CN101654703B - Method for identifying paddy female sterile gene FST molecule - Google Patents
Method for identifying paddy female sterile gene FST molecule Download PDFInfo
- Publication number
- CN101654703B CN101654703B CN2009100949877A CN200910094987A CN101654703B CN 101654703 B CN101654703 B CN 101654703B CN 2009100949877 A CN2009100949877 A CN 2009100949877A CN 200910094987 A CN200910094987 A CN 200910094987A CN 101654703 B CN101654703 B CN 101654703B
- Authority
- CN
- China
- Prior art keywords
- pcr
- female sterile
- molecular weight
- fst
- paddy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for identifying paddy female sterile gene FST molecules, which belongs to the breeding field of agricultural biological technology. The adopted technical scheme comprises the following steps: extracting paddy total DNA, and carrying out PCR reaction by particularity primers Gf1, Gr1,Jf1 and Jr1; adding 3 mu l of loading buffer to be uniformly mixed, sampling 6 mu l, and carrying out the electrophoresis of 125 V for 40 minutes by agarose gel of 2 percent and 1*TAE buffer; and checking on an ultraviolet transilluminator, and identifying the gene type of the material according to the electrophoresis result. The gene type is a wild PCR product with the molecular weight of 395bp and 655bp, the PCR product of a mutation type (female sterile) has the molecular weight of 298 bp and 655 bp, and the PCR product of a hybridization type has the molecular weight of 298 bp, 395 bp and 663 bp (or 655bp). The invention has the effect of rapidly and effectively identifying the paddy female sterile gene FST.
Description
Technical field
The present invention relates to the method for a paddy female sterile gene FST Molecular Identification, belong to agricultural biological technical field, more particularly belong to the breeding field.
Background technology
The breakthrough of crop breeding depends on the discovery of new distinguished germ plasm material, and wherein the most outstanding example is exactly the discovery and the utilization of the cytoplasmic male sterile line seventies in last century on the paddy rice.Male sterile is to become this period of time before to the mature pollen particle shape that function is arranged after the stamen original hase is differentiated to form; The process that is experienced in the vary such as Physiology and biochemistry, form is obstructed; Stamen just can not normal development, causes forming the phenomenon of great-hearted pollen.
Relative with male sterile is female sterile.The normal plants female organ is grown the growth (comprising that ovule is grown and blastular forms) that mainly refers to ovary; If female organ, ovule or egg cell development are obstructed or until abortion; Just show plant female sterile phenomenon, research has found that female sterile comprises recessive and two kinds of dominance female steriles.Up to now, the female sterile phenomenon is found in the kind of plant surplus paddy rice, wheat, rape, corn, oil tea, Chinese pine etc. 10 and is in the news.
The type of plant female-sterile mutant is a lot, does not break up the different steps of ovum abortion in blastular from female organ, all can produce abortion female sterile type in various degree.According to the characteristics and the female organ type of abortion, can female sterile be divided into 3 types.1. female organ does not break up or the carpel of female organ becomes stamen and masculine fully.Though 2. have female organ (divide again have or do not have style and column cap), ovule is grown even megaspore impaired development and do not have normal blastular.3. have normal female organ blastular, but abortion finally takes place in egg apparatus even ovum.On paddy rice, female sterile appears at distant hybirdization or Hybrids of Indica and Japonica offspring mostly, and is the quantitative character of controlled by multiple genes, and the blastular abortion is the main type of paddy female sterile.
At present, some and blastular and the relevant gene of floral organ growth have been identified and have located.Find on the Arabidopis thaliana that sin1 is relevant with female fertility, the sin-plant integument heteroplasia of undergoing mutation, thus cause the prosoplasia of megasporocyte.Bel11, Superman gene also are the genes involveds of integument normal development.In addition, discover MADS-box gene family coding and the relevant key protein of plant floral organ tissue development.All express in each stage that ovule is grown like ZAG2 on the corn and ZMM1, maybe be relevant with the ovule normal development.On paddy rice, find that OsMADS13, OsMADS21 are relevant with the paddy rice ovary development with OsMADS30.
The research of paddy female sterile helps understanding the growth of plant female organ and the function of genes involved; Inquire into the not affine reason of indica-japonica hybrid; Be the utilization of inter-subspecific heterosis, set up new heterosis utilization pattern etc. and have important theory and practice significance.Paddy female complete sterility cryptic mutant G39 is an ideal research material, is that sporophyte is sterile in the female sterile heredity.Discover that further the sterile gene that G39 carries is a new female complete sterility recessive gene (fst); Be positioned on paddy rice second karyomit(e); The gene (FST) of corresponding wild type plant is the MADS-Box gene family; The transcriptional regulator that FST gene (DQ004266) coding is relevant with the blastular normal development, the 8bp base in this gene M ADS-Box zone (5 '-TCGAAGAG-3 ') disappearance causes afunction, formation female sterile fst.The floral organ of fst two mutants is grown normal, and flower pesticide and pollen development are normal.Paddy female sterile material fst can be easy to obtain through the conventional hybridization breeding, and relevant departments of Yunnan Prov Agriculture University are for sale.But its female sterile gene detection is had only through cytology, embry observation or hybridization checking.These two kinds of detection methods need material is planted down, treat could to observe or hybridize when the plant ovule is grown, and the time cycle was about 90 days, and is loaded down with trivial details on the method.Therefore, also there is not perfect, the quick method of effectively selecting to identify female sterile gene FST of a kind of technology at present.
Summary of the invention
The present invention overcomes the deficiency that does not have female sterile gene (FST) authentication method at present, provide a kind of accurately, molecular assay method fast and efficiently.
Technical scheme of the present invention is to get material blade to be identified to extract rice total dna; Auele Specific Primer Gf1, Gr1, Jf1 and Jr1 with FST carry out the PCR reaction; Add appearance 6 μ l on the loading buffer mixing of 3 μ l, with 2% sepharose, 1 * TAE buffer, 125V electrophoresis 40min; Detect on the ultraviolet transilluminator, according to electrophoresis result expert evidence genotype.Genotype is that the PCR molecular weight of product of wild-type (+/+) is 395bp and 663bp; Genotype is that the PCR molecular weight of product of mutant (/-) is 298bp and 655bp, and mutant is the female sterile material; Genotype is that the PCR molecular weight of product of heterozygous (+/-) is 298bp, 395bp and 663bp (or 655bp).Effect purposes of the present invention can fast, effectively be differentiated paddy female sterile gene FST.
The reaction solution composition and the amplification program of primer sequence, pcr amplification reaction are following:
The Gf1 sequence is: AGGCAGGTGACATTCGCGGG
The Gr1 sequence is: GGCCGAGAGAAACTTAGCCGAAAACT
The Jf1 sequence is: AGTAGCCCTCCCCGCCTC
The Jr1 sequence is: AGCTAGTTCTTCATCCTTTCGCAGCAA
Reaction solution is formed: the reaction TV is 15ul, contains ddH
2O 10.16 μ l, 10 * buffer (contains Mg
2+) 1.5 μ l, dNTP (2.5mM) 1.2 μ l, each 0.12 μ l of 4 primers (50pmol), Takara TaqHS (5U/ μ l) 0.08 μ l, template DNA (100ng/ μ l) 0.5 μ l,
Amplification program: 94 ℃ of 5min;
94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min, 30 circulations;
72℃5min。
The invention has the beneficial effects as follows the new paddy female complete sterility two mutants that G39 finds for this seminar, its male organs are grown normal, can form great-hearted pollen.In this female-sterile mutant fst heredity is that sporophyte is sterile, and the abortion type is the blastular abortion.The gene (FST) of corresponding wild type plant is the MADS-box gene family also, but is different from rice Os MADS13, OsMADS21 and the OsMADS30 that has reported.Sequence alignment research shows, the transcriptional regulator that paddy rice FST gene (DQ004266) coding is relevant with the blastular normal development, and the 8bp base in this gene M ADS-Box zone (5 '-TCGAAGAG-3 ') disappearance causes afunction, formation female sterile fst.
Based on paddy female sterile wild-type and the two mutants sequence difference at the FST gene, Auele Specific Primer Gf1, Gr1, Jf1 and the Jr1 of design FST provide strong instrument for quick and precisely differentiating paddy rice fst gene.Be embodied in: when (1) is made primer and differentiated rice material with Auele Specific Primer Gf1, Gr1, Jf1 and the Jr1 of FST; Owing to be the sequence of having used female sterile gene self, therefore differentiate that accuracy rate is 100%, and the time spent is no more than 5 days; Differentiate material extraction DNA, PCR reaction and electrophoresis get final product; (2) because discrimination method is simple, differentiate the restriction that does not receive season and material quantity, the complicated procedures of having avoided the field economical character to identify, the discrimination method simple economy identifies that a material or individuality only need the about 1-2 of Renminbi unit.
Description of drawings
Fig. 1 makes primer with Gf1, Gr1, Jf1 and Jr1, and through pcr amplification, the resulting electrophoretogram of agarose gel electrophoresis, wherein swimming lane 1,4 is wild-type (female educating), and 2 is heterozygous, and 3,5,6 is mutant (female sterile).
The practical implementation case
Embodiment is differentiated and Molecular Identification method expert evidence genotype with morphological observation, test cross checking respectively several colonies individual plant for making up different hereditary segregating populations, compares the several method identification result, investigates the safety of molecule differential method.
Embodiment one
Derive from Ansanbyeo/G39 hybridization F2 for colony, totally 220 individual plants respectively with the genotype of embryo morphology observation and Molecular Identification method expert evidence, compare two kinds of method identification results to 220 individual plants, investigate the safety of molecule differential method.
Embryo morphology is learned when observing, and strips the blastular after blooming, and the LUTARALDEHYDE stationary liquid is fixed (1.4% LUTARALDEHYDE, 2% Paraformaldehyde 96; 50mM PIPES, PH 7.20) fixing, PIPES rinsing, ethanol dewater step by step (10%-100%); Paraffin embedding, section (2um), dyeing (0.5% toluidine blue+0.1%Na
2CO
3), opticmicroscope is inspection down.
During Molecular Identification, get material blade to be identified, extract rice total dna; Auele Specific Primer Gf1, Gr1, Jf1 and Jr1 with FST carry out the PCR reaction; Add appearance 6 μ l on the loading buffer mixing of 3 μ l, with 2% sepharose, 1 * TAE buffer, 125V electrophoresis 40min; Detect on the ultraviolet transilluminator, according to electrophoresis result expert evidence genotype.Genotype is that the PCR molecular weight of product of wild-type (+/+) is 395bp and 663bp; Genotype is that the PCR molecular weight of product of mutant (/-) is 298bp and 655bp, and mutant is the female sterile material; Genotype is that the PCR molecular weight of product of heterozygous (+/-) is 298bp, 395bp and 663bp (or 655bp).Effect purposes of the present invention can fast, effectively be differentiated paddy female sterile gene FST.
The reaction solution composition and the amplification program of primer sequence, pcr amplification reaction are following:
The Gf1 sequence is: AGGCAGGTGACATTCGCGGG
The Gr1 sequence is: GGCCGAGAGAAACTTAGCCGAAAACT
The Jf1 sequence is: AGTAGCCCTCCCCGCCTC
The Jr1 sequence is: AGCTAGTTCTTCATCCTTTCGCAGCAA
Reaction solution is formed: the reaction TV is 15ul, contains ddH
2O 10.16 μ l, 10 * buffer (contains Mg
2+) 1.5 μ l, dNTP (2.5mM) 1.2 μ l, each 0.12 μ l of 4 primers (50pmol), Takara TaqHS (5U/ μ l) 0.08 μ l, template DNA (100ng/ μ l) 0.5 μ l,
Amplification program: 94 ℃ of 5min;
94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min, 30 circulations;
72℃?5min。
The result sees table 1, can be found out by table 1, derives from Ansanbyeo/G39 hybridization F
2In 220 individual plants of colony, embryo morphology is learned to observe and is found that wherein 165 individual plant blastulars are grown normally, and the genotype that its molecule is differentiated is the pure and mild or dominance heterozygosis of dominance; 55 individual plant blastular heteroplasia, the genotype that its molecule is differentiated is that recessiveness is isozygotied.Show that the evaluation of Molecular Identification and embryo morphology is in full accord, the Molecular Identification accuracy rate is 100%, and the molecule discriminating can be distinguished, and dominance is pure and mild, the genotype of two kinds of plant of dominance heterozygosis.
