CN101629158A - Recombinant vaccine for enterohemorrhagic escherichia coli O157 - Google Patents
Recombinant vaccine for enterohemorrhagic escherichia coli O157 Download PDFInfo
- Publication number
- CN101629158A CN101629158A CN200810050967A CN200810050967A CN101629158A CN 101629158 A CN101629158 A CN 101629158A CN 200810050967 A CN200810050967 A CN 200810050967A CN 200810050967 A CN200810050967 A CN 200810050967A CN 101629158 A CN101629158 A CN 101629158A
- Authority
- CN
- China
- Prior art keywords
- vaccine
- gene
- escherichia coli
- bacterial strain
- enterohemorrhagic escherichia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to a recombinant vaccine strain for enterohemorrhagic Escherichia coli O157, in particular to a recombinant vaccine strain for enterohemorrhagic Escherichia coli O157 which loses the pathogenicity, and retains the specific immunogenicity thereof. The invention further relates to a vaccine and a vaccine composition based on the recombinant strain for enterohemorrhagic Escherichia coli, a production method and application thereof in preventing the infection of human enterohemorrhagic Escherichia coli O157 and preventing the enterohemorrhagic Escherichia coli O157 from residing and propagating in alimentary tracts of ruminants.
Description
Affiliated field
The present invention relates to the recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain, particularly relate to the enterohemorrhagic Escherichia coli O 157 genetically engineered recombiant vaccine bacterial strain that has lost pathogenecity but kept its specific immune originality.The invention further relates to based on said enterohemorrhagic Escherichia coli O 157 vaccine, its production method and at prevention people enterohemorrhagic Escherichia coli O 157 and infect and the application of prevention enterohemorrhagic Escherichia coli O 157 in the ruminating animal digestive tube is settled down and bred.
Background technology
Enterohemorrhagic E.coli (EHEC) is a kind of important New Development food source Amphixenosis pathogenic bacteria.EHEC enters in the body by contaminated food, infect intestinal epithelial cells, the hemorrhagic diarrhea, hemorrhagic colitis and hemolytic urinary tract syndromes (the Riley LW that cause infected person, et al, The New EnglandJournal of Medicine, 308 (12): 681-685,1983; Levine MM, Journal of InfectiousDiseases, 155:377-389,1987).
So far, the vaccine that does not also have available prevention EHEC O157 to infect clinically.Infect in order to treat EHECO157, mainly be to use microbiotic at present.Yet, because antibiotic therapy can cause the serious alteration of intestinal flora and the generation of Resistant strain, and some microbiotic is understood cracking bacterium thalline and is caused that toxin discharges, so that cause even more serious pathologic reaction, so scarcely advocate to use antibiotic therapy clinically, wish to find as early as possible a kind of vaccine that can effectively prevent EHEC O157 to infect.
United States Patent (USP) 5,354 has been described the monoclonal antibody of hemorrhage Escherichia coli O 157: H7 and intestinal bacteria 026:H11 No. 661.United States Patent (USP) 6,410, the epitope of describing EHEC O157:H7 toxin No. 024, and the antibody of anti-this toxin and as the application of treatment and diagnostic preparation.United States Patent (USP) 6,365, the antibody and the oral vaccine that disclose based on EHEC O157:H7 lipopolysaccharides O-side chain epitope for No. 723.United States Patent (USP) 6,291 discloses the composition that contains monose or polysaccharide sequence for No. 435 and has reduced EHEC virulence and the treatment EHEC application in infecting.United States Patent (USP) 6,485 discloses the method that use phage (for example V5) reduces EHEC O157 level in the enteron aisle for No. 902.United States Patent (USP) 6,383 has been described for No. 496 and have been had RpoS
+The attenuation Salmonella typhosa of phenotype and polygenic mutation, its production method and in vaccine production as the application of gene delivery vector.So far, have only the inventor once to make up enterorrhagia Bacillus coil 0157 gene-deleted vaccine (Chinese patent ZL03157537.4).
The inventor is on the basis of enterorrhagia Bacillus coil 0157 gene-deleted vaccine patent; avirulent shiga toxin 1 (Stx1) and shiga toxin 2 (Stx2) mutant gene after the sudden change are imported above-mentioned vaccine strains; structure obtains new EHEC O157 recombiant vaccine bacterial strain of the present invention; and experiment confirm this vaccine strains have good security and immanoprotection action, thereby finished the present invention.
Summary of the invention
An object of the present invention is to provide recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain alive, it is characterized in that on the basis of enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain (preservation registration number CGMCC No.1015), import the avirulent shiga toxin mutant gene after the sudden change, thereby further improved the immunogenicity of vaccine strains.
According to a preferred embodiment of the invention, wherein said enterorrhagia Bacillus coil 0157 gene-deleted vaccine is as China Patent No.: the vaccine strains defined in the ZL03157537.4.
According to a preferred embodiment of the invention, wherein said shiga toxin gene is stx1 and the stx2 gene in the EHECO157:H7 genome.
According to a preferred embodiment of the invention, the gene after the A subunit sudden change that is stx1 and stx2 gene of wherein said shiga toxin mutant gene.
Another object of the present invention provides the method for producing the vaccine strains that is defined as above, and this method comprises:
(1) amplification obtains the stx1 of EHEC O157:H7 and the part flanking sequence of full gene of stx2 and both sides, and the gene fragment clone that amplification is obtained is in appropriate carriers;
(2) stx1 that respectively amplification is obtained and the toxicity active zone of stx2A subunit and the base in transmembrane transport district are carried out point mutation, make it to lose cytotoxicity, and the mutant sequence after will suddenling change are cloned into respectively in the appropriate carriers;
(3) recombinant vectors that obtains with step (2) transforms appropriate host cell;
(4) the reconstitution cell culture supernatant that step (3) is obtained carries out cytotoxicity experiment, filters out to have lost Cytotoxic stx1 and stx2 mutant sequence;
(5) recombinant plasmid transformed that carries avirulent stx1 and stx2 mutant sequence that obtains with step (4) arrives the enterorrhagia Bacillus coil 0157 gene-deleted vaccine, obtains recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention.
According to a preferred embodiment of the invention, it is wherein said in the step (2) that to have lost Cytotoxic Stx1 mutant sequence be that the 167th L-glutamic acid is mutated into aspartic acid (E167D), the 170th arginine is mutated into leucine (R170L), and the 231st alanine mutation becomes aspartic acid (A231D) to become L-glutamic acid (G234E) with the 234th glycine mutation.And wherein said to have lost Cytotoxic Stx2 mutant sequence be that the 166th L-glutamic acid is mutated into aspartic acid (E166D), and the 219th alanine mutation becomes aspartic acid (A219D) to become L-glutamic acid (G232E) with the 232nd glycine mutation.
A further object of the present invention provides and is used for the immunization people with prevention EHEC O157 infection or the vaccine composition of immunization ruminating animal to stop EHEC O157 to settle down and breed at digestive tube, said vaccine composition contains the recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain that is defined as above, and one or more pharmaceutically acceptable carrier or vehicle.
According to a preferred embodiment of the invention, wherein said vaccine composition also can contain one or more and includes but not limited to that Freund's complete adjuvant and Freund's incomplete adjuvant are at interior immunostimulant or immunomodulator.
The invention provides the recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain, the enterohemorrhagic Escherichia coli O 157 genetically engineered reorganization attenuated vaccine bacterial strain that has lost pathogenecity but remained with specific immune originality particularly is provided.The present invention further provides based on said recombinant vaccine for enterohemorrhagic Escherichia coli O 157, its production method and prevention people enterohemorrhagic Escherichia coli O 157 infect or the immunization ruminating animal to stop the application of EHEC O157 in digestive tube is settled down and bred.
As a kind of recombinant vaccine strain of work, should be in hypotoxicity and the two maintenance balance of immunogenicity.That is to say that such vaccine strain should not cause any i or I in the normal host body, can in body, be settled down the concurrent immunogen activity of waving again after the inoculation simultaneously.
The inventor has successfully made up and has possessed this equilibrated recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain on the basis of enterorrhagia Bacillus coil 0157 gene-deleted vaccine (Chinese patent ZL03157537.4) bacterial strain (preservation registration number CGMCC No.1015).Vaccine strains of the present invention is on the basis of enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain, imports to have lost Cytotoxic stx1 and stx2 mutant gene.Our experimental study confirms; O157 recombiant vaccine bacterial strain of the present invention has lost pathogenic to normal functional cell and living Animal Models really; and have the immunogenicity that prevention wild-type EHEC O157 infects, and model mice is had good immunoprotective effect.
In the practice of preparation recombinant vaccine for enterohemorrhagic Escherichia coli O 157 of the present invention, on the former basis that successfully makes up enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain (preservation registration number CGMCCNo.1015) of the inventor, determine with shiga toxin stx gene to be object, gene to stx1 and stx2 carries out point mutation, filter out then and lost Cytotoxic Stx1 and Stx2 mutant, and avirulent stx1 and stx2 mutant gene imported enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain, thereby obtain having lost pathogenic but remain with enough immunogenic recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain.
Briefly, be purpose of the present invention, the inventor is at first based on enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain (preservation registration number CGMCC No.1015) (referring to Chinese patent ZL03157537.4), use polymerase chain reaction (PCR) method from the wild virulent strain EDL933 of EHEC O157:H7, to amplify full gene and the flanking sequence thereof of stx1 and stx2 respectively, and the gene of coding stx1 and stx2 carried out point mutation, the stx1 and the stx2 mutant gene that will obtain after will suddenling change then are cloned in the plasmid pUC18, and the gained recombinant plasmid transformed is arrived in the host bacterium (bacillus coli DH 5 alpha).Utilize the vero cell that the recombinant bacterial strain that carries stx1 and stx2 mutant gene is carried out cytotoxicity experiment then, lost Cytotoxic stx1 and stx2 mutant gene to screen.
The recombinant plasmid that carries the stx1 that lost cytotoxic effect and stx2 mutant gene is imported in the enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain, the O157 recombinant bacterial strain that has this recombinant plasmid can be expressed lost Cytotoxic shiga toxin, with the immunogenicity of enhancing O157 vaccine strains, thereby construct recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention.
Then, utilize vero cell and mouse model that security, immunogenicity and the immanoprotection action of vaccine strains of the present invention are furtherd investigate again.The result confirms that recombinant vaccine for enterohemorrhagic Escherichia coli O 157 of the present invention has good security and immunogenicity, and laboratory animal (mouse) is had good immunoprotective effect (referring to embodiment 4-8).
Therefore, method of the present invention may further comprise the steps:
(1) amplification obtains stx1 and full gene of stx2 and flanking sequence from EHEC O157:H7 genome, and it is cloned in the appropriate carriers;
(2) gene among stx1 and the stx2 is carried out rite-directed mutagenesis;
(3) stx1 and the stx2 mutant gene that step (2) is obtained is cloned in the appropriate carriers;
(4) recombinant vectors that obtains with step (3) transforms appropriate host cell, and utilizes the cytotoxicity experiment screening to lose Cytotoxic stx1 and stx2 mutant;
(5) recombinant plasmid that will carry stx1 and stx2 nontoxicity mutant sequence changes enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain over to;
(6) utilize the cytotoxicity of the recombinant bacterial strain of vero cell detection step (5);
(7) utilize mouse model to detect security and the immanoprotection action of the recombinant bacterial strain of step (5) to experiment mice.
According to the preferred embodiments of the invention, wherein the stx1 complete sequence comprises A subunit upstream 813bp to B subunit downstream 665bp, altogether 2705bp.
According to the preferred embodiments of the invention, wherein said stx2 complete sequence comprises A subunit upstream 925bp to B subunit downstream 232bp, altogether 2402bp.
According to the preferred embodiments of the invention, wherein the base of suddenling change among stx1 and the stx2 is the nucleotide sequence in coding toxicity active zone and transmembrane transport district.
According to the preferred embodiments of the invention, defined in wherein said enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain such as the Chinese patent ZL03157537.4, have the bacterial strain of preservation registration number CGMCCNo.1015.
Specifically, find that the zone of two high conservatives is arranged in the A of Stx subunit by sequential analysis.A toxicity active zone that is positioned at toxin, another is positioned at the transmembrane transport district of toxin.By sudden change, may eliminate the toxicity of toxin, but keep immunogenicity completely these two conservative regions.This experiment is carried out point mutation to the base in these two zones on the A subunit of Stx1 and Stx2 respectively, and is studied at the cytotoxicity of Stx and mutant thereof promptly on this basis.
At first carry out the clone of stx1 and mutant gene thereof.According to stx1 sequence and flanking sequence design primer on the EHEC O157:H7 genome.Wherein the stx1 complete sequence is used to increase for primers F SZ34 cggaattctgtatactgcatggtgcc (SEQ IDNO:5) and FSZ35 gaattccatatgcagtgctgtgacgatgatg (SEQ ID NO:6).Primers F SZ36 actgtgacagctcaagctttactttttcggca (SEQ ID NO:7) and FSZ37tgccgaaaaagtaaagcttgagctgtcacagt (SEQ ID NO:8) are positioned at the toxicity active zone of stx1A subunit, this a pair of primer can complementary pairing, and has introduced two mutating alkali yls therein.Primers F SZ38taatgccacgctctcgaggatatcattaatgcttc (SEQ ID NO:9) and FSZ39gaagcattaatgatatcctcgagagcgtggcatta (SEQ ID NO:10) are positioned at the transmembrane transport district of stx1A subunit, this a pair of primer energy complementary pairing, and introduced two mutating alkali yls therein.
Pcr amplification from the genome of EDL933 bacterial strain goes out the dna sequence dna of full gene of stx1 and flanking fragment with primers F SZ34 (SEQ ID NO:5) and FSZ35 (SEQ ID NO:6), it is cloned between the NdeI/XbaI site of plasmid pUC18, obtains recombinant plasmid pSTX1 with structure; With primers F SZ36 (SEQ ID NO:7) and FSZ37 (SEQ ID NO:8) point mutation is carried out in stx1 genotoxicity active zone, and the fragment cloning after will suddenling change constructs recombinant plasmid pSTX1.1 between the NdeI/XbaI site of plasmid pUC18; With primers F SZ38 (SEQ ID NO:9) and FSZ39 (SEQ ID NO:10) stx1 gene transmembrane transport district is carried out point mutation, and the fragment cloning after will suddenling change constructs recombinant plasmid pSTX1.2 between the NdeI/XbaI site of plasmid pUC18.Then, with above-mentioned primer the toxicity active zone and the transmembrane transport district of stx1 gene carried out point mutation simultaneously again, the fragment cloning after the sudden change between the NdeI/XbaI site of plasmid pUC18, is constructed recombinant plasmid pSTX1.3.
Carry out the clone of stx2 and mutant gene thereof then.According to stx2 complete sequence on the EHEC O157:H7 genome and flanking DNA sequences Design primer.The stx2 complete sequence is used to increase for primers F SZ31 cgggatccttcacaaagcggagggga (SEQID NO:3) and FSZ32cggaattctgtatactgcatggtgcc (SEQ ID NO:4).Primers F SZ26 gcgtaaggcgtctgctgtg (SEQ ID NO:1) and FSZ27cacagcagacgccttacgc (DEQ ID NO:2) are positioned at the toxicity active zone of stx2A subunit, this a pair of primer can complementary pairing, and has introduced two mutating alkali yls therein.Primers F SZ40taatatatcagacatactggagactgtggc (SEQ ID NO:11) and FSZ41gccacagtctccagtatgtctgatatatta (SEQ ID NO:12) are positioned at the transmembrane transport district of stx2A subunit, this a pair of primer can complementary pairing, and has introduced two mutating alkali yls therein.
Use primers F SZ31 (SEQ ID NO:3) and FSZ32 (SEQ ID NO:4) from EDL933 strain gene group, to amplify the dna sequence dna of full gene of stx2 and flanking fragment, and it is cloned between the BamHI/EcoRI site of plasmid pUC18, construct recombinant plasmid pSTX2; With primers F SZ26 (SEQID NO:1) and FSZ27 (SEQ ID NO:2) point mutation is carried out in the toxicity active zone of stx2 gene, and the fragment cloning after will suddenling change constructs recombinant plasmid pSTX2.1 between the BamHI/EcoRI site of plasmid pUC18; With primers F SZ40 (SEQ ID NO:11) and FSZ41 (SEQ ID NO:12) the transmembrane transport district of stx2 gene is carried out point mutation, and the fragment cloning after will suddenling change constructs recombinant plasmid pSTX2.2 between the BamHI/EcoRI site of plasmid pUC18; Re-use above-mentioned primer the toxicity active zone and the transmembrane transport district of stx2 gene carried out point mutation simultaneously, the fragment cloning after the sudden change between the BamHI/EcoRI site of plasmid pUC18, is constructed recombinant plasmid pSTX2.3.
Then, above-mentioned stx1 toxicity active zone of increasing and transmembrane transport region mutation fragment and stx2 toxicity active zone and transmembrane transport region mutation fragment are cloned into respectively between the NdeI/XbaI and BamHI/EcoRI site of plasmid pUC18, construct and contain stx1 and the segmental recombinant plasmid pSTX1.3-STX2.3 of stx2 mutator gene simultaneously.
In the final recombinant plasmid pSTX1.3-STX2.3 that makes up, the L-glutamic acid that Stx1 toxicity active zone is the 167th is mutated into aspartic acid (E167D), and the 170th arginine is mutated into leucine (R170L); The alanine mutation of striding the 231st in film district becomes aspartic acid (A231D), and the 234th glycine mutation becomes L-glutamic acid (G234E).The L-glutamic acid that Stx2 toxicity active zone is the 166th is mutated into aspartic acid (E166D); The alanine mutation of striding the 219th in film district becomes aspartic acid (A219D), and the 232nd glycine mutation becomes L-glutamic acid (G232E).
The recombinant plasmid transformed that will have the shiga toxin mutant gene then is in the host bacterium.Because comprising shiga toxin, we clone's Stx1 and Stx2 sequence upstream express required regulating and controlling sequence, so after changing toxin gene and mutant gene thereof over to intestinal bacteria, toxin and mutant gene thereof can utilize the expression regulation element of self to start the expression of toxin gene or mutant gene, to give expression to shiga toxin and mutant thereof as far as possible, make it to have natural conformation and immunogenicity with natural structure.Owing to utilized the expression regulation element of shiga toxin self, and with intestinal bacteria as the host, therefore can expressed toxin be secreted in the inoculum with the same in Enterohemorrhagic E.coli.
Then, utilize the vero cell, detect wild-type shiga toxin and mutant thereof toxic action the vero cell as target cell.To have after the recombinant bacterial strain cultivation of shiga toxin or its mutant sequence, filtering separation bacterial cultures supernatant, and the bacillus coli DH 5 alpha culture supernatant of use process same treatment in contrast, detects the cytotoxic effect of shiga toxin and mutant thereof.
Briefly, with the bacterial cultures supernatant after filtering by 10 times of gradient dilutions after, join in the cultured vero cell, detect and calculate wild-type shiga toxin or its mutant inhibiting rate the growth of vero cell by following formula.
Inhibiting rate=(control group OD value-experimental group OD value)/control group OD value * 100%
After the repeated experiments 3 times, draw out wild-type Stx1, Stx2 and mutant thereof the inhibition curve to the growth of vero cell, and relatively the shiga toxin different mutants is to the toxicity of vero cell, the toxicity of observing after shiga toxin suddenlys change changes.
The result shows the Stx1 that suddenlys change with respect to not, and the toxicity of mutant Stx1.1 and Stx1.3 descends obviously,
1000 times have been descended approximately, the cytotoxicity of can having thought basically eliminate; And with respect to the Stx2 of sudden change not, the toxicity of mutant Stx2.1, Stx2.2 and Stx2.3 also all obviously descends, wherein Stx2.3 toxicity descend maximum, so can think and eliminated cytotoxicity fully.
The recombinant plasmid pSTX1.3-STX2.3 that will have the stx1 that eliminated toxic action and stx2 mutant gene changes the enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain (preservation registration number: CGMCC No.1015 that makes up before our over to; China Patent No.: ZL03157537.4), construct purpose bacterial strain of the present invention: the recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain.
Regulation according to budapest treaty, the inventor is on June 16th, 2008, with recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain (called after: O157-AM934 of the present invention, the classification called after: colon bacillus Eschierichia coli) be kept at China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC), its preservation registration number is: CGMCCNo.2539.
For security and the immunogenicity of estimating recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention, respectively its biological characteristics and immunological characteristic have been carried out following experimental study.
1, Vero cytotoxicity experiment: after the culture supernatant filtration with EHEC O157:H7 EDL933 and recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain, detect the restraining effect of these two strain culture supernatants by aforementioned cytotoxicity experiment method, and these two bacterial strains are compared analysis to the toxic action of vero cell vero cell growth.The result shows that EHEC O157:H7 wild-type virulent strain EDL933 has very strong toxic action to the vero cell, and recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention has been lost the toxic action to the vero cell substantially.
2, recombinant vaccine for enterohemorrhagic Escherichia coli O 157 The stability of strain experiment: vaccine strains of the present invention is cultivated in continuous passage in LB, do not use microbiotic in the process that goes down to posterity, to check under the situation that does not have microbiotic pressure the stability of recombinant plasmid in vaccine strains.The result shows that under the situation of antibiotic-free pressure, vaccine strains of the present invention passed in 10 generations, had satisfactory stability.
3, the safety experiment of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain: will be divided into 2 groups at random from newborn rat, irritate stomach inoculation EHEC O157:H7 EDL933 (group in contrast) and recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention respectively, dosage of inoculation is 4 * 10
9CFU/ only.Simultaneously to mouse peritoneal injection mitomycin (2.5mg/kg body weight).Observe and record mouse growth conditions.
The result shows that the experimental mice growth of inoculation vaccine strains of the present invention is normal, no visible clinical symptom; The control group mice body weight of inoculation wild-type virulent strain O157:H7 EDL933 alleviates rapidly, and 8 mouse are all dead in 4 days.This result confirms, recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention has been lost pathogenic to experiment mice, has good security.
4, the experiment of the mouse discharge of bacteria after the immunity of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain:, be divided into blank group and recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain immune group of the present invention at random with 20 Kunming mouses.Immunity is irritated stomach with virulent strain EHEC O157:H7 EDL933 after 14 days and is attacked poison, detects the discharge of bacteria situation in the stool in mice then every day.
As seen the result with the blank group mouse of physiological saline, still has EHEC O157:H7 EDL933 up to attacking also can detect in malicious back 13 days in the ight soil.And the immune group mouse was attacked the poison back the 6th day, then detected from the immune group stool in mice less than EHEC O157:H7 EDL933 and discharged.After recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention immunity is described, can effectively shorten virulent strain settling down the time in animal intestinal.
5, the passive immunization protectiveness of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain experiment (maternal antibody is to the protectiveness of suckling mouse): 40 of female mouse of the about 28g of body weight are divided into not immune blank group and vaccine strains immune group of the present invention at random.After the first immunisation 7 days, public mouse and female mouse are raised together with mating.After 7 days, to female mouse booster immunization 1 time.In the 2nd immunity about 2 weeks of back, the female mouse that pregnancy is about to childbirth divides cage to feed.Female mouse is divided the puerperium, the 7 age in days suckling mouses that given birth to is irritated stomach with virulent strain EHEC O157:H7 EDL933 attack poison.Record dead mouse situation is to estimate the vaccine strains immune protective effect.
As seen the result accepts suckling mouse that virulent strain attacks since death in the 3rd day.The survival rate of the female mouse of not immune control group institute lactogenesis mouse has only 16.8%, and the survival rate of the female mouse of immune group institute lactogenesis mouse is 83.0%.After showing the female mouse of vaccine strains of the present invention immunity, the suckling mouse that is given birth to can obtain maternal antibody when sucking breast milk, thereby makes suckling mouse obtain passive immunization provide protection preferably.
More than to recombinant vaccine for enterohemorrhagic Escherichia coli O 157 The stability of strain of the present invention, security, cytotoxicity with virulent strain is settled down the influence of time at mouse intestinal; and can fully confirm with the immune protective experimental result that suckling mouse carries out: recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention has satisfactory stability, security and immunogenicity, and has good immunoprotective effect.Recombinant bacterial strain of the present invention can be used as a kind of vaccine strains fully, is used to produce the immunoprophylaxis preparation that infects at enterohemorrhagic Escherichia coli O 157.
Therefore, having the present invention further provides immunization people infects or the vaccine composition of immunization ruminating animal to stop EHEC O157 to settle down and breed at digestive tube with prevention EHEC O157.Said vaccine composition contains the recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain that is defined as above, and one or more pharmaceutically acