CN101693028A - Application of lithospermic acid ester compounds in preparation of medicines for treating malaria - Google Patents
Application of lithospermic acid ester compounds in preparation of medicines for treating malaria Download PDFInfo
- Publication number
- CN101693028A CN101693028A CN200910197474A CN200910197474A CN101693028A CN 101693028 A CN101693028 A CN 101693028A CN 200910197474 A CN200910197474 A CN 200910197474A CN 200910197474 A CN200910197474 A CN 200910197474A CN 101693028 A CN101693028 A CN 101693028A
- Authority
- CN
- China
- Prior art keywords
- lithospermic acid
- acid ester
- ester compounds
- falcipain
- malaria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides application of lithospermic acid ester compounds in preparation of medicines for treating malaria, the lithospermic acid ester compound has the following structural formula, wherein R1 is methyl or n-butyl; and R2 is hydrogen or methyl. The invention also provides a pharmaceutical composition containing lithospermic acid ester compound active ingredient having the weight content of 5-95% in the pharmaceutical composition and pharmaceutically acceptable carriers. The result of experiments for determining the binding activity of lithospermic acid butyl ester and Falcipain-2 protease shows that obvious binding between the lithospermic acid ester and FP-2 protein is achieved and higher suppression rate to Falcipain-2 enzyme is presented. The result of the determination of in-vitro antimalarial activity shows that both lithospermic acid butyl ester and lithospermic acid dimethyl ester have higher in-vitro anti-plasmodium activity. Therefore, the lithospermic acid ester compounds can be used for preparing the medicines for treating malaria.
Description
Technical field
The present invention relates to medicine, be specifically related to the application of a kind of lithospermic acid ester compounds in pharmacy, relate in particular to the application of lithospermic acid ester compounds in the malaria medicine that the preparation treatment is caused by plasmodium.
Background technology
Malaria is that the most frequent parasitic disease takes place on the earth, is the disease of being propagated, had potential fatal risk by anopheles.There is the malaria case about 500,000,000 in the annual whole world, causes surpassing 1,000,000 people's death, and the overwhelming majority occurs in Africa.World Health Organization (WHO) points out that malaria killed a child below 5 years old in average per 30 seconds.Malaria is caused by plasmodium.Have and plasmodially femalely plasmodium is injected human body, typical malaria clinical symptoms can take place, can be divided into the fourth phase: cold stage, pyrogenic stage, sweating stage and intermission through 10～20 days by behind the mosquito bite human body.After the outbreak repeatedly of malaria, anemia, hepatosplenomegaly can appear in patient, even dangerous symptoms such as brain type, superelevation pattern of fever, the cold mould of fainting and gastrointestinal type occur, even threat to life.Along with the chemical sproof continuous increase of existing antimalarial agent, the sickness rate of malaria increases day by day, demands having the discovery of the antimalarial agent of novel therapeutic effect urgently.
The plasmodium of erythrocyte stage hydrolysis host's in its acidic food bubble hemoglobin is to obtain required energy and the aminoacid of self life.Biological study shows, forgives a series of hydrolytic enzyme in plasmodial food vacuole, as aspartic protease (plasmepsins), and cysteine proteinase (falcipains), and metalloproteases (falcilysins).These enzymes have become the chemotherapeutical potential target of malaria.
Cysteine proteinase is M
τThe protein that is about 21000-30000 has the highest hydrolysing activity when pH 4-6.5, its active site has cysteine residues.Plasmodial cysteine proteinase belongs to papain family.Known plasmodium cysteine proteinase has four hypotypes, falcipain-1 (plasmodium cysteine proteinase-1), falcipain-2A (the plasmodium cysteine proteinase-2A), falcipain-2B (the plasmodium cysteine proteinase-2B), falcipain-3 (plasmodium cysteine proteinase-3).Falcipain 1 is the plasmodium cysteine proteinase that first expression obtains, and its biological study shows that it is to plasmodial monogony stage did not influence, but the function of energy remarkable influence egg capsule.Falcipain-2A, falcipain-2B have 97% homology, and be only different 7 of aminoacid sequence.Monitoring by oligonucleotide probe finds that the expression of falcipain-2B mRNA is lower than falcipain-2A.Yet falcipain-2A is very similar with peak value at the time dependence of plasmodium trophosome its expression in late period with falcipain-2B, and this shows that two kinds of different hypotypes have similar biological function.Falcipain-3 and falcipain-2 have 66.6% homology at catalytic domain, but the stage that they are expressed is different.Falcipain-2 reaches summit at vegetative stage, and falcipain-3 is in that more the sophisticated plasmodium stage peaks.In these several hypotypes, maximum for the research of falcipain-2, so the exploitation of its inhibitor also is subjected to paying close attention to more widely.
The traditional Chinese medical herbal treatment malaria has had very long history, such as in " element asks thorn cruel opinion ", just having proposed with acupuncture prophylactic treatment malaria, aspect Chinese herbal medicine, except world-famous Herba Artemisiae Annuae, Radix Clematidis, Herba Kyllingae, Fructus Bruceae, Radix Dichroae, Herba Centipedae, Semen Arecae, Herba Potentillae Discoloris, Herba Ranunculi Scelerati (Radix Anemones rupicolae) etc. also are used for treating malaria among the people.The reactive compound arteannuin of finding from the Chinese medicine Herba Artemisiae Annuae is used for the treatment of malaria and has obtained good effect, is widely used in clinical.Chinese medicine has magical curative effect to be admitted by the world aspect promoting health and curing diseases, and seeks from Chinese medicine therefore that to have an anti-cruel active chemical compound significant.The inventor has accumulated kind more than 2000 by basic research for many years, and has set up the natural product storehouse, by chemical compound in the storehouse is screened, has found to have the lithospermic acid ester compounds of anti-cruel effect.
Summary of the invention
Technical problem to be solved by this invention is the application of research design lithospermic acid ester compounds in preparation treatment malaria medicine.
The invention provides a kind of lithospermic acid ester compounds, have following general structural formula:
R in the formula
1Be methyl or normal-butyl; R
2Be hydrogen or methyl.
Lithospermic acid ester compounds is distributed in many kind of plant, can separate to obtain from plant, also can obtain with the mode of chemosynthesis.
Described lithospermic acid ester compounds is: alkannic acid dimethyl ester, alkannic acid butyl ester.
Another object of the present invention has provided the application of lithospermic acid ester compounds in preparation treatment malaria medicine.
The compounds of this invention alkannic acid butyl ester combines determination of activity with Falcipain-2 protease, and the result shows that the alkannic acid butyl ester has tangible the combination with FP-2 albumen; Lithospermic acid ester compounds has high inhibitory to falcipain-2; The external antimalarial active of lithospermic acid ester compounds is measured, and the result shows that alkannic acid butyl ester and alkannic acid dimethyl ester all have good in-vitro malaria protozoon activity.Therefore, lithospermic acid ester compounds can be used for preparing the medicine for the treatment of malaria.
It is active component that another object of the present invention provides with the lithospermic acid ester compounds, is used to prepare the pharmaceutical composition for the treatment of malaria.Especially the pharmaceutical composition for preparing the malaria that causes by plasmodium.
It is active component that pharmaceutical composition of the present invention contains the lithospermic acid ester compounds for the treatment of effective dose, and contains one or more pharmaceutically acceptable carriers.Wherein the weight content of active component in pharmaceutical composition is 5-95%.
Described pharmaceutically acceptable carrier is meant the pharmaceutical carrier of pharmaceutical field routine, for example: diluent, excipient such as water lamp; Filler such as starch, sucrose etc.; Binding agent such as gelatin, polyvinylpyrrolidone; Wetting agent such as glycerol; Disintegrating agent such as calcium carbonate, sodium bicarbonate; Absorption enhancer such as quaternary ammonium compound; Surfactant such as hexadecanol; Absorption carrier such as Kaolin and soap clay; Lubricant such as Pulvis Talci, calcium stearate, Polyethylene Glycol etc., can also in compositions, add other adjuvant such as flavouring agent, sweeting agent etc. in addition.
The compounds of this invention can compositions form by oral, snuffing is gone into, the mode of rectum or parenteral is applied to the patient who needs this treatment.Be used for when oral, can or make liquid preparation such as water or oil-suspending agent, syrup etc. the solid preparation of its academic title's routine such as tablet, granule, capsule etc.; When being used for parenteral, can be made into solution, smuggled goods oiliness suspending agent of injection etc.
The various dosage forms of pharmaceutical composition of the present invention can be according to the conventional production method preparation of pharmaceutical field.Active component is mixed with one or more carriers, be made into required dosage form then.
The specific embodiment
Embodiment 1: the preparation of alkannic acid dimethyl ester and alkannic acid butyl ester
After the Dracocephalum moldabium 10kg of Folium Pini is ground into coarse powder,, that the extractum that the extracting solution reclaim under reduced pressure obtains is soluble in water with 80% alcohol reflux 3 times, use earlier ethyl acetate extraction, reclaim ethyl acetate part (200g), water liquid part reuse n-butanol extraction, reclaim n-butyl alcohol part (700g).N-butyl alcohol partly passes through silica gel column chromatography, and with chloroform-acetone 1: 0-1: 1 gradient elution is divided into 5 big flow points.Wherein behind the 4th flow point concentrate drying 21.3g behind dissolve with methanol through the reverse phase silica gel chromatograph, with the methanol-water gradient elution, be divided into 6 flow points.Wherein the 2nd flow point is through Sephadex LH-20 glucosan chromatograph, with chloroform: 1: 1 eluting of methanol, detect through silica gel thin-layer chromatography, having 3 components, is yellow powder behind component 1 concentrate drying wherein, is weighed as 510mg, structure is accredited as the alkannic acid butyl ester, behind component 2 concentrate dryings is pale yellow powder, is weighed as 625mg, and structure is accredited as alkannic acid dimethyl ester.
The structure of alkannic acid butyl ester is as follows:
(alkannic acid butyl ester and alkannic acid dimethyl ester that this law makes are used for the following example 2-5)
The structure of alkannic acid dimethyl ester is as follows:
Embodiment 2:
The compounds of this invention alkannic acid butyl ester combines determination of activity with Falcipain-2 protease:
Falcipain-2 protease combines the mensuration of active screening and kinetic constant based on SPR (surface plasma resonance) principle with the alkannic acid butyl ester, the instrument of use be Biacore 3000 (Biacore AB, Uppsala, Sweden).
(1) structure of Falcipain-2 plasmid (pQE30-Fal2)
According to Falcipain-2 cDNA sequential design primer, forward and reverse primer are respectively 5 ' CGTGGATCCCAAATGAATTATGAAG3 ' and 5 ' ATATGTCGACTTATTCAATTAATGGAATG3 ', comprise BamH I and Sal I restriction enzyme site, by pcr amplification Falcipain-2 fragment, PCR product behind the enzyme action is connected the back identifies correctly with expression vector pQE30, be transformed into escherichia coli M15 and express.
(2) the proteic expression and purification of Falcipain-2 (FP-2)
The plasmid pQE30-Fal2 that builds changed over to obtain expressing engineering bacteria among the escherichia coli M15, engineering bacteria is incubated at overnight incubation (peptone 10g/L in the 10mL LB culture medium that contains 100 μ g/mL ampicillin and 50 μ g/mL kanamycin, yeast extract 5g/L, sodium chloride 10g/L).Go into 1L by switching in 1: 100 then and contain in the fresh LB culture medium of ampicillin and kanamycin, under 37 ℃, 220 rev/mins of cultivations.When OD600 reaches about 0.8 the time, add IPTG to final concentration 0.5mM, reduce the temperature to 25 ℃ simultaneously and cultivate and carried out induction expression of protein in 12 hours.4000 rev/mins of centrifugal 30 minutes collection thalline are put in-80 ℃ of ultra cold storage freezers preservations and spend the night after collection is good.Thalline is hanged with the buffer 1 of 20mL (and 10mM imidazoles, pH 8.0 for 20mM Tris-Cl, 0.5M NaCl), with ultrasonic disruption on the suspension ice bath (300W worked 30 minutes, one time 5 seconds, midfeather 10 seconds).The cell homogenates that obtains after the fragmentation is at 4 ℃, centrifugal 30 minutes with 10000 rev/mins, abandon supernatant, with buffer 2 (6M guanidine HCl 20mMTris-Cl 250mM NaCl 20mM imidazoles, the pH 8.0) dissolution precipitation of 20mL, gentle agitation is 1 hour under the room temperature, 10000 rev/mins of centrifugal 30min, and sample on the supernatant is arrived usefulness bind buffer (Binding buffer) 2 (6M guanidine HCl, 20mM Tris-Cl, 250mM NaCl, pH 8.0) Ni that balance is good
2+On-NTA the post, successively with dcq buffer liquid 1 (8M carbamide, 20mM Tris-Cl, 500mM NaCl pH 8.0) and the foreign protein of each 30ml flush away non-specific binding of dcq buffer liquid 2 (8M carbamide, 20mM Tris-Cl, 30mM imidazoles), reuse elution buffer (8M carbamide, 20Mm Tris-Cl, the 1M imidazoles) 10ml flush away destination protein, detect proteic molecular weight and purity with SDS-PAGE.
(3) renaturation of FP-2 inclusion body protein
The albumen that purification is obtained adds 10mM DTT, 37 ℃ of warm down baths after 45 minutes, protein solution is diluted to the 10g/ml (dialysis solution: 100mM Tris-Cl of dialysing, 1mM EDTA, 20% glycerol, 250mM L-arginine, 1mM glutathion, 1mM oxidized form of glutathione (GSSG), pH 8.0) spend the night.The albumen that dialysis is good concentrates the mensuration that promptly can be used as enzyme inhibition activity.
(4) the proteic coupling of FP-2
After thoroughly cleaning Biacore 3000 machines, steady to baseline with PBS buffer (3mM EDTA and 0.005% (v/v) surfactant P20, pH 7.4 for 10mM4-hydroxyl piperazine ethyl sulfonic acid, 150mM NaCl) balancing machine.0.2MN-ethyl-N '-dimethyl aminopropyl carbodiimide and 50mMM N-hydroxy-succinamide (EDC/NHS) 1: 1 are mixed, with 5 μ L/min sample introductions 7 minutes with the activation chip surface.FP-2 albumen 10mM sodium acetate, pH4.2, being diluted to final concentration is 69 μ g/ml, with 5 μ L/min flow velocity sample introductions.At last, use the 1M diethanolamine hydrochloride, pH 8.5 is with 5 μ L/min flow velocity sample introductions 7 minutes, the sealing chip surface, and the final proteic coupling amount of FP-2 is about 9300RU.
(5) screening compound
Substrate Z-Phe-Arg-pNA HCl (Bachem AG) is as positive control.The alkannic acid butyl ester dissolves with 100%DMSO, and mother liquid concentration is 10mM.With HBS-EP buffer diluted compounds, to final concentration be 1 μ M and 10 μ M, the final concentration of DMSO is 0.1%.According to the proteic bonded RU of FP-2 on alkannic acid butyl ester and the chip (Response Unit, resonance units) value, judge whether chemical compound has in conjunction with active.Have in conjunction with active chemical compound and can carry out detailed dynamic experiment.The result proves that the alkannic acid butyl ester has tangible the combination with FP-2 albumen.
(6) kinetic determination
The alkannic acid butyl ester is made into different Concentraton gradient respectively with work buffer HBS-EP (containing 0.1%DMSO), and with 30 μ l/min sample introduction 1min, the 2min that dissociates stablizes 2min with same buffer then.Obtain the sensing figure of alkannic acid butyl ester and FP-2 protein-interacting, 1: 1 (Langmuir) combination model or steady-state model in the reuse Biacore analysis software carry out match, obtain definite kinetics and thermodynamic equilibrium constant.
(7) result of the test:
The test result of table 1 positive control and alkannic acid butyl ester and FP-2 protein binding constant.
Embodiment 3
The compounds of this invention suppresses active mensuration to falcipain-2 protease percentage
(1) renaturation of proteic expression and purification of Falcipain-2 (FP-2) and FP-2 inclusion body protein
Referring to embodiment 2
(2) The compounds of this invention is to the mensuration of FP-2 enzyme inhibition activity
100mM NaOAc at 197 μ L, 10mM DTT, add FP-2 albumen (final concentration 10g/ml) in the buffer solution system of pH 5.5 and be dissolved in the testing compound solution of DMSO, final concentration 10M and 0M (negative control) are hatched under the room temperature behind the 30min with MD SpectraMax M5 microplate reader in excitation wavelength (excitation) 355nm; Emission wavelength (emission) 460nm place surveys the RFU value in the 15min continuously, calculates reaction rate K
m, draw testing compound percent inhibition under 10M with following formula,
Computing formula is:
(matched group K
mValue-experimental group K
mValue)/matched group K
mValue * 100%
(3) compound activity test result
Table 2. lithospermic acid ester compounds is to falcipain-2 suppression ratio data.
Embodiment 4
The compounds of this invention is to falcipain-2 protease half effective inhibition concentration (IC
50) mensuration
Choose the 10M suppression ratio and survey IC at the chemical compound more than 50%
50, experimental technique and system such as embodiment 3.According to the chemical compound reaction rate K that the FP-2 enzyme is lived under variable concentrations
m, the suppression ratio that the computerized compound is lived to the FP-2 enzyme under variable concentrations uses the Sigmoidal formula to carry out the IC that match obtains chemical compound with origin software
50Value the results are shown in Table 3.
Table 3. lithospermic acid ester compounds is lived to the falcipain-2 enzyme and is suppressed IC
50
The external antimalarial active of embodiment 5 lithospermic acid ester compounds is measured
Antimalarial active can be by measuring plasmodium LDH active next determine (Jain, M.; Khan, S.I.; Tekwani, B.L.; Jacob, M.R.; Singh, S.; Singh, P.P.; Jain, R.Synthesis, antimalarial, antileishmanial, and antimicrobial activities of some8-quinolinamine analogues.Bioorg.Med.Chem.2005,13,4458-4466.)..In each hole of 96 orifice plates that contain 10 μ L serial dilution test sample books, add red blood cell suspension (the 200 μ L that infected D6 or W2 strain P.falciparum plasmodium cysteine proteinase, cultivate concentrated 10% human serum and the 60lg/mL amikacin of adding at RPMI 1640, make the plasmodium mass formed by blood stasis reach 2%, packed cell volume reaches 2%), use 90% N then
2, 5% O
2, and 5% CO
2The mist flushing plate of forming was cultivated 72 hours in cultivating the room, and temperature remains on 37 ℃.LDH is active in MalstatTM reagent (Flow Inc., Portland, OR) measure, the mensuration program is with reference to program (the M.T.Makler andD.J.Hinrichs of Makler and Hinrichs, Measurement of the lactate dehydrogenase activity ofPlasmodium falciparum as an assessment of parasitemia.J.Am.J.Trop.Med.Hyg.1993,48 (2): 205-210).In fact concise and to the point, be exactly the same 100 μ L he Mal stat of mixture that 20 μ L are cultivated
TMReagent mix was at room temperature cultivated 30 minutes. and (Sigma, St.Louis MO), cultivated under dark condition 1 hour to add the mixture (the NBT/PES ratio is 1: 1) of 20 microlitre NBT/PES then.Afterwards, add 100 μ L, 5% acetum and stop this reaction, and come check-out console with 650nm. add arteannuin and chloroquine in the medicine matched group.From dose-effect curve, calculate IC
50When measuring the selection index of chemical compound antimalarial active, also to measure them in external toxicity to mammalian cell. test is carried out (J.Mustafa in 96 hole tissue culturing plates, S.I.Khan, G.Ma, L.A.Walker andI.A.Khan, Synthesis and Anticancer Activities of Fatty Acid Analogs ofPodophyllotoxin.Lipids.2004,39 (2): 167-172.).In 96 orifice plates with 25, the density plantation vero cells in 000/hole was also cultivated 24 hours. add the sample of variable concentrations, be alkannic acid butyl acetate solution and alkannic acid dimethyl ester DMSO solution, concentration is followed successively by 528.8ng/ml, 1586.4ng/ml, 4760g/ml, continues to cultivate 48 hours.Utilize Neutral Red assay method to measure the survivaling cell number, from dose-effect curve, calculate IC
50. use amycin as the positive control medicine.The IC to D6 and W2 of lithospermic acid ester compounds
50Be worth as following table:
The result shows that alkannic acid butyl ester and alkannic acid dimethyl ester all have good in-vitro malaria protozoon activity.
Claims (4)
1. the application of lithospermic acid ester compounds in preparation treatment malaria medicine is characterized in that lithospermic acid ester compounds has following general structure:
R in the formula
1Be methyl or normal-butyl; R
2Be hydrogen or methyl.
2. application according to claim 1 is characterized in that described medicine is for treating the medicine of the malaria that is caused by plasmodium.
3. pharmaceutical composition for the treatment of malaria is characterized in that containing just like lithospermic acid ester compounds active component described in the claim 1 and acceptable carrier pharmaceutically.
4. pharmaceutical composition according to claim 3 is characterized in that the weight content of described active component lithospermic acid ester compounds in pharmaceutical composition is 5-95%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101974749A CN101693028B (en) | 2009-10-21 | 2009-10-21 | Application of lithospermic acid ester compounds in preparation of medicines for treating malaria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101974749A CN101693028B (en) | 2009-10-21 | 2009-10-21 | Application of lithospermic acid ester compounds in preparation of medicines for treating malaria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101693028A true CN101693028A (en) | 2010-04-14 |
| CN101693028B CN101693028B (en) | 2012-08-22 |
Family
ID=42092055
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009101974749A Expired - Fee Related CN101693028B (en) | 2009-10-21 | 2009-10-21 | Application of lithospermic acid ester compounds in preparation of medicines for treating malaria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101693028B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102249918A (en) * | 2011-05-20 | 2011-11-23 | 华南农业大学 | Preparation method of magnesium lithospermate |
| CN106938997A (en) * | 2017-01-17 | 2017-07-11 | 华东理工大学 | N (4 substitution phenethyl) acetamides and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101040907B (en) * | 2007-04-27 | 2011-01-05 | 上海现代中医药技术发展有限公司 | Method of controlling the quality of salvia miltiorrhiza raw material fingerprint in the plant medicine for improving hemorheology |
-
2009
- 2009-10-21 CN CN2009101974749A patent/CN101693028B/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102249918A (en) * | 2011-05-20 | 2011-11-23 | 华南农业大学 | Preparation method of magnesium lithospermate |
| CN102249918B (en) * | 2011-05-20 | 2013-12-04 | 华南农业大学 | Preparation method of magnesium lithospermate |
| CN106938997A (en) * | 2017-01-17 | 2017-07-11 | 华东理工大学 | N (4 substitution phenethyl) acetamides and application thereof |
| CN106938997B (en) * | 2017-01-17 | 2019-10-11 | 华东理工大学 | N- (4- replaces phenethyl) acetamides and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101693028B (en) | 2012-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Martin | Cell death and inflammation: the case for IL‐1 family cytokines as the canonical DAMP s of the immune system | |
| CN101693037B (en) | Application of flavonoid glycoside compounds in preparation of medicines for treating malaria | |
| Monteleone et al. | Mechanisms of unconventional secretion of IL-1 family cytokines | |
| Gulakowski et al. | Antireplicative and anticytopathic activities of prostratin, a non-tumor-promoting phorbol ester, against human immunodeficiency virus (HIV) | |
| Wardrop et al. | The story of the discovery of heparin and warfarin | |
| Upadhyay et al. | Solid-phase synthesis of mimosine tetrapeptides and their inhibitory activities on neuraminidase and tyrosinase | |
| JP2013529654A (en) | Pharmaceutical composition comprising levocarnitine and dobesylate | |
| Jin et al. | Dietary flavonoids fisetin and myricetin: dual inhibitors of Plasmodium falciparum falcipain-2 and plasmepsin II | |
| Jiang et al. | Discovery of glycyrrhetinic acid as an orally active, direct inhibitor of blood coagulation factor xa | |
| Han et al. | Investigational drugs for the treatment of Zika virus infection: a preclinical and clinical update | |
| CN102526022A (en) | Application of epigallocatechin-3-gallate in preparation of antitumor drug | |
| CN101693028B (en) | Application of lithospermic acid ester compounds in preparation of medicines for treating malaria | |
| NZ547946A (en) | Treatment composition | |
| CN106692150B (en) | Purposes of the Nintedanib in the drug that preparation prevents and treats Hepatic fibrosis and cirrhosis | |
| RU2738719C1 (en) | Agent for treating coronavirus, retrovirus infections and hepatitis c | |
| CN101693036B (en) | Application of cynanversicoside C in preparation of medicines for treating malaria | |
| KR20130031551A (en) | Flavonoids inhibiting sars-corona virus activity, pharmaceutically acceptable derivatives and salts thereof, composition and health functional food for treating or preventing sars containing the same | |
| CN100435805C (en) | Use of polysaccharose sulfate for preparing medicine against grippal virus | |
| EP3017816B1 (en) | Diindolylmethane-based medicinal agent and use thereof to treat influenza and viral respiratory infections | |
| CN1973902B (en) | Anticancer medicine adriamycin composition with ginseng polyse as carrier and its preparation process | |
| RU2647455C1 (en) | Composition having immunostimulating action for sublingual administration | |
| CN104274437B (en) | A kind of medicinal usage of A type trimerization OPC class polyphenol | |
| Mohan | Problems and perspectives in the design of anti‐HIV‐1 agents | |
| Spasov et al. | Antithrombotic activity of DAB-15, a novel diazepinobenzimidazole compound | |
| Raju et al. | Antiinflammatory, in-silico docking and adme analysis of some isolated compounds of Tageteserecta flower heads |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120822 Termination date: 20141021 |
|
| EXPY | Termination of patent right or utility model |