Table 1 supplies examination Ansanbyeo/G39 hybridization F
2The plant genotype of colony and blastular abortion
Embodiment two
Derive from Sangambyeo/G39 hybridization F2 for colony, totally 340 individual plants respectively with the genotype of hybridization checking and Molecular Identification method expert evidence, compare two kinds of method identification results to 340 individual plants, investigate the safety of molecule differential method.
During the hybridization checking, when paddy rice blooms, get fresh pollen to its column cap pollination, bagging.Each plant bagging one fringe, two weeks were investigated solid situation.
During Molecular Identification, get material blade to be identified, extract rice total dna; Auele Specific Primer Gf1, Gr1, Jf1 and Jr1 with FST carry out the PCR reaction; Add appearance 6 μ l on the loadingbuffer mixing of 3 μ l, with 2% sepharose, 1 * TAE buffer, 125V electrophoresis 40min; Detect on the ultraviolet transilluminator, according to electrophoresis result expert evidence genotype.Genotype is that the PCR molecular weight of product of wild-type (+/+) is 395bp and 663bp; Genotype is that the PCR molecular weight of product of mutant (/-) is 298bp and 655bp, and mutant is the female sterile material; Genotype is that the PCR molecular weight of product of heterozygous (+/-) is 298bp, 395bp and 663bp (or 655bp).Effect purposes of the present invention can fast, effectively be differentiated paddy female sterile gene FST.
The reaction solution composition and the amplification program of primer sequence, pcr amplification reaction are following:
The Gf1 sequence is: AGGCAGGTGACATTCGCGGG
The Gr1 sequence is: GGCCGAGAGAAACTTAGCCGAAAACT
The Jf1 sequence is: AGTAGCCCTCCCCGCCTC
The Jr1 sequence is: AGCTAGTTCTTCATCCTTTCGCAGCAA
Reaction solution is formed: the reaction TV is 15ul, contains ddH
2O 10.16 μ l, 10 * buffer (contains Mg
2+) 1.5 μ l, dNTP (2.5mM) 1.2 μ l, each 0.12 μ l of 4 primers (50pmol), Takara TaqHS (5U/ μ l) 0.08 μ l, template DNA (100ng/ μ l) 0.5 μ l,
Amplification program: 94 ℃ of 5min;
94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min, 30 circulations;
72℃5min。
The result sees table 2, can be found out by table 2, derives from 340 individual plants of Sangambyeo/G39 hybridization F2 colony, and hybridization can have 255 by blocky individual plant, and the genotype that its molecule is differentiated is the pure and mild or dominance heterozygosis of dominance; 55 individual plants are shaky, and the genotype that its molecule is differentiated is that recessiveness is isozygotied.Show that Molecular Identification is in full accord with the hybridization evaluation, the Molecular Identification accuracy rate is 100%, and the molecule discriminating can be distinguished, and dominance is pure and mild, the genotype of two kinds of plant of dominance heterozygosis.
Table 2 supplies examination Sangambyeo/G39 hybridization F
2Solid and the plant genotype of the bagging of colony
Embodiment three
50 parts of 20 parts of male sterility of rice strains and various paddy rice resources, 70 parts of materials are female Fertile material, with the genotype of Molecular Identification method expert evidence, investigate the safety of molecule differential method.
During Molecular Identification, get material blade to be identified, extract rice total dna; Auele Specific Primer Gf1, Gr1, Jf1 and Jr1 with FST carry out the PCR reaction; Add appearance 6 μ l on the loading buffer mixing of 3 μ l, with 2% sepharose, 1 * TAE buffer, 125V electrophoresis 40min; Detect on the ultraviolet transilluminator, according to electrophoresis result expert evidence genotype.Genotype is that the PCR molecular weight of product of wild-type (+/+) is 395bp and 663bp; Genotype is that the PCR molecular weight of product of mutant (/-) is 298bp and 655bp, and mutant is the female sterile material; Genotype is that the PCR molecular weight of product of heterozygous (+/-) is 298bp, 395bp and 663bp (or 655bp).Effect purposes of the present invention can fast, effectively be differentiated paddy female sterile gene FST.
The reaction solution composition and the amplification program of primer sequence, pcr amplification reaction are following:
The Gf1 sequence is: AGGCAGGTGACATTCGCGGG
The Gr1 sequence is: GGCCGAGAGAAACTTAGCCGAAAACT
The Jf1 sequence is: AGTAGCCCTCCCCGCCTC
The Jr1 sequence is: AGCTAGTTCTTCATCCTTTCGCAGCAA
Reaction solution is formed: the reaction TV is 15ul, contains ddH
2O 10.16 μ l, 10 * buffer (contains Mg
2+) 1.5 μ l, dNTP (2.5mM) 1.2 μ l, each 0.12 μ l of 4 primers (50pmol), Takara TaqHS (5U/ μ l) 0.08 μ l, template DNA (100ng/ μ l) 0.5 μ l,
Amplification program: 94 ℃ of 5min;
94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min, 30 circulations;
72℃5min。
The result shows that 70 parts of material PCR molecular weight of product are 395bp and 663bp, and genotype is a wild-type, and female educating shows that the Molecular Identification accuracy rate is 100%.
Table 3 is that molecular assay method compares with fetology, hybridization verification method.
The comparison of the different authentication methods of table 3
Can be found out that by table 1～table 3 when using Gf1, Gr1, Jf1 and Jr1 to differentiate female sterile gene FST as primer, accuracy rate is more than 100%, and the molecular engineering appraisal cost is low, required time is short, can obviously shorten breeding process.
Claims (2)
1. the method for a paddy female sterile gene FST Molecular Identification the steps include:
1) material blade to be identified is extracted rice total dna;
2) Auele Specific Primer Gf1, Gr1, Jf1, the Jr1 with female sterile gene FST carries out the PCR reaction;
The Gf1 sequence is: AGGCAGGTGACATTCGCGGG
The Gr1 sequence is: GGCCGAGAGAAACTTAGCCGAAAACT
The Jf1 sequence is: AGTAGCCCTCCCCGCCTC
The Jr1 sequence is: AGCTAGTTCTTCATCCTTTCGCAGCAA
3) PCR reaction back adds the loading buffer of 3 μ l, and appearance 6 μ l on the mixing are with 2% sepharose that contains EtBr0.1ug/ml, 1 * TAE buffer, 125V electrophoresis 40min;
4) on ultraviolet transilluminator, detect pcr amplification product and electrophoresis result;
When 5) making primer with Gf1, Gr1, Jf1 and Jr1, genotype is that the PCR molecular weight of product of wild-type (+/+) is 395bp and 663bp; Genotype is that the PCR molecular weight of product of mutant (/-) is 298bp and 655bp; Genotype is that the PCR molecular weight of product of heterozygous (+/-) is 298bp, 395bp and 663bp or 655bp;
6) the pcr amplification product molecular weight is that the paddy gene type (/-) of 298bp and 655bp is the female sterile material.
2. the method for a kind of paddy female sterile gene FST Molecular Identification according to claim 1 is characterized in that the reaction solution composition and the amplification program of said pcr amplification reaction is:
Reaction solution is formed: the reaction TV is 15ul, contains ddH
2O 10.16 μ l, 10 * buffer contains Mg2+1.5 μ l, dNTP 2.5mM1.2 μ l, 4 each 0.12 μ l of primer 50pmol, Takara Taq HS5U/ μ l 0.08 μ l, template DNA 100ng/ μ l 0.5 μ l;
Amplification program: 94 ℃ of 5min;
94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min, 30 circulations;
72℃5min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100949877A CN101654703B (en) | 2009-09-18 | 2009-09-18 | Method for identifying paddy female sterile gene FST molecule |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100949877A CN101654703B (en) | 2009-09-18 | 2009-09-18 | Method for identifying paddy female sterile gene FST molecule |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101654703A CN101654703A (en) | 2010-02-24 |
| CN101654703B true CN101654703B (en) | 2012-08-22 |
Family
ID=41709154
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100949877A Expired - Fee Related CN101654703B (en) | 2009-09-18 | 2009-09-18 | Method for identifying paddy female sterile gene FST molecule |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101654703B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112772404B (en) * | 2020-12-31 | 2021-07-27 | 云南农业大学 | Breeding method of rice female nuclear sterility restoring line |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1226375A (en) * | 1999-03-23 | 1999-08-25 | 中国水稻研究所 | Method for quickly determining purity of hybrid seed and sterility line of hybrid rice |
| CN101225442A (en) * | 2007-12-14 | 2008-07-23 | 武汉大学 | Method for detecting three-line hybrid rice honglian-type new restoring gene by using molecule mark sensing |
-
2009
- 2009-09-18 CN CN2009100949877A patent/CN101654703B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1226375A (en) * | 1999-03-23 | 1999-08-25 | 中国水稻研究所 | Method for quickly determining purity of hybrid seed and sterility line of hybrid rice |
| CN101225442A (en) * | 2007-12-14 | 2008-07-23 | 武汉大学 | Method for detecting three-line hybrid rice honglian-type new restoring gene by using molecule mark sensing |
Non-Patent Citations (2)
| Title |
|---|
| Ludovico Dreni等.The D-lineage MADS-box gene OsMADS13 controls ovule.《The Plant Journal》.2007,第52卷690-699页. * |
| 朱建荣等.滇型水稻细胞质雄性不育恢复基因Rf-D1(t)的克隆与遗传特性分析.《分子植物育种》.2009,第7卷(第4期),671-678页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101654703A (en) | 2010-02-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Brink | Paramutation at the R locus in maize | |
| Brink | A genetic change associated with the R locus in maize which is directed and potentially reversible | |
| Lu et al. | Molecular diversity and genome structure in modern sugarcane varieties | |
| Kotani et al. | The LOSS OF APOMEIOSIS (LOA) locus in Hieracium praealtum can function independently of the associated large‐scale repetitive chromosomal structure | |
| CN104894144B (en) | A kind of Oryza sativa L. CYP704B2 gene mutation body and method for identifying molecules thereof and application | |
| CN104342450B (en) | The method for cultivating corn haploid induction line of the corn haploid-induction higher than corn haploid induction line CAU5 | |
| CN105002191B (en) | A kind of Oryza sativa L. CYP704B2 gene mutation body and method for identifying molecules thereof and application | |
| CN107787181A (en) | Hybrid seed production and associated materials and method are improved by outcrossing rate higher in cytoplasmic male sterility rice | |
| CN106434708A (en) | Rice MSP1 gene mutant, and molecular identification method and application thereof | |
| CN109207513A (en) | The application of DCM1 albumen and its encoding gene in regulation male plant fertility | |
| CN111944921B (en) | Application of brassica napus BnaA08.PDS3 gene in breeding of color traits of brassica napus petals | |
| CN103333953A (en) | Method for identification of purity of two-line hybrid rice seed | |
| WO2021000936A1 (en) | USE OF OSDGD2β GENE IN CULTIVATION OF MALE STERILE RICE MATERIAL | |
| Plewa | Specific-locus mutation assay in Zea may: A report of the US environmental protection agency Gene-Tox program | |
| CN103798132B (en) | A kind of method of scale initiative wheat alien translocation line | |
| AU5975796A (en) | Use of the indeterminate gametophyte gene for maize improvement | |
| CN107236810B (en) | Maize male nuclear sterility gene, molecular marker and application thereof | |
| CN101654703B (en) | Method for identifying paddy female sterile gene FST molecule | |
| Wang et al. | A transposon‐mediated reciprocal translocation promotes environmental adaptation but compromises domesticability of wild soybeans | |
| KR101871806B1 (en) | Markers for discriminating genotyping restorer gene involved in male sterility of Brassica napus and discriminating method using the same | |
| Glover et al. | Searching for tagged male-sterile mutants of Arabidopsis | |
| Guan et al. | Genetic analysis and population structure of wild and cultivated wishbone flower (Torenia fournieri Lind.) lines related to specific floral color | |
| Abd El-Twab et al. | Visualization of genomic relationships in allotetraploid hybrids between Chrysanthemum lavandulifolium X C. chanetii by fluorescence in situ hybridization and genomic in situ hybridization | |
| Abd El-Twab et al. | Isolation of chromosomes and mutation in the interspecific hybrid between Chrysanthemum boreale and C. vestitum using fluorescence in situ hybridization and genomic in situ hybridization | |
| CN116622883B (en) | Specific probe, primer, kit and method for identifying rice H23 transformant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120822 Termination date: 20160918 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |