CN101693036B - Application of cynanversicoside C in preparation of medicines for treating malaria - Google Patents
Application of cynanversicoside C in preparation of medicines for treating malaria Download PDFInfo
- Publication number
- CN101693036B CN101693036B CN200910197472XA CN200910197472A CN101693036B CN 101693036 B CN101693036 B CN 101693036B CN 200910197472X A CN200910197472X A CN 200910197472XA CN 200910197472 A CN200910197472 A CN 200910197472A CN 101693036 B CN101693036 B CN 101693036B
- Authority
- CN
- China
- Prior art keywords
- cynanversicoside
- cynaversicoside
- falcipain
- malaria
- activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides an application of cynanversicoside C in the preparation of medicines for treating malaria, the structural formula of cynanversicoside C is as follows, and the invention also provides a pharmaceutical composition containing the cynanversicoside C and pharmaceutically acceptable carriers. The active ingredient, cynanversicoside C, has the weight content of 5-95% in the pharmaceutical composition. The result of experiments for determining the binding activity of the cynanversicoside C and Falcipain-2 protease proves that obvious binding between the cynanversicoside C and FP-2 protein is achieved and higher suppressive activity to FP-2 enzyme is presented. The result of the determination of in-vitro antimalarial activity of the cynanversicoside C shows that the cynanversicoside C has higher in-vitro anti-plasmodium activity. Therefore, the cynanversicoside C can be used for preparing the medicines for treating malaria and has tremendous clinic application value.
Description
Technical field
The present invention relates to medicine, be specifically related to the application of chemical compound Cynaversicoside C. in preparation treatment malaria medicine, relate in particular to the application of chemical compound Cynaversicoside C. in the malaria medicine that the preparation treatment is caused by plasmodium.
Background technology
Malaria is that the most frequent parasitic disease takes place on the earth, is the disease of being propagated, had potential fatal risk by anopheles.There is the malaria case about 500,000,000 in the annual whole world, causes surpassing 1,000,000 people's death, and the overwhelming majority occurs in Africa.World Health Organization (WHO) points out that malaria killed a child below 5 years old in average per 30 seconds.Malaria is caused by plasmodium.Have and plasmodially femalely plasmodium is injected human body, typical malaria clinical symptoms can take place, can be divided into the fourth phase: cold stage, pyrogenic stage, sweating stage and intermission through 10～20 days by behind the mosquito bite human body.After the outbreak repeatedly of malaria, anemia, hepatosplenomegaly can appear in patient, even dangerous symptoms such as brain type, superelevation pattern of fever, the cold mould of fainting and gastrointestinal type occur, even threat to life.Along with the chemical sproof continuous increase of existing antimalarial agent, the sickness rate of malaria increases day by day, demands having the discovery of the antimalarial agent of novel therapeutic effect urgently.
The plasmodium of erythrocyte stage hydrolysis host's in its acidic food bubble hemoglobin is to obtain required energy and the aminoacid of self life.Biological study shows, forgives a series of hydrolytic enzyme in plasmodial food vacuole, as aspartic protease (plasmepsins), and cysteine proteinase (falcipains), and metalloproteases (falcilysins).These enzymes have become the chemotherapeutical potential target of malaria.
Cysteine proteinase is that M τ is about 21000～30000 protein, o'clock has the highest hydrolysing activity in pH 4～6.5, and its active site has cysteine residues.Plasmodial cysteine proteinase belongs to papain family.Known plasmodium cysteine proteinase has four hypotypes, falcipain-1 (plasmodium cysteine proteinase-1), falcipain-2A (the plasmodium cysteine proteinase-2A), falcipain-2B (the plasmodium cysteine proteinase-2B), falcipain-3 (plasmodium cysteine proteinase-3).Falcipain 1 is the plasmodium cysteine proteinase that first expression obtains, and its biological study shows that it is to plasmodial monogony stage did not influence, but the function of energy remarkable influence egg capsule.Falcipain-2A, falcipain-2B have 97% homology, and be only different 7 of aminoacid sequence.Monitoring by oligonucleotide probe finds that the expression of falcipain-2B mRNA is lower than falcipain-2A.Yet falcipain-2A is very similar with peak value at the time dependence of plasmodium trophosome its expression in late period with falcipain-2B, and this shows that two kinds of different hypotypes have similar biological function.Falcipain-3 and falcipain-2 have 66.6% homology at catalytic domain, but the stage that they are expressed is different.Falcipain-2 reaches summit at vegetative stage, and falcipain-3 is in that more the sophisticated plasmodium stage peaks.In these several hypotypes, maximum for the research of falcipain-2, so the exploitation of its inhibitor also is subjected to paying close attention to more widely.
The traditional Chinese medical herbal treatment malaria has had very long history, such as in " element asks thorn cruel opinion ", just having proposed with acupuncture prophylactic treatment malaria, aspect Chinese herbal medicine, except world-famous Herba Artemisiae Annuae, Radix Clematidis, Herba Kyllingae, Fructus Bruceae, Radix Dichroae, Herba Centipedae, Semen Arecae, Herba Potentillae Discoloris, Herba Ranunculi Scelerati (Radix Anemones rupicolae) etc. also are used for treating malaria among the people.Therefore the reactive compound arteannuin of finding from the Chinese medicine Herba Artemisiae Annuae is used for the treatment of malaria and has obtained good effect, is widely used in clinically, seeks from Chinese medicine that to have an anti-cruel active chemical compound significant.The inventor has accumulated kind more than 2000 by basic research for many years, and has set up the natural product storehouse, by chemical compound in the storehouse is screened, has found that Cynaversicoside C. has the malaria effect.
Radix Cynanchi Atrati is the root of the upright Radix Cynanchi Atrati of asclepiadaceae Cynanchum plant, Cynanchum versicolor Bunge, and Radix Cynanchi Atrati has the effect that clearing away heat and cooling blood, inducing diuresis for treating stranguria syndrome, detoxifcation are treated skin ulcer in the theory of Chinese medical science, is used for diseases such as fever due to yin deficiency, hectic fever due to YIN-deficiency consumptive fever, puerperal fever due to deficiency of blood.Do not see that as yet the chemical constituent in the Radix Cynanchi Atrati has the report of malaria effect.
Summary of the invention
Technical problem to be solved by this invention is to propose the application of research design Cynaversicoside C. in preparation treatment malaria medicine.
The invention provides the application of Cynaversicoside C. in preparation treatment malaria medicine.
The structural formula of Cynaversicoside C. is as follows:
Cynaversicoside C. system separates the chemical compound that obtains from upright Radix Cynanchi Atrati, Cynanchum versicolor Bunge.
Combine tests such as determination of activity by Cynaversicoside C. with Falcipain-2 protease, the result proves that Cynaversicoside C. has tangible the combination with FP-2 albumen, has higher inhibition activity to the FP-2 enzyme.The external antimalarial active of Cynaversicoside C. is measured, and the result shows that Cynaversicoside C. has good in-vitro malaria protozoon activity.Therefore, can be used for preparing the medicine for the treatment of malaria
It is active component that another object of the present invention provides with the Cynaversicoside C., is used to prepare the pharmaceutical composition for the treatment of malaria, is particularly useful for preparing the pharmaceutical composition of the malaria that treatment causes by plasmodium.
It is active component that pharmaceutical composition of the present invention contains the Cynaversicoside C. for the treatment of effective dose, and contains one or more pharmaceutically acceptable carriers.Wherein the weight of active component in pharmaceutical composition is 5-95%.
Described pharmaceutically acceptable carrier is meant the pharmaceutical carrier of pharmaceutical field routine, for example: diluent, excipient such as water lamp; Filler such as starch, sucrose etc.; Binding agent such as gelatin, polyvinylpyrrolidone; Wetting agent such as glycerol; Disintegrating agent such as calcium carbonate, sodium bicarbonate; Absorption enhancer such as quaternary ammonium compound; Surfactant such as hexadecanol; Absorption carrier such as Kaolin and soap clay; Lubricant such as Pulvis Talci, calcium stearate, Polyethylene Glycol etc., can also in compositions, add other adjuvant such as flavouring agent, sweeting agent etc. in addition.
The compounds of this invention can compositions form by oral, snuffing is gone into, the mode of rectum or parenteral is applied to the patient who needs this treatment.Be used for when oral, can or make liquid preparation such as water or oil-suspending agent, syrup etc. the solid preparation of its academic title's routine such as tablet, granule, capsule etc.; When being used for parenteral, can be made into solution, smuggled goods oiliness suspending agent of injection etc.
The various dosage forms of pharmaceutical composition of the present invention can be according to the conventional production method preparation of pharmaceutical field.Active component is mixed with one or more carriers, be made into required dosage form then.
The specific embodiment
Embodiment 1: the preparation of Cynaversicoside C.
After Radix Cynanchi Atrati dry root 10kg pulverizes, measure 90% alcohol refluxs 3 times with 10 times, each 2 hours, merge extractive liquid,, decompression and solvent recovery, get ethanol extraction, macroporous resin HP-20 post on this extract, it is colourless to be eluted to eluent with distilled water and 30%EtOH respectively, and reuse 90%EtOH is eluted to till the sulphuric acid ethanol saponin colour developing feminine gender, reclaim the 90%EtOH eluent to doing, get 90%EtOH eluting part.The 90%EtOH eluting is partly carried out silica gel column chromatography, with chloroform-methanol (1: 1～1: 10v/v) carry out gradient elution, check the chromatography flow point with thin layer chromatography, flow point with identical single speckle merges, concentrate, get flow point 1,2,3,4,5, the the 3rd and the 4th part is wherein carried out the purification on normal-phase silica gel column chromatography more respectively, chloroform-methanol in varing proportions carries out eluting, the 3rd flow point gets A I-VII flow point, the 4th flow point gets B I-V flow point, with wherein B IV flow point through repeatedly RP-C18 chromatography (MeOH:H
2O) separation, purification obtain Cynaversicoside C. 146mg.The Cynaversicoside C. that makes is used for embodiment 2-5.
Cynaversicoside C. (cynanversicoside C), white amorphous powder, mp124-128 ℃,
(c=0.562, MeOH), molecular formula: C
28H
40O
10Through spectroscopic data analysis and physicochemical character measure with bibliographical information (Qiu Sheng-Xiang, et al.Phytochemistry, 1989,28 (11), Cynaversicoside C. 3175-3178) is in full accord.
Embodiment 2: Cynaversicoside C. combines determination of activity with Falcipain-2 protease
Falcipain-2 protease combines the mensuration of active screening and kinetic constant based on SPR (surface plasma resonance) principle with the alkannic acid butyl ester, the instrument of use be Biacore 3000 (Biacore AB, Uppsala, Sweden).
(1) structure of Falcipain-2 plasmid (pQE30-Fal2)
According to Falcipain-2 cDNA sequential design primer, forward and reverse primer are respectively 5 ' CGTGGATCCCAAATGAATTATGAAG3 ' and 5 ' ATATGTCGACTTATTCAATTAATGGAATG3 ', comprise BamH I and Sal I restriction enzyme site, by pcr amplification Falcipain-2 fragment, PCR product behind the enzyme action is connected the back identifies correctly with expression vector pQE30, be transformed into escherichia coli M15 (Qiagen) and express.
(2) the proteic expression and purification of Falcipain-2 (FP-2)
The plasmid pQE30-Fal2 that builds changed over to obtain expressing engineering bacteria among the escherichia coli M15, engineering bacteria is incubated at overnight incubation (peptone 10g/L in the 10mL LB culture medium that contains 100 μ g/mL ampicillin and 50 μ g/mL kanamycin, yeast extract 5g/L, sodium chloride 10g/L).Go into 1L by switching in 1: 100 then and contain in the fresh LB culture medium of ampicillin and kanamycin, under 37 ℃, 220 rev/mins of cultivations.When OD600 reaches about 0.8 the time, add IPTG to final concentration 0.5mM, reduce the temperature to 25 ℃ simultaneously and cultivate and carried out induction expression of protein in 12 hours.4000 rev/mins of centrifugal 30 minutes collection thalline are put in-80 ℃ of ultra cold storage freezers preservations and spend the night after collection is good.Thalline is hanged with the buffer 1 of 20mL (and 10mM imidazoles, pH 8.0 for 20mM Tris-Cl, 0.5M NaCl), with ultrasonic disruption on the suspension ice bath (300W worked 30 minutes, one time 5 seconds, midfeather 10 seconds).The cell homogenates that obtains after the fragmentation is at 4 ℃, centrifugal 30 minutes with 10000 rev/mins, abandon supernatant, with buffer 2 (6M guanidine HCl 20mM Tris-Cl 250mM NaCl 20mM imidazoles, the pH 8.0) dissolution precipitation of 20mL, gentle agitation is 1 hour under the room temperature, 10000 rev/mins of centrifugal 30min, and sample on the supernatant is arrived usefulness bind buffer 2 (6M guanidine HCl, 20mM Tris-Cl, 250mM NaCl, pH 8.0) Ni that balance is good
2+On-NTA the post, successively with dcq buffer liquid 1 (8M carbamide, 20mM Tris-Cl, 500mM NaCl pH 8.0) and the foreign protein of each 30ml flush away non-specific binding of dcq buffer liquid 2 (8M carbamide, 20mM Tris-Cl, 30mM imidazoles), reuse elution buffer (8M carbamide, 20Mm Tris-Cl, the 1M imidazoles) 10ml flush away destination protein, detect proteic molecular weight and purity with SDS-PAGE.
(3) renaturation of FP-2 inclusion body protein
The albumen that purification is obtained adds 10mM DTT, 37 ℃ of warm down baths after 45 minutes, protein solution is diluted to the 10g/ml (dialysis solution: 100mM Tris-Cl of dialysing, 1mM EDTA, 20% glycerol, 250mM L-arginine, 1mM glutathion, 1mM oxidized form of glutathione (GSSG), pH 8.0) spend the night.The albumen that dialysis is good concentrates the mensuration that promptly can be used as enzyme inhibition activity.
(4) the proteic coupling of FP-2
After thoroughly cleaning Biacore 3000 machines, steady to baseline with PBS buffer (3mM EDTA and 0.005% (v/v) surfactantP20, pH 7.4 for 10mM 4-hydroxyl piperazine ethyl sulfonic acid, 150mM NaCl) balancing machine.0.2M N-ethyl-N '-dimethylaminopropyl carbodiimide (N-ethyl-N '-dimethyl aminopropyl carbodiimide) and 50mMM N-hydroxy-succinamide (EDC/NHS) 1: 1 are mixed, with 5 μ L/min sample introductions 7 minutes with the activation chip surface.FP-2 albumen 10mM sodium acetate, pH4.2, being diluted to final concentration is 69 μ g/ml, with 5 μ L/min flow velocity sample introductions.At last, use the 1M diethanolamine hydrochloride, pH 8.5 is with 5 μ L/min flow velocity sample introductions 7 minutes, the sealing chip surface, and the final proteic coupling amount of FP-2 is about 9300RU.
(5) screening compound
Substrate Z-Phe-Arg-pNA HCl (Bachem AG) is as positive control.The Cynaversicoside C. that embodiment 1 makes dissolves with 100%DMSO, and mother liquid concentration is 10mM.With HBS-EP buffer diluted compounds, to final concentration be 1 μ M and 10 μ M, the final concentration of DMSO is 0.1%.According to the proteic bonded RU of FP-2 on alkannic acid butyl ester and the chip (Response Unit, resonance units) value, judge whether chemical compound has in conjunction with active.Have in conjunction with active chemical compound and can carry out detailed dynamic experiment.The result proves that Cynaversicoside C. has tangible the combination with FP-2 albumen.
(6) kinetic determination
Cynaversicoside C. is made into different Concentraton gradient respectively with work buffer HBS-EP (containing 0.1% DMSO), and with 30 μ l/min sample introduction 1min, the 2min that dissociates stablizes 2min with same buffer then.Obtain the sensing figure of Cynaversicoside C. and FP-2 protein-interacting, 1: 1 (Langmuir) combination model or steady-state model in the reuse Biacore analysis software carry out match, obtain definite kinetics and thermodynamic equilibrium constant.
(6) result of the test:
The test result of table 1 positive control and Cynaversicoside C. and FP-2 protein binding constant.
Embodiment 3 Cynaversicoside C .s suppress active mensuration to falcipain-2 protease percentage
(1) renaturation of proteic expression and purification of Falcipain-2 (FP-2) and FP-2 inclusion body protein
Referring to embodiment 2
(2) The compounds of this invention is to the mensuration of FP-2 enzyme inhibition activity
100mM NaOAc at 197 μ L, 10mM DTT, add FP-2 albumen (final concentration 10g/ml) in the buffer system of pH 5.5 and be dissolved in the testing compound solution of DMSO, final concentration 10M and 0M (negative control) are hatched under the room temperature behind the 30min with MD SpectraMax M5 microplate reader in excitation wavelength excitation 355nm; Emission wavelength emission 460nm place surveys the RFU value in the 15min continuously, calculates reaction rate K
m, draw testing compound percent inhibition under 10M with following formula,
Computing formula is:
(matched group K
mValue-experimental group K
mValue)/matched group K
mValue * 100%
(3) compound activity test result
Cynaversicoside C. is 83% to the suppression ratio of falcipain-2.
Embodiment 4 Cynaversicoside C .s are to falcipain-2 protease half effective inhibition concentration (IC
50) mensuration
Choose the 10M suppression ratio and survey IC at the chemical compound more than 50%
50, select the suitable compound Concentraton gradient, i.e. Cynaversicoside C. solution, experimental technique and system such as embodiment 3.According to the chemical compound reaction rate K that the FP-2 enzyme is lived under variable concentrations
m, the suppression ratio that the computerized compound is lived to the FP-2 enzyme under variable concentrations uses the Sigmoidal formula to carry out the IC that match obtains chemical compound with origin software
50Value, Cynaversicoside C. is lived to the falcipain-2 enzyme and is suppressed IC as a result
50Value is 1.54M.The prompting Cynaversicoside C. has antimalarial active preferably.
The external antimalarial active of embodiment 5 Cynaversicoside C .s is measured
Antimalarial active can be by measuring plasmodium LDH active next determine (Jain, M.; Khan, S.I.; Tekwani, B.L.; Jacob, M.R.; Singh, S.; Singh, P.P.; Jain, R.Synthesis, antimalarial, antileishmanial, and antimicrobial activities of some 8-quinolinamine analogues.Bioorg.Med.Chem.2005,13,4458-4466.).In each hole of 96 orifice plates that contain 10 μ L serial dilution test sample books, add red blood cell suspension (the 200 μ L that infected D6 or W2 strain P.falciparum, cultivate concentrated 10% human serum and the 60lg/mL amikacin of adding at RPMI 1640, make the plasmodium mass formed by blood stasis reach 2%, packed cell volume reaches 2%), use 90%N then
2, 5% O
2, and 5% CO
2The mist flushing plate of forming was cultivated 72 hours in cultivating the room, and temperature remains on 37 ℃.LDH is active in MalstatTM reagent (Flow Inc., Portland, OR) measure, the mensuration program is with reference to program (the M.T.Makler and D.J.Hinrichs of Makler and Hinrichs, Measurement of the lactate dehydrogenase activity of Plasmodium falciparum as an assessment of parasitemia.J.Am.J.Trop.Med.Hyg.1993,48 (2): 205-210).In fact concise and to the point, be exactly the same 100 μ L he Malstat of mixture that 20 μ L are cultivated
TMReagent mix was at room temperature cultivated 30 minutes. and (Sigma, St.Louis MO), cultivated under dark condition 1 hour to add the mixture (the NBT/PES ratio is 1: 1) of 20 microlitre NBT/PES then.Afterwards, add 100 μ L, 5% acetum and stop this reaction, and come check-out console with 650nm. add arteannuin and chloroquine in the medicine matched group.From dose-effect curve, calculate IC
50When measuring the selection index of chemical compound antimalarial active, also to measure them in external toxicity to mammalian cell. test is carried out (J.Mustafa in 96 hole tissue culturing plates, S.I.Khan, G.Ma, L.A.Walker and I.A.Khan, Synthesis and Anticancer Activities of Fatty Acid Analogs of Podophyllotoxin.Lipids.2004,39 (2): 167-172.).In 96 orifice plates with 25, the density plantation vero cells in 000/hole was also cultivated 24 hours. add the sample of variable concentrations, be Cynaversicoside C. DMSO solution, concentration is 528.8ng/ml, 1586.4ng/ml, 4760g/ml, continues to cultivate 48 hours.Utilize Neutral Red assay method to measure the survivaling cell number, from dose-effect curve, calculate IC
50. use amycin as the positive control medicine.The IC to D6 and W2 of Cynaversicoside C.
50Be worth as following table:
The result shows that Cynaversicoside C. has good in-vitro malaria protozoon activity.
Claims (4)
1. the application of Cynaversicoside C. in preparation treatment malaria medicine is characterized in that the structural formula of Cynaversicoside C. is as follows:
2. application according to claim 1 is characterized in that described medicine is for treating the medicine of the malaria that is caused by plasmodium.
3. application according to claim 1 is characterized in that described medicine is to contain just like Cynaversicoside C. described in the claim 1 and the pharmaceutical composition made of acceptable carrier pharmaceutically.
4. application according to claim 3 is characterized in that the weight content of active component Cynaversicoside C. in pharmaceutical composition is 5-95%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910197472XA CN101693036B (en) | 2009-10-21 | 2009-10-21 | Application of cynanversicoside C in preparation of medicines for treating malaria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910197472XA CN101693036B (en) | 2009-10-21 | 2009-10-21 | Application of cynanversicoside C in preparation of medicines for treating malaria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101693036A CN101693036A (en) | 2010-04-14 |
| CN101693036B true CN101693036B (en) | 2011-11-09 |
Family
ID=42092061
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910197472XA Expired - Fee Related CN101693036B (en) | 2009-10-21 | 2009-10-21 | Application of cynanversicoside C in preparation of medicines for treating malaria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101693036B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103948616B (en) * | 2014-04-15 | 2015-12-30 | 暨南大学 | Upright Radix Cynanchi Atrati glycosides C kills the application of the ectoparasite ciliate medicine of Fish in preparation |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1817898A (en) * | 2006-03-16 | 2006-08-16 | 中国人民解放军第二军医大学 | Use of anti-inflammatory medicine for scheelite total saponin and its saponin compound |
-
2009
- 2009-10-21 CN CN200910197472XA patent/CN101693036B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1817898A (en) * | 2006-03-16 | 2006-08-16 | 中国人民解放军第二军医大学 | Use of anti-inflammatory medicine for scheelite total saponin and its saponin compound |
Non-Patent Citations (3)
| Title |
|---|
| Qiu Sheng-Xiang et al.STEROIDAL GLYCOSIDES FROM THE ROOT OF CYNANCHUM VERSICOLOR.《Phytochemistry》.1989,第28卷(第11期),3175-3178. * |
| 吴振洁等.鹅绒藤属植物的化学成分和药理作用.《国外医药植物药分册》.1991,第6卷(第4期),147-154. * |
| 袁鹰.直立白薇活性成分及质量控制研究.《中国优秀硕士学位论文全文数据库,医药卫生科技辑》.2007,(第6期),69. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101693036A (en) | 2010-04-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Anti-hyperuricemic peptides derived from bonito hydrolysates based on in vivo hyperuricemic model and in vitro xanthine oxidase inhibitory activity | |
| Monteleone et al. | Mechanisms of unconventional secretion of IL-1 family cytokines | |
| Gulakowski et al. | Antireplicative and anticytopathic activities of prostratin, a non-tumor-promoting phorbol ester, against human immunodeficiency virus (HIV) | |
| CN101693037B (en) | Application of flavonoid glycoside compounds in preparation of medicines for treating malaria | |
| EP1930002B1 (en) | Use of hydroxybenzoic acid ester compounds for the manufacture of a medicament for the prevention and treatment of hpv infection | |
| Nichol et al. | Stimulation of murine interferon by a substituted pyrimidine | |
| Jin et al. | Dietary flavonoids fisetin and myricetin: dual inhibitors of Plasmodium falciparum falcipain-2 and plasmepsin II | |
| Upadhyay et al. | Solid-phase synthesis of mimosine tetrapeptides and their inhibitory activities on neuraminidase and tyrosinase | |
| Han et al. | Investigational drugs for the treatment of Zika virus infection: a preclinical and clinical update | |
| Bekheit et al. | Potential RNA-dependent RNA polymerase (RdRp) inhibitors as prospective drug candidates for SARS-CoV-2 | |
| CN101693028B (en) | Application of lithospermic acid ester compounds in preparation of medicines for treating malaria | |
| CN101693036B (en) | Application of cynanversicoside C in preparation of medicines for treating malaria | |
| JP5663768B2 (en) | Interferon with spatial structure change and its application | |
| CN103450163A (en) | Indazole compounds, preparation method, and pharmaceutical applications thereof | |
| CN107913398A (en) | A kind of application of polypeptide in preventing or treating thrombotic diseases | |
| Tarro | Anti-Rhinovirus Activity of Ethyl 4-(3-(2-(3-Methylisoxazol-5-Yl) Ethoxy) Propoxy) Benzoate (EMEB) | |
| JP6606370B2 (en) | Antiallergic agent and mediator release inhibitor | |
| CN105012294B (en) | New application of the ellagic acid compounds in treatment antihyperuricemic disease drug is prepared | |
| Lin et al. | Structural Basis for Coronaviral Main Proteases Inhibition by the 3CLpro Inhibitor GC376 | |
| Daryabari et al. | An update on betrixaban, the challenging anticoagulant agent for extended venous thromboembolism prophylaxis | |
| CN100390200C (en) | Recombinant targeted fusion protein for treating acquired immunodeficiency syndrome | |
| RU2597150C2 (en) | Antiviral compound of multiple action, its composition and method of treating viral diseases | |
| CN105796539B (en) | Pig Xian acid is preparing the application in treating anti-malarial drug | |
| Raju et al. | Antiinflammatory, in-silico docking and adme analysis of some isolated compounds of Tageteserecta flower heads | |
| Odnovorov et al. | Prospects for Specific Influenza Treatment. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111109 Termination date: 20141021 |
|
| EXPY | Termination of patent right or utility model |