CN101633954A - Community chip for analyzing community structure and dynamic variation of activated sludge microbe - Google Patents
Community chip for analyzing community structure and dynamic variation of activated sludge microbe Download PDFInfo
- Publication number
- CN101633954A CN101633954A CN200910070014A CN200910070014A CN101633954A CN 101633954 A CN101633954 A CN 101633954A CN 200910070014 A CN200910070014 A CN 200910070014A CN 200910070014 A CN200910070014 A CN 200910070014A CN 101633954 A CN101633954 A CN 101633954A
- Authority
- CN
- China
- Prior art keywords
- community
- chip
- gene
- dna
- synthetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a community chip for analyzing community structure and dynamic variation of activated sludge microbes; the community chip is a DNA probe for detecting bacteria which is fixed on materials such as glass, silicon slice or a nylon membrane and the like; the probe is of a nucleotide sequence stated in SEQ ID NO.1-SEQ IDNO.66; the OTU which the probe aims at and the relation which represents clone sub Genbank accession number, all OTU nearest source bacterial strain and the similarity thereof are shown in table 1; the community chip is used for analyzing community structure and dynamic variation of the activated sludge microbes and is characterized by timing, sensitivity, fastness, accuracy, high efficiency, obtaining quantity of bacterial group variable information and the like. The community chip can quickly analyze community structure of the activated sludge microbes; the same chip can detect 57 OUTs which can represent different classification levels (category, class, order, family and genus).
Description
Technical field
The present invention relates to a kind of biochip, particularly relate to the community chip that is used to analyze active sludge microorganism structure of community and dynamic change.
Background technology
Active sludge is a kind of ten minutes complex environment sample, the ecosystem that it is made up of microorganisms such as bacterium and microfaunas such as protozoon, metazoan, therefore, active sludge has characteristics such as the flora structure is various, flora function complexity, and research active sludge structure of community and dynamic change thereof then have crucial meaning for understanding active sludge flora distribution and function relationship, environmental factors change to the influence of its microbial ecological etc.
Traditional microbiological analysis measuring method, comprise the observation of microscope microbial morphology, most probable counting process, selective medium counting, purebred separation and Physiology and biochemistry evaluation etc., these methods all exist selectivity strong in environmental sample research, defectives such as workload is big and not all microorganism can both grow on substratum, therefore, the kind and the quantity that can not objectively reflect complicated flora comprehensively, according to investigations, culture method can only separation and Culture to the bacterial strain of certain complicated flora 0.1%-10%.In recent years, some biomarkers that people begin using microbe biological chemistry classification comprise that respiratory chain ubiquinone, lipid acid wait and carry out purebred microbiological analysis, but because the complicacy of environmental sample, such technology still is not suitable for the environmental sample flora analysis be made up of various bacteria.
At present, the research of environmental sample microorganism species mainly realizes by the dna fingerprinting technology, comprise: denaturing gradient gel electrophoresis (Denaturing Gradient Gel Electrophoresis, DGGE), rrna DNA amplification restriction fragment is analyzed (Amplified ribosomal DNA restriction analysis, ARDRA), random amplification polymorphism DNA (randomamplified polymorphic DNA, RAPD), restriction fragment length polymorphism is analyzed (Restriction FragmentLength Polymorphism, RFLP) etc., these technology respectively have relative merits, application is in various degree all arranged in the cluster analysis of varying environment sample microbial bacteria, as Smit E. etc. utilize the ARDRA technical Analysis copper staining to soil bacteria group structure and multifarious influence; The diversity of mud flora in Susanne L. etc. has then utilized the DGGE technical study denitrogenation bio-reactor; Application DGGE methods such as Chai Lihong have been carried out rapid detection to bacterium diversity in adjacent two salt lakes, Qinghai, and Rima B.Franklin etc. utilizes RAPD relatively to distinguish the microorganism species of different water samples.The relative cultured method of dna fingerprinting technology fast, simply, the variation and the state thereof that can reflect environmental sample flora microorganism by dna fingerprint difference atlas analysis, but still there is certain problem in this method, mainly contains: can not provide flora about the concrete concrete details of forming and changing, poor repeatability etc.
In recent years, also utilize system's oligonucleotide chip that environmental samples such as compost, soil, active sludge, uranium pollution aquifer have been carried out microorganism detection, the dynamic (dynamical) report of flora, contain 297 as utilizations such as DeSantis, the superchip of 851 16S rDNA probes is analyzed the microbe species of three kinds of environmental samples (water, soil, aerosol), though the result shows this chip technology and can not identify novel bacterial, can obtain more species diversity than clone's sequence measurement when the analysis environments sample.Though this technology has overcome the dna fingerprinting technology to a certain extent and tradition is cultivated or the defective of cloning and sequencing method, but because but relevant research all is to be based upon on the basis of limited culturing micro-organisms, therefore the flora kind of information that provides is few, can not reflect environmental sample microbial bacteria group structure comprehensively, more crucial is that it can not in time reflect the variation of flora.
Activity classification unit (OTU, operational taxonomic units) belongs to a kind of classification, between belonging to and planting, general criteria for classification is that clone subsequence similarity is belonged to same door, guiding principle, order, section, genus, OUT respectively greater than 80%, 85%, 90%, 92%, 94%, 97% respectively at present.
Up to now, Shang Weijian utilizes clone's design gene chip probes that 16S rRNA library construction obtains and preparation to be used to analyze the report of the community chip of active sludge microorganism structure of community and dynamic change.
Summary of the invention
The objective of the invention is to overcome the active sludge microorganism structure of community that exists in the prior art and the deficiency of Dynamic Variation Analysis technology thereof, a kind of community chip that can be used to analyze active sludge microorganism structure of community and dynamic change responsive, fast that contains much information is provided.
Technical scheme of the present invention is summarized as follows:
A kind of community chip that is used to analyze active sludge microorganism structure of community and dynamic change, the dna probe that it is characterized in that fixed test bacterium on materials such as slide or silicon chip or nylon membrane, described probe is the described nucleotide sequence of sequence table SEQ ID NO.1-SEQ ID NO.66, described probe at OTU and the relation such as the table 1 of representative clone sub-Genbank accession number, each OTU nearest source bacterial strain and similarity thereof;
Table 1:
Described OTU is the activity classification unit.
Utilize community chip of the present invention to analyze active sludge microorganism structure of community and dynamic change, have in good time, sensitive, fast, accurately, efficient and obtain characteristics such as flora change information amount is big.The present invention can real-time analysis active sludge microorganism structure of community, and same chip can detect 57 kinds of OTUs of the different taxonomical hierarchies of representative (door, guiding principle, order, section, genus) simultaneously.
Description of drawings
Fig. 1 is the gene structure synoptic diagram of target gene 16S rDNA;
Fig. 2 is a probe arranged synoptic diagram of the present invention;
Fig. 3 is the specificity collection of illustrative plates of each OTU;
Fig. 4 is the chip hybridization collection of illustrative plates of the present invention under the different C/N.
Embodiment
The present invention considers the readily degradable of killed bacterial RNA, therefore by extract RNA carry out RT-PCR then more can be in time and the dynamic change of the reflection flora of sensitivity, and avoid the interference of dead bacterial nucleic acid.In order more fully to reflect the composition of active sludge microorganism flora, the present invention utilizes each activity classification unit (OTU of clone's design of active sludge 16S rRNA gene library, operational taxonomic units) (belongs to a kind of classification, between belonging to and planting, general criteria for classification is respectively greater than 80% with clone subsequence similarity at present, 85%, 90%, 92%, 94%, 97% belongs to same door respectively, guiding principle, order, section, belong to, OTU) specific probe of representative clone son, and be fixed on slide according to certain array or materials such as silicon chip or nylon membrane are formed community chip of the present invention by specificity DNA probing needle with each OTU.
A kind of technology that is used for analyzing the community chip of active sludge microorganism structure of community and dynamic change of the present invention is utilized the target gene of two pairs of universal primers amplifications and the corresponding bacterium of mark different activities mud sample, behind microflora's chip hybridization of amplified production and normal mature active sludge, can detect with analyze different operational conditionss or functional status mud sample in the variation of bacterial species.
Below in conjunction with specific embodiment, the present invention is further illustrated.
The extraction of active sludge RNA
Get a certain amount of pretreated mud sample and add N,O-Diacetylmuramidase (20mg/mL) behind 37 ℃ of effect 10min, add 1mL TRIzol (being trade name), behind the vortex oscillation 5min, the centrifugal 10min of 10000r/min; Get supernatant and add 200 μ L chloroforms, behind the vortex oscillation 15s, the centrifugal 10min of 10000r/min; Get supernatant and add the equal-volume Virahol, place 20min for-20 ℃; The centrifugal 10min of 10000r/min abandons supernatant; Add 75% washing with alcohol post precipitation, the centrifugal 5min of 10000r/min abandons supernatant and air-dry precipitation; Through a small amount of diethylpyrocarbonate (DEPC) treating water dissolving nucleic acid post precipitation, add deoxyribonuclease I (deoxyribonuclease pollution) and act on 15min in 37 ℃; Further adopt RNA purification kit purifying RNA.Wherein, all consumptive materials all will be handled and autoclaving through DEPC.
The acquisition of active sludge flora bacterial strain 16S to be analyzed rRNA gene fragment
(1) utilize cDNA test kit (Tiangen, China) to obtain the total cDNA of active sludge;
(2) adopt bacterium universal primer 27F (5 '-AGAGTTTGATCCTGGCTCAG-3 ') and 1492R
Bacterial 16 S rDNA fragment among (5 '-TACCTTGTTACGACTT-3 ') total cDNA that directly increases;
(3) the PCR product adopts sepharose to reclaim test kit (Takara, China) after 1% agarose gel electrophoresis detects and reclaims the purpose fragment;
(4) be transformed among the E.coli DH5 α by the 16S rDNA fragment of TA clone technology with amplification, 450 positive colony of blue hickie screening picking are set up 16S rDNA clone library;
(5) adopt the RFLP method to cloning son analysis, select enzyme and cut the different recon of band spectrum and check order;
(6), from public databases such as GenBank, access the 16S rRNA gene order of the higher relevant bacterial strain of similarity with the Blast search utility according to sequencing result.Adopt DNAMAN software to carry out the multisequencing comparison, with clone subsequence similarity greater than 97% belong to same activity classification unit (OTU) and the representative sequence of different OTU be submitted to the GenBank database and obtain nucleotide sequence registration accession number.
(7) select representative clone of each OTU to be research object, with pMD18-T carrier universal primer (BcaBEST PrimerRV-M:5 '-GAGCGGATAATTTCACACAGG-3 ' and BcaBEST Primer
M13-47:5 '-CGCCAGGGTTTTCCCAGTCACGA-3 ') is upstream primer and downstream primer, utilizes PCR to obtain active sludge flora bacterial strain 16S to be analyzed rRNA gene fragment.
The design of universal primer
With 16S rRNA gene is target gene (Fig. 1)
(1) adopts DNAMAN software, each OTU representative clone of active sludge sample 16S rRNA library is carried out sequence alignment.Obtain the base sequence comparison chart;
(2) according to the base sequence comparison chart, at 16S rRNA gene conservative district design universal primer;
According to the regional presence bit point of each OTU representative variation of design of primers principle and active sludge, the 860-1130 zone (B zone) of selecting to contain the 410-600bp zone (a-quadrant) of V3 variable region respectively and containing V5, V6 variable region is the pcr amplification zone.Described primer is 2 pairs, is respectively:
| Numbering | Sequence (5 '-3 ') | The region |
| ??A1 | ??ACTCCTACGGGACGCAG | ??407-423bp |
| ??A2 | ??CTGCTGCTGGCACGGAGTTAG | ??576-596bp |
| ??B1 | ??AGGATTAGATACCCTGGTAGTC | ??853-874bp |
| ??B2 | ??CTGACGACAGCCATGCAG | ??1120-1137bp |
The design of probe
Group's biochip technology is a kind of anti-phase solid-phase hybridization technology, and its flora analytic function mainly relies on institute's fixed particular probe on the chip, and the sequence of probe and kind are the keys of preparation gene chip.
1) adopts DNAMAN software, each OTU representative clone of active sludge sample 16S rRNA library is carried out sequence alignment.Obtain the base sequence comparison chart;
2) according to the base sequence comparison chart, at V3, V5 and the V6 zone design probe of 16S rRNA gene;
After designing each OTU probe, candidate sequence is compared in the GenBank database, filter out specificity probe and add disconnected arm molecule while 5 ' terminal amino group modification of forming by 15 T at its 5 ' end preferably.
Be used to analyze the preparation of the community chip of active sludge microorganism structure of community and dynamic change
The dna probe of fixed test bacterium on materials such as slide or silicon chip or nylon membrane, described probe is the described nucleotide sequence of sequence table SEQ IDNO.1-SEQ ID NO.66, described probe at OTU and the relation such as the table 1 of representative clone sub-Genbank accession number, each OTU nearest source bacterial strain and similarity thereof;
1. probe is arranged
See Fig. 2, in Fig. 2:
1,2 OTU2; 3 OTU3; 4,5 OTU5; 6 OTU7,12; 7 OTU8,9; 8,9 OTU13; 10 OTU 16; 11,44 OTU17; 12 OTU18; 13 OTU22; 14 OTU30,31,32; 15 OTU35; 16 OTU36; 17,18 OTU37,39; 19 OTU40; 20 OTU43; 21 OTU44,46; 22 OTU45; 23,24 OTU47; 25,26 OTU48; 27 OTU50; 28,56 OTU51; 29 OTU52; 30 OTU53,54; 31 OTU55; 32 OTU59,60; 33,59 OTU61; 34,60 OTU62,65; 35 OTU63; 36 OTU66; 37,63 OTU68; 38,39 OTU69; 40,64 OTU70; 41 OTU11,71; 42 OTU72; 43 OTU73; 45 OTU20; 46OTU 23; 47 OTU32; 48 OTU 22,34; 49, OTU38; 50,51 OTU39; 52 OTU41; 53 OTU42; 54 OTU 44,45,46; 55 OTU49; 57 OTU56; 58 OTU57,58; 61,62 OTU67; 65,66 positive controls; 67, negative control (50%DMSO).
2. the preparation process of gene chip
Adopt 50% dmso solution probe, making its final concentration is 1 μ g/ μ L, transfers to successively in 384 orifice plates then, is placed on the gene chip sample applying instrument (Spotarray 72).Start the control software of Spotarray, working procedure, with in the point sample district of each probe points on the slide of aldehyde radicalization, the distance between the point is 5mm according to arrangement mode shown in Figure 2, every kind of probe repeats point sample 3 times.To put under the excellent chip room temperature after the dried overnight,, can use with behind crosslinked 2 times of crosslinked instrument (the UVPcl-2000M ultraciolet Crosslinker) 600J at 45 ℃ baking oven inner drying 2h.
The preparation of fluorescence testing sample
1.cDNA article one chain is synthetic
Adopt random primer to obtain the total cDNA of active sludge sample.
The RT reaction system:
5×AMV?buffer??????????4μL
Random primer (10pmol/ μ L) 1 μ L
dNTP(10pmol/μL)???????2μL
AMV(5U/μL)????????????1μL
Rnase inhibitor (40U/ μ L) 0.5 μ L
Template (RNA) 5 μ L
Adding DEPC treating water to reaction system cumulative volume is 20 μ L.
Reaction conditions: behind 42 ℃ of extension 60min, handle 10min for 72 ℃.
2. the fluorescence labeling method of sample
The fluorescent mark of sample adopts the asymmetric PCR method.Asymmetric PCR is finished by two-wheeled.
The 1st to take turns reaction system as follows.Treat the 1st take turns reaction and finish after, 200 μ LPCR products are adopted PCR product purification test kit purifying and are settled to 50 at last, the concrete grammar by specification carries out.
The PCR reaction system:
A1 or B1 (10pmol/ μ L) 1 μ L
A2 or B2 (10pmol/ μ L) 1 μ L
Taq?mix???????????????25μL
Template (the 16S rRNA gene fragment of total cDNA or each OTU) 5 μ L or 1 μ L
Add ddH
2O to the reaction system cumulative volume be 50 μ L.
The PCR reaction conditions: 94 ℃, 5min; 94 ℃, 25s, 55 ℃, 25s, 72 ℃, 25s, 30 circulations; 72 ℃, 5min.
The 2nd to take turns reaction conditions the same.
The PCR reaction system:
A2 or B2 (10pmol/ μ L) 2 μ L
Taq???????????????????????0.3μL
dNTP(10mmol/L)????????????0.25μL
The dUTP of Cy3 mark (25nmol) 0.3 μ L
5×PCR?buffer?????????????5μL
Template (one behind the purifying taken turns the PCR product) 40 μ L
Add ddH
2O to the reaction system cumulative volume be 50 μ L.
Chip hybridization and detection
Pcr amplification product each 1 μ L and 8 μ L hybridization solution (Unihyb are taken turns in A, B zone two
TMTelechem company) after the mixing, selects probe array zone on the gene chip (slide glass has been put into hybridizing box and covered cover plate), note to leave bubble between cover plate and the slide glass, in box, add 100 μ L water simultaneously to keep humidity.Take out hybridizing box after tightening hybridizing box and putting into 50 ℃ of water-baths insulation 60min, take out slide, successively slide is put into respectively WBA (1 * SSC, 10%SDS), WBB (0.05 * SSC, 10%SDS), WBC (respectively washs 1min in 0.05 * SSC) elutriant.
Microflora's chip after adopting Genepix personal 4100A biochip scanner to hybridization carries out signal scanning and detection, interpretation of result software and version are Genepix Pro6.0, scanning resolution is 10 μ m, and scanning result saves as .GIFf and .jpg form respectively.The special hybridization collection of illustrative plates of each OTU is seen Fig. 3.
Be used to analyze the application of the community chip of active sludge microorganism structure of community and dynamic change
Different steps (realizes sludge bulking by changing influent quality C/N before will being used to analyze the community chip of active sludge microorganism structure of community and dynamic change and sludge bulking taking place, water inlet C/N is respectively 16 (I), 41 (II), 43 (III), 49 (IV), 52 (V)) mud PCR product hybridize flora changing conditions in the observation sludge bulking process with the different arrays on same the chip.Chip hybridization collection of illustrative plates of the present invention under the different C/N the results are shown in Figure 4.
Sequence table:
＜110〉Inst. of Hygienics and Environmental Medical Science, Academy of Military Medici
＜120〉be used to analyze the community chip of active sludge microorganism structure of community and dynamic change
<160>66
<210>1
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>1
tcctttctcg?caagagacac?20
<210>2
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>2
gtgaccgttc?cagagatg??18
<210>3
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>3
tatcgcggcc?tcagagat??18
<210>4
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>4
ttagcgaccg?actccgaa??18
<210>5
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>5
agaaatgacg?cgaaactagg?20
<210>6
<211>16
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(16)
<400>6
tgccacgacg?acttcc??16
<210>7
<211>15
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(15)
<400>7
cggtcgcggt?ttcca?15
<210>8
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>8
gcgtgttacc?cagagagatt?20
<210>9
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>9
atttggggtc?cacttcggt?19
<210>10
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(23)
<400>10
gtgatcgtag?gtttcagaaa?tgt?23
<210>11
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>11
tctaaatcct?ggtgcgagc??19
<210>12
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>12
ggaatcgtcc?cagcaatg??18
<210>13
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(22)
<400>13
tctggaatcc?tgaagagatt?tg??22
<210>14
<211>17
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(17)
<400>14
tcgttcggag?cagcaat??17
<210>15
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(22)
<400>15
ataggcaaga?aaagtacgag?aa?22
<210>16
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(21)
<400>16
cagagatgcc?tttcttcagt?t??21
<210>17
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(21)
<400>17
ctagaaaatg?caggaacctg?g??21
<210>18
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(22)
<400>18
gtcgaaaggt?cggggtgctc?tt??22
<210>19
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>19
gtatcgaccc?ctgctgtg????18
<210>20
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>20
tagacccttt?ccggggttta?20
<210>21
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(22)
<400>21
actcgtgcta?ttcctaggga?ta?22
<210>22
<211>17
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(17)
<400>22
tcgtaagagg?cctgtgg??17
<210>23
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>23
aaactattcc?gtcggttcg??19
<210>24
<211>24
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(24)
<400>24
taggtattgg?aatttaattt?cagt?24
<210>25
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(23)
<400>25
gggaatgatt?ttgaaagaag?tca?23
<210>26
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(21)
<400>26
gctgctagga?ggtaactttt?a?21
<210>27
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>27
agaaggtgtc?tgcggaaatg?20
<210>28
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>28
ggccgtaagg?tcagagtcc??19
<210>29
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>29
tgggtacaga?gatgtatcgt?20
<210>30
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>30
cgtgggtgaa?agctcatt??18
<210>31
<211>15
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(15)
<400>31
cgagtgccga?taccg?15
<210>32
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(21)
<400>32
tcacacacga?acttttcaga?g?21
<210>33
<211>15
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(15)
<400>33
cccatgaccg?gtcca??15
<210>34
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(22)
<400>34
gtgagtggat?atatcggaaa?cg?22
<210>35
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>35
caaccggaag?tgatgtga??18
<210>36
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>36
tgtagattga?caggactgg?19
<210>37
<211>17
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(17)
<400>37
gcgtctgaca?gcttctg?17
<210>38
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(23)
<400>38
ggtttgacat?ataccggaaa?cat?23
<210>39
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>39
ggggacttcc?acgttctc?18
<210>40
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>40
ctcattccac?gagatccg??18
<210>41
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>41
cgcaaggaaa?ctgtgaga??18
<210>42
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(23)
<400>42
cagggattaa?ctctatgaaa?gta?23
<210>43
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(22)
<400>43
gaaagggtaa?ttccgatcgt?ct?22
<210>44
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(21)
<400>44
ataagtcgtg?gtgaacatcc?a??21
<210>45
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>45
cagtctctcc?taatacgggg?20
<210>46
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>46
caggataata?ctctgcgtg??19
<210>47
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>47
aatctcccgg?gtgaatac??18
<210>48
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>48
cctttgggtt?aatacctcgg?20
<210>49
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(21)
<400>49
tcagggggga?atataatgac?t?21
<210>50
<211>17
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(17)
<400>50
gctaatatcc?ggcgcga??17
<210>51
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(21)
<400>51
ataagtgccg?gctaatatcc?g?21
<210>52
<211>25
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(25)
<400>52
gggtatattg?gttaagagct?gatat?25
<210>53
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>53
atccagccgg?ctaatacct??19
<210>54
<211>
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(25)
<400>54
atgttgatta?gagtggaaaa?ttaat?25
<210>55
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>55
gtctttctag?atcgtctg?18
<210>56
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>56
tacgtgtaga?agcctgatg?19
<210>57
<211>21
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(21)
<400>57
aactagagaa?aacccccctt?c??21
<210>58
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>58
ctgcggggaa?aattgaag?18
<210>59
<211>20
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>59
aacggttctg?cggaactaat??20
<210>60
<211>19
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(19)
<400>60
acgggattta?tcctggact??19
<210>61
<211>18
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(18)
<400>61
cctacgtgta?ggagcttg??18
<210>62
<211>
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(20)
<400>62
agaagcatct?atggtgtgta??20
<210>63
<211>16
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(16)
<400>63
tcctgcgggg?gggtat??16
<210>64
<211>17
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(17)
<400>64
gaagaagcgc?aagtgac??17
<210>65
<211>17
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(17)
<400>65
actcctacgg?gacgcag??17
<210>66
<211>22
<212>DNA
＜213〉synthetic
<220>
<221>gene
<222>(1)…(22)
<400>66
aggattagat?accctggtag?tc?22
Claims (1)
1. community chip that is used to analyze active sludge microorganism structure of community and dynamic change, the dna probe that it is characterized in that fixed test bacterium on materials such as slide or silicon chip or nylon membrane, described probe is the described nucleotide sequence of sequence table SEQ ID NO.1-SEQ IDNO.66, described probe at OTU and the relation such as the table 1 of representative clone sub-Genbank accession number, each OTU nearest source bacterial strain and similarity thereof;
Table 1:
Described OTU is the activity classification unit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910070014 CN101633954B (en) | 2009-08-03 | 2009-08-03 | Community chip for analyzing community structure and dynamic variation of activated sludge microbe |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910070014 CN101633954B (en) | 2009-08-03 | 2009-08-03 | Community chip for analyzing community structure and dynamic variation of activated sludge microbe |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101633954A true CN101633954A (en) | 2010-01-27 |
| CN101633954B CN101633954B (en) | 2011-11-09 |
Family
ID=41593291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910070014 Expired - Fee Related CN101633954B (en) | 2009-08-03 | 2009-08-03 | Community chip for analyzing community structure and dynamic variation of activated sludge microbe |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101633954B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586132A (en) * | 2011-12-14 | 2012-07-18 | 建设部水处理新技术产业化基地(天津港保税区水处理新技术产业化基地) | Sphingobacteria sp. for removing ammonia nitrogen from sewage at low temperature and separate culturing method thereof |
| CN106645046A (en) * | 2016-09-18 | 2017-05-10 | 北京工业大学 | Method for in-situ determination of intracellular nitric oxide (NO) of microbes in denitrified activated sludge |
| CN113077845A (en) * | 2021-04-13 | 2021-07-06 | 中国科学院大气物理研究所 | Analysis method for composition of atmospheric aerosol microbial community |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100386445C (en) * | 2007-04-17 | 2008-05-07 | 中南大学 | Genome chip for analyzing microbial community structure in acidic environment |
-
2009
- 2009-08-03 CN CN 200910070014 patent/CN101633954B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586132A (en) * | 2011-12-14 | 2012-07-18 | 建设部水处理新技术产业化基地(天津港保税区水处理新技术产业化基地) | Sphingobacteria sp. for removing ammonia nitrogen from sewage at low temperature and separate culturing method thereof |
| CN106645046A (en) * | 2016-09-18 | 2017-05-10 | 北京工业大学 | Method for in-situ determination of intracellular nitric oxide (NO) of microbes in denitrified activated sludge |
| CN113077845A (en) * | 2021-04-13 | 2021-07-06 | 中国科学院大气物理研究所 | Analysis method for composition of atmospheric aerosol microbial community |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101633954B (en) | 2011-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101748192B (en) | Gene chip of main pathogenic microorganism in drinking water and testing kit | |
| CN1995380B (en) | Method for detecting and identifying mycobacterium tuberculosis strain and its dedicated reagent kit | |
| CN103361439B (en) | Method for integrated detection of nine beer-spoilage bacteria | |
| CN101748193B (en) | Gene chip for detecting pathogens of lower respiratory tract and reagent kit | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN104988144A (en) | Gene liquid chip for detecting 10 kinds of common pathogenic microorganisms in soil and detection method of gene liquid chip | |
| CN101633954B (en) | Community chip for analyzing community structure and dynamic variation of activated sludge microbe | |
| CN116042902A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneously detecting six candida species and special primer and probe thereof | |
| CN111154900A (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| CN102424862B (en) | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila | |
| CN104131115A (en) | Gene chip for detecting pathogenic fungi of poplar canker and application thereof | |
| CN101200769B (en) | Detection method for discriminating medicinal lucid ganoderma by using special gene sequence | |
| CN102168131B (en) | Primer for amplifying specific regions of common pathogenic type Legionella gyrB genes and application thereof | |
| CN102628042B (en) | Specific ribonucleotide of legionella pneumophilia O9 wzm gene and application thereof | |
| CN101928779A (en) | Real-time fluorescent RCR molecular detection kit for leptosphaeria maculans and detection method thereof | |
| CN105112510A (en) | Gene chip for typing mycobacteria and application method thereof | |
| KR101721098B1 (en) | Dna chip for the quantitative measurement of harmful cyanobacteria in korean freshwater | |
| CN102827930B (en) | Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof | |
| CN104278025B (en) | Cabbage type rape full-length genome SCAR molecular labelings and preparation method and application | |
| CN101624631B (en) | Method for rapidly, qualitatively and quantitatively detecting microcystic aeruginosa on spot and the reagent kit | |
| CN102251042B (en) | Method for quickly detecting purity of seeds of bottle gourd varieties and kit used by same | |
| CN1275717A (en) | Nucleic acid molecular probe for identifying blue-green alga and method | |
| CN110669835A (en) | Potentilla anserina rhizosphere microorganism diversity and flora analysis method based on high-throughput sequencing | |
| Park et al. | The characterization of bacterial community structure in the rhizosphere of watermelon (Citrullus vulgaris SCHARD.) using culture-based approaches and terminal fragment length polymorphism (T-RFLP) | |
| CN108642190A (en) | Forensic medicine composite detection kit based on 14 autosome SNP genetic markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111109 Termination date: 20120803 |