invention has improved the Fushou spiral shell cellulase activity, has improved the Fushou spiral shell cellulase to cellulosic Degradation; With DNS enzyme activity determination method, and the enzyme activity that calculates the enzyme activity E.coliDBCe lAg-tb fermented liquid of enzyme liquid has improved 25-35% than E.coliDBCelAg.
Description of drawings
Fig. 1 is from E.coliDBCelAg cellulase protein space conformation.
Fig. 2 is the cellulase protein space conformation from E.coliDBCelAg-tb.
Embodiment
The present invention is described further as an example of " Fushou spiral shell " example for the below.
The first step, obtain the cellulose enzyme gene of Fushou spiral shell:
(1) extract total mRNA---the messenger RNA(mRNA) of Fushou spiral shell;
Approximately 600mg of fresh stomach-tissue sample is taken out in the extraction of mRNA in Fushou spiral shell, quick-frozen in liquid nitrogen is used the Promega PolyATtract of company after fully grinding
System1000withMagneticStand extracts mRNA;
(2) carry out post transcription cloning cDNA---complementary DNA (cDNA), get 1.5 μ LmRNA, 2 μ LOligodT (high poly-deoxythymidine acid) and 7.6 μ LH
2O mixes, be heated to 65 ℃, 10 minutes, ice bath is 2 minutes again, add 4 μ L5M-MLV-buffer (avian myeloblastosis virus reverse transcription damping fluid), 2.5 μ LdNTP (deoxynucleoside triphosphate) and AMV (avian myeloblastosis virus) ThermoScript II (Promega) 2mL, 41 ℃, 60 minutes, the activity of 65 ℃ of enzymes that go out again ,-20 ℃ of preservations are stand-by;
(3) amplify the Fushou spiral shell cellulose enzyme gene by PCR (polymerase chain reaction) again;
Reaction system: 18 μ LNuclease-FreeWater, 2.5 μ L10XPCRReactionbuffer, 1 μ L upstream primer (10mM), 1 μ L downstream primer (10mM), 0.5 μ LdNTP (10mM), 1.5 μ LMgCl
2(25mM), 0.25 μ LTaqDNAPolymerase (fidelity enzyme 5U/ μ L), 1 μ LcDNA (diluting 50 times); The primer two ends add respectively BamHI and EcoRI restriction enzyme site, and primer is:
F，5’GCTAGGATCCCCCAACAAAGATGTCAGG 3’；
R，5’TATAGAATTCCTTTATTGCCCTCTGAGTGTCG 3’；
Response procedures: 95 ℃, 5min, 1 circulation; 94 ℃, 1min, 58 ℃, 50S, 72 ℃, 1min, 35 circulations; 72 ℃, 10min, 1 circulation; 4 ℃ of preservations;
(4) recovery of PCR product; The PCR product is electrophoresis on 2% sepharose of 1 times of TAE (Tutofusin tris acetic ethylenediamine tetraacethyl solution) preparation; When the object tape separation is better, with the blob of viscose cutting-out of blade with the object tape place, cut unnecessary glue, be placed in clean 1.5mLeppendorf pipe, reclaim object tape with AgaroseGelDNAExtractionKit, this cellulose enzyme gene segment sequence is:
atgccctctg gtgctgctgg tgctggggtg accagcgaga tcgaccgact gagaagaagc 60
gacataacgg ttcacgtgaa tgttggtggt aacatcaacc acggtcaagt gagcattcga 120
gtgttacaaa agagaaaggc attcccgttc gggacatgtg tggccgcctg ggcctacaac 180
gatgggtcca aaggagcata ccgggatttc atccaccagc actacaactg ggccgtgcca 240
gaaaactcac tcaagtgggc tagcatcgaa cctaacaggg gacaaaagaa ctatcagcct 300
ggcctaaaca tgcttcacgg actgagaaat cacgggatta aggtgagagg tcacaacctg 360
gtgtggtctg tcgacaatac ggtgcagaac tgggtcaagg ctctgcatgg ggatgagctg 420
cgaaaggttg tccatgacca catcgtggaa accatcaaca catttaaggg attagtggag 480
cactgggatg tgaacaacga gaacctgcat ggccagtggt accagcatca actgaatgac 540
aatggctaca acctggaact gttccgtatc gcacacgccg ccgaccccaa cgtcaaactc 600
ttcctcaacg actacaacgt tgtgtccaac agttattcaa caaacgacta tcttcgacaa 660
ggtcaacagt ttaaggccgc taatgtgggt ctttacggtt tgggtgccca gtgccacttt 720
ggcgacgaaa gcgacccaga acccggtact aagcaacgtc tggatacttt agctcaagtg 780
ggcgtgccca tctgggccac tgagttggat gtggtagctt cggatgagaa cagacgagcg 840
gacttctacg agcacgcgct gacagtcctg tacggccatc atgccgtgga gggcatcctc 900
atgtggggct tctgggacaa ggcccactgg cgtggcgcca gagctgctct tgttgtcgga 960
gacaacctgc agctgacggc ggccggacgt cgcgtgctgg agctctttga gcacaggtgg 1020
atgacagacg agacgcacaa cctggcagcg ggcactcagt tcacagtacg cggtttccat 1080
ggcgactacg aggtgcaagt catcgtccag ggtcaagagc acactaacct gaggcagacg 1140
ttctcgttgg gcaacggtcc ccacaccgtc aacattaatg ttagc 1185
Second step, Cloning and sequencing:
(1) ligation, in the process of pcr amplification, the TaqDNA polysaccharase has the characteristic that adds the Nucleotide A that a non-template is originated at double-stranded DNA 3 ends, makes amplified production have the A protruding terminus;
The PCR product is connected with the pMD18-T carrier that contains the T end, just can completes the clone of PCR product;
10 μ L ligation systems are as follows: pMD18-T carrier (precious biotechnology (Dalian) company limited produce provide), 2.5ng; External source fragment DNA segment H, 10ng; LigationSolution (connecting fluid), 5 μ L, 16 ℃ were reacted 16 hours; This is for connecting product;
(2) preparation of competent cell and conversion, the preparation of competent cell is adopted CaCL with conversion
2The standby competent cell of legal system:
The picking intestinal bacteria fall within 10mLLB (Luria-Bertani substratum) liquid nutrient medium, and in constant-temperature shaking incubator, 37 ℃, 250r/min cultivated 12-16 hour;
Get in the LB (Luria-Bertani substratum) that this nutrient solution of 1mL is inoculated in 100mL, 37 ℃, 250r/min is cultured to OD
600=0.375, approximately 2 hours; Be placed in 5-10min on ice, carry out 1800r/min, 8min centrifugal on refrigerated centrifuge, collecting cell;
Add the ice-cold CaCl of 10mL
2The solution re-suspended cell, 1800r/min, 8min are centrifugal; Add the ice-cold CaCl of 10mL
2The solution re-suspended cell is placed precipitation on ice, removes liquid, and constant volume 2mL is placed in and obtained competent cell on ice in 12-16 hour;
Get the competent cell of 100 μ L preparations in the 1.5mL centrifuge tube, add 5 μ L to connect product (second step, Cloning and sequencing: connect product in (1)), place 30min on ice; 42 ℃, the 90s heat-shocked is put in 2min on ice immediately, adds the 0.5mlLB nutrient solution in 37 ℃, and 150r/min cultivated 1 hour; Get 50-200 μ L bacterium liquid coating LB (contain X-gal, IPTG, penbritin, 50ug/ml) flat board was cultivated 16 hours for 37 ℃;
(3) screening of positive colony: the clone is carried out preliminary screening with X-gal (5-bromo-4-chloro-3-indoles-β-D-galactoside) and IPTG; The negative bacterium colony of blue colonies, though the most of positive bacterium colonies of white colony also need further be verified with the PCR method: the single white colony of picking, be resuspended in 10 μ LTE, take this bacterium liquid as template, the PCR method is confirmed the size of Insert Fragment in the pMD18-T carrier;
The PCR system is as follows: resuspended bacterium liquid TE (Tutofusin tris edta solution) 1 μ L, H
2O18 μ L, 10XPCR damping fluid (ReactionBuffer) 2.5 μ L, dNTP (10mM) 0.5 μ L; Upstream primer (10mM concentration) 1 μ L, (downstream primer (10mM concentration) 1 μ L, MgCL
2(25mM) 1.5 μ L, TaqDNA polysaccharase (Ploymerase) (5U/ μ L) 0.25 μ L; Response procedures such as preceding step); Agarose electrophoresis shows the PCR result, and PCR product and the product D NA fragment positive clone identical with the exogenous dna fragment size that is used for clone's connection arranged;
(4) plasmid extraction: from amplification to the positive colony of purpose fragment, (50ug/mL), 37 ℃, cultivated 16 hours by penbritin in 5mLLB for single colony inoculation of picking; 12000g, 10min is centrifugal, collecting cell; Extract plasmid with alkaline process, plasmid is cut digestion through EcoRI, BamHI enzyme; 10 μ L systems: plasmid 4 μ L, H
2O4 μ L, BamHI damping fluid 1 μ L, enzyme 0.5 μ L; Whether checking has the external source fragment to insert again;
(5) order-checking: the recombinant plasmid sequence is measured by Shanghai biotechnology Services Co., Ltd, then at the www.ncbi.nlm.nih.gov comparison by Internet, by comparison, tests the exactness of its sequence of positive analysis, the plasmid called after pMD18-Thase that obtains;
The 3rd step, rite-directed mutagenesis:
(1) with molecular biology professional software (DNAman, DNAs tar) and professional website (http://swissmodel.expasy.org/workspace, www.sbc.su.se/-miklos/DAS/ carries out on-line analysis by transmembrane protein structure prediction net http://, adopt " DAS "-TransmembranePredictionserver) to carry out the functional analysis prediction, need to determine the amino acid of transformation to be: 332 α-amino-isovaleric acids sport L-Ala; Can fortifying fibre element enzyme and the interaction of Mierocrystalline cellulose on space structure;
(2) directional transformation of cellulase protein adopts test kit to carry out rite-directed mutagenesis, then it is definite to check order; The below sports 332 α-amino-isovaleric acids the method for L-Ala explanation rite-directed mutagenesis:
1) design primer:
Requirement and test kit operation steps according to gene order and rite-directed mutagenesis, the codon GTG of the 332nd Va l α-amino-isovaleric acid of this cellulase protein sports the codon GCG of Ala Beta Alanine, design a pair of primer (forward and reverse) P1 and the P2 that comprises the mutational site, concrete sequence is as follows:
P1：5′GCAGCTGACGGCGGCCGGACGTCGCGCGCTGGAGCTCTTTGAGCACAGG 3′；
P2：5′CGTGTGCTCAAAGAGCTCCAGCGCGCGACGTCCGGCCGCCGTCAGCTGC 3′。
The base at shade position is the sudden change position.All primers are synthetic by Shanghai Bo Ya Bioisystech Co., Ltd.
2) PCR rite-directed mutagenesis:
All are all undertaken by the QuikChangeSite-directedMutagenesiskit operation instruction of Stratagene company.
Template plasmid is pMD18-Thase, plasmid after rite-directed mutagenesis is pMD18-Thase-tb, and directly the e. coli jm109 of transformed competence colibacillus, choose at random 3 bacterium colonies and extract corresponding plasmid after the coating cultivation, educate the order-checking of limit company by the rich inferior biotechnology in Shanghai, stand-by after order-checking is correct.
Fushou spiral shell cellulose enzyme gene mutant nucleotide sequence is:
atgccctctg gtgctgctgg tgctggggtg accagcgaga tcgaccgact gagaagaagc 60
gacataacgg ttcacgtgaa tgttggtggt aacatcaacc acggtcaagt gagcattcga 120
gtgttacaaa agagaaaggc attcccgttc gggacatgtg tggccgcctg ggcctacaac 180
gatgggtcca aaggagcata ccgggatttc atccaccagc actacaactg ggccgtgcca 240
gaaaactcac tcaagtgggc tagcatcgaa cctaacaggg gacaaaagaa ctatcagcct 300
ggcctaaaca tgcttcacgg actgagaaat cacgggatta aggtgagagg tcacaacctg 360
gtgtggtctg tcgacaatac ggtgcagaac tgggtcaagg ctctgcatgg ggatgagctg 420
cgaaaggttg tccatgacca catcgtggaa accatcaaca catttaaggg attagtggag 480
cactgggatg tgaacaacga gaacctgcat ggccagtggt accagcatca actgaatgac 540
aatggctaca acctggaact gttccgtatc gcacacgccg ccgaccccaa cgtcaaactc 600
ttcctcaacg actacaacgt tgtgtccaac agttattcaa caaacgacta tcttcgacaa 660
ggtcaacagt ttaaggccgc taatgtgggt ctttacggtt tgggtgccca gtgccacttt 720
ggcgacgaaa gcgacccaga acccggtact aagcaacgtc tggatacttt agctcaagtg 780
ggcgtgccca tctgggccac tgagttggat gtggtagctt cggatgagaa cagacgagcg 840
gacttctacg agcacgcgct gacagtcctg tacggccatc atgccgtgga gggcatcctc 900
atgtggggct tctgggacaa ggcccactgg cgtggcgcca gagctgctct tgttgtcgga 960
gacaacctgc agctgacggc ggccggacgt cgcgcgctgg agctctttga gcacaggtgg 1020
atgacagacg agacgcacaa cctggcagcg ggcactcagt tcacagtacg cggtttccat 1080
ggcgactacg aggtgcaagt catcgtccag ggtcaagagc acactaacct gaggcagacg 1140
ttctcgttgg gcaacggtcc ccacaccgtc aacattaatg ttagc 1185
3) expression vector establishment:
PMD18-Thase, pMD18-Thase-tb cuts with BamHI and EcoRI enzyme with plasmid pET-30a (+) respectively, connect again and transform, containing screening positive clone on the LB flat board of kantlex, the plasmid life is pET-CelAg and pET-CelAg-tb, be converted into E.coliBL21 (DE3), ordering this bacterium is E.coliDBCelAg and E.coliDBCelAg-tb again, and enzyme is cut and checked order and test just its sequence.
4) expression analysis of recombinant bacterium E.coliDBCelAg and E.coliDBCelAg-tb:
The LB substratum is adopted in yeast culture and cultivation.Seed culture, picking one ring thalline, be inoculated in the 100mL shaking flask that the 20mLLB substratum is housed from the flat board, is cultured to logarithmic phase at 150r/min rotating speed and 37 ℃ of temperature.Liquid seeds is changed in the 500mL shaking flask that the 100mL nutrient solution is housed by 3% inoculum size, carry out fermentation culture at 150r/min rotating speed and 37 ℃ of temperature.
Add IPTG when being cultured to exponential phase, final concentration is 1mmol/L, then is cultured to the later stage of stationary phase.In the fermentation culture process, enzyme is lived in changing measure.
5) extraction of crude enzyme liquid:
Fermented liquid 8000r/min is abandoned supernatant liquor after 4 ℃ of centrifugal 10min, the washing thalline also goes in the phosphoric acid buffer (pH8.0) of 50mmol/L, ultrasonication 10min in ice-water bath, then at 4 ℃ of centrifugal 15min of lower 10000r/min, the gained supernatant liquor is crude enzyme liquid.
With DNS enzyme activity determination method, and calculate the enzyme activity of enzyme liquid.The enzyme activity of E.coliDBCelAg-tb fermented liquid has improved 25-35% than E.coliDBCelAg.
Sequence table
＜110〉Chongqing University of Technology
＜120〉the cellulase directed evolution method of Fushou spiral shell
<130>
<140>
<141>
<160>2
<170>
<210>1
<211>1185
<212>DNA
＜213〉Fushou spiral shell (Ampullaria crossean)
<221>CDS
<400>1
atgccctctg gtgctgctgg tgctggggtg accagcgaga tcgaccgact gagaagaagc 60
gacataacgg ttcacgtgaa tgttggtggt aacatcaacc acggtcaagt gagcattcga 120
gtgttacaaa agagaaaggc attcccgttc gggacatgtg tggccgcctg ggcctacaac 180
gatgggtcca aaggagcata ccgggatttc atccaccagc actacaactg ggccgtgcca 240
gaaaactcac tcaagtgggc tagcatcgaa cctaacaggg gacaaaagaa ctatcagcct 300
ggcctaaaca tgcttcacgg actgagaaat cacgggatta aggtgagagg tcacaacctg 360
gtgtggtctg tcgacaatac ggtgcagaac tgggtcaagg ctctgcatgg ggatgagctg 420
cgaaaggttg tccatgacca catcgtggaa accatcaaca catttaaggg attagtggag 480
cactgggatg tgaacaacga gaacctgcat ggccagtggt accagcatca actgaatgac 540
aatggctaca acctggaact gttccgtatc gcacacgccg ccgaccccaa cgtcaaactc 600
ttcctcaacg actacaacgt tgtgtccaac agttattcaa caaacgacta tcttcgacaa 660
ggtcaacagt ttaaggccgc taatgtgggt ctttacggtt tgggtgccca gtgccacttt 720
ggcgacgaaa gcgacccaga acccggtact aagcaacgtc tggatacttt agctcaagtg 780
ggcgtgccca tctgggccac tgagttggat gtggtagctt cggatgagaa cagacgagcg 840
gacttctacg agcacgcgct gacagtcctg tacggccatc atgccgtgga gggcatcctc 900
atgtggggct tctgggacaa ggcccactgg cgtggcgcca gagctgctct tgttgtcgga 960
gacaacctgc agctgacggc ggccggacgt cgcgtgctgg agctctttga gcacaggtgg 1020
atgacagacg agacgcacaa cctggcagcg ggcactcagt tcacagtacg cggtttccat 1080
ggcgactacg aggtgcaagt catcgtccag ggtcaagagc acactaacct gaggcagacg 1140
ttctcgttgg gcaacggtcc ccacaccgtc aacattaatg ttagc 1185
<210>2
<211>1185
<212>DNA
＜213〉Fushou spiral shell (Ampullaria crossean)
<221>CDS
<400>2
atgccctctg gtgctgctgg tgctggggtg accagcgaga tcgaccgact gagaagaagc 60
gacataacgg ttcacgtgaa tgttggtggt aacatcaacc acggtcaagt gagcattcga 120
gtgttacaaa agagaaaggc attcccgttc gggacatgtg tggccgcctg ggcctacaac 180
gatgggtcca aaggagcata ccgggatttc atccaccagc actacaactg ggccgtgcca 240
gaaaactcac tcaagtgggc tagcatcgaa cctaacaggg gacaaaagaa ctatcagcct 300
ggcctaaaca tgcttcacgg actgagaaat cacgggatta aggtgagagg tcacaacctg 360
gtgtggtctg tcgacaatac ggtgcagaac tgggtcaagg ctctgcatgg ggatgagctg 420
cgaaaggttg tccatgacca catcgtggaa accatcaaca catttaaggg attagtggag 480
cactgggatg tgaacaacga gaacctgcat ggccagtggt accagcatca actgaatgac 540
aatggctaca acctggaact gttccgtatc gcacacgccg ccgaccccaa cgtcaaactc 600
ttcctcaacg actacaacgt tgtgtccaac agttattcaa caaacgacta tcttcgacaa 660
ggtcaacagt ttaaggccgc taatgtgggt ctttacggtt tgggtgccca gtgccacttt 720
ggcgacgaaa gcgacccaga acccggtact aagcaacgtc tggatacttt agctcaagtg 780
ggcgtgccca tctgggccac tgagttggat gtggtagctt cggatgagaa cagacgagcg 840
gacttctacg agcacgcgct gacagtcctg tacggccatc atgccgtgga gggcatcctc 900
atgtggggct tctgggacaa ggcccactgg cgtggcgcca gagctgctct tgttgtcgga 960
gacaacctgc agctgacggc ggccggacgt cgcgcgctgg agctctttga gcacaggtgg 1020
atgacagacg agacgcacaa cctggcagcg ggcactcagt tcacagtacg cggtttccat 1080
ggcgactacg aggtgcaagt catcgtccag ggtcaagagc acactaacct gaggcagacg 1140
ttctcgttgg gcaacggtcc ccacaccgtc aacattaatg ttagc 1185
Claims (1)
1. the cellulase directed evolution method of Fushou spiral shell, its step is as follows:
The first step, obtain the cellulose enzyme gene of Fushou spiral shell:
(1) first extract total mRNA-messenger RNA(mRNA) of Fushou spiral shell:
(2) carry out again post transcription cloning cDNA-complementary DNA (cDNA);
(3) then, by PCR-polymerase chain reaction, amplify the cellulose enzyme gene of Fushou spiral shell;
(4) last, reclaim the PCR product, obtain the cellulose enzyme gene fragment of Fushou spiral shell;
This cellulose enzyme gene fragment sequence is the sequence shown in SEQ ID NO:1:
atgccctctg gtgctgctgg tgctggggtg accagcgaga tcgaccgact gagaagaagc
gacataacgg ttcacgtgaa tgttggtggt aacatcaacc acggtcaagt gagcattcga
gtgttacaaa agagaaaggc attcccgttc gggacatgtg tggccgcctg ggcctacaac
gatgggtcca aaggagcata ccgggatttc atccaccagc actacaactg ggccgtgcca
gaaaactcac tcaagtgggc tagcatcgaa cctaacaggg gacaaaagaa ctatcagcct
ggcctaaaca tgcttcacgg actgagaaat cacgggatta aggtgagagg tcacaacctg
gtgtggtctg tcgacaatac ggtgcagaac tgggtcaagg ctctgcatgg ggatgagctg
cgaaaggttg tccatgacca catcgtggaa accatcaaca catttaaggg attagtggag
cactgggatg tgaacaacga gaacctgcat ggccagtggt accagcatca actgaatgac
aatggctaca acctggaact gttccgtatc gcacacgccg ccgaccccaa cgtcaaactc
ttcctcaacg actacaacgt tgtgtccaac agttattcaa caaacgacta tcttcgacaa
ggtcaacagt ttaaggccgc taatgtgggt ctttacggtt tgggtgccca gtgccacttt
ggcgacgaaa gcgacccaga acccggtact aagcaacgtc tggatacttt agctcaagtg
ggcgtgccca tctgggccac tgagttggat gtggtagctt cggatgagaa cagacgagcg
gacttctacg agcacgcgct gacagtcctg tacggccatc atgccgtgga gggcatcctc
atgtggggct tctgggacaa ggcccactgg cgtggcgcca gagctgctct tgttgtcgga
gacaacctgc agctgacggc ggccggacgt cgcgtgctgg agctctttga gcacaggtgg
atgacagacg agacgcacaa cctggcagcg ggcactcagt tcacagtacg cggtttccat
ggcgactacg aggtgcaagt catcgtccag ggtcaagagc acactaacct gaggcagacg
ttctcgttgg gcaacggtcc ccacaccgtc aacattaatg ttagc
Second step, Cloning and sequencing:
(1) clone PCR products is connected the PCR product with the pMD18-T carrier that contains the T end;
(2) CaCl is adopted in the preparation of competent cell and conversion
2The standby competent cell of legal system;
(3) screening of positive colony is carried out preliminary screening with X-gal and IPTG to the clone;
(4) extract plasmid, extract plasmid with alkaline process;
(5) order-checking, after the recombinant plasmid sequencing, with
Www.ncbi.nlm.nih.govComparison by Internet, the exactness of its sequence of check analysis;
The 3rd step, rite-directed mutagenesis:
(1) with molecular biology professional software DNAman, DNAstar and professional website
Http:// swissmodel.expasy.org/workspaceWww.sbc.su.se/miklos/DAS/ carries out on-line analysis by transmembrane protein structure prediction net http://, adopt " DAS "-Transmembrane Predictionserver to carry out the functional analysis prediction, need to determine the amino acid of transformation to be: 332 α-amino-isovaleric acids sport L-Ala; Can fortifying fibre element enzyme and the interaction of Mierocrystalline cellulose on space structure;
(2) directional transformation of cellulase protein adopts test kit to carry out rite-directed mutagenesis, then it is definite to check order; The below sports 332 α-amino-isovaleric acids the method for L-Ala explanation rite-directed mutagenesis:
1) design primer:
Requirement and test kit operation steps according to gene order and rite-directed mutagenesis, the codon GTG of the 332nd Val α-amino-isovaleric acid of this cellulase protein sports the codon GCG of Ala L-Ala, design a pair of primer P1 and the P2 that comprises the mutational site, concrete sequence is as follows:
P1：5′GCAGCTGACGGCGGCCGGACGTCGCGCGCTGGAGCTCTTTGAGCACAGG3′；
P2：5′CGTGTGCTCAAAGAGCTCCAGCGCGCGACGTCCGGCCGCCGTCAGCTGC3′；
The base at shade position is the sudden change position, and all primers are synthetic by Shanghai Bo Ya Bioisystech Co., Ltd;
2) PCR rite-directed mutagenesis:
All are all undertaken by the Quik Change Site-directed Mutagenesis kit operation instruction of Stratagene company.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910191123 CN101693899B (en) | 2009-10-14 | 2009-10-14 | Cellulose orthogenesis method of ampullaria crossean |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910191123 CN101693899B (en) | 2009-10-14 | 2009-10-14 | Cellulose orthogenesis method of ampullaria crossean |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101693899A CN101693899A (en) | 2010-04-14 |
| CN101693899B true CN101693899B (en) | 2013-05-08 |
Family
ID=42092896
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910191123 Expired - Fee Related CN101693899B (en) | 2009-10-14 | 2009-10-14 | Cellulose orthogenesis method of ampullaria crossean |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101693899B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643789B (en) * | 2011-02-17 | 2013-08-21 | 东莞泛亚太生物科技有限公司 | Cellulase and application thereof |
| CN105586354B (en) * | 2016-01-29 | 2018-10-19 | 中国计量学院 | Protein and its cloning process of a kind of Pomacea canaliculata anti contravariance related gene trehalose synthetase gene, its coding |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101210236A (en) * | 2006-12-30 | 2008-07-02 | 中国科学院上海生命科学研究院 | Multifunctional cellulase and application thereof |
| CN101210237A (en) * | 2006-12-30 | 2008-07-02 | 中国科学院上海生命科学研究院 | Animal endogenous interior contact-beta-1,4-dextranase and application thereof |
-
2009
- 2009-10-14 CN CN 200910191123 patent/CN101693899B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101210236A (en) * | 2006-12-30 | 2008-07-02 | 中国科学院上海生命科学研究院 | Multifunctional cellulase and application thereof |
| CN101210237A (en) * | 2006-12-30 | 2008-07-02 | 中国科学院上海生命科学研究院 | Animal endogenous interior contact-beta-1,4-dextranase and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Kentaro Sakamoto and Haruhiko Toyohara."Molecular cloning of glycoside hydrolase family 45 cellulase genes from brackish water clam Corbicula japonica".《Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology》.2009,第152卷(第4期),390-396页. |
| 李燕红和赵辅昆."纤维素酶的研究进展".《生命科学》.2005,第17卷(第5期),392-397页. |
| 马翠鸾等."分子生物学技术在纤维素酶改造中的应用".《化工科学》.2008,第16卷(第5期),52-57页. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101693899A (en) | 2010-04-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112708607B (en) | Inulase mutant MutS120R with changed thermal adaptability and application thereof | |
| CN109355276A (en) | A kind of Pullulan enzymatic mutant and its application | |
| CN104130951A (en) | Recombinant pichia pastoris engineering bacteria and metabolic recombinant xylanase as well as preparation of metabolic recombinant xylanase | |
| CN101845447B (en) | Beta-agarase encoding gene and gene acquisition method | |
| Cheema et al. | Isolation of a gene encoding a cellulolytic enzyme from swamp buffalo rumen metagenomes and its cloning and expression in Escherichia coli | |
| CN107164398A (en) | A kind of recombinant alpha galactosidase gene, carrier, engineering bacteria and its application | |
| CN109852597A (en) | A kind of beta galactosidase galRBM20_1 and its preparation method and application | |
| CN101693899B (en) | Cellulose orthogenesis method of ampullaria crossean | |
| CN102816728A (en) | Construction of beta-1,4-endoxylanase engineering bacterium, and application of enzyme of beta-1,4-endoxylanase engineering bacterium | |
| CN102226166A (en) | Gene engineering strain for efficiently expressing pullulanase and construction method thereof | |
| CN104726435B (en) | A kind of beta-glucosidase enzyme mutant, its recombinant expression plasmid and the engineered strain of conversion | |
| CN103614303B (en) | A kind of Li's Trichoderma strains of expressing saccharifying enzyme | |
| CN102994476B (en) | Saccharifying enzyme | |
| CN103160483B (en) | Beta-glucosidase, as well as expression gene and application thereof | |
| CN102807958B (en) | Bacterial strain capable of secreting cellulase as well as cellulase extraction method and application thereof | |
| CN104726388B (en) | A kind of Pullulanase bacterium producing multi enzyme preparation and the method for improving its enzymatic productivity | |
| CN104419688A (en) | Fructosyl transferase as well as gene, secreted expression vector and application thereof | |
| CN102220354B (en) | Heat-resisting urate oxidase gene of microbacterium category bacteria and application of same | |
| CN102864132A (en) | Xylosidase with high heat resistance as well as coding gene and applications of xylosidase | |
| CN116064616A (en) | Cellulase gene, cellulase, recombinant vector and application | |
| CN103013956A (en) | Saccharifying enzyme and recombinant expression strain thereof | |
| CN101979528A (en) | Esterase and coding gene and use thereof | |
| CN111304182A (en) | β -glucosidase and preparation method and application thereof | |
| CN113817758A (en) | Chitosan enzyme gene for encoding Bacillus belgii, chitosanase, preparation method and application thereof | |
| CN106701805B (en) | Encoding gene of endogenous β -glucosidase, encoded protein, expression vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130508 Termination date: 20131014 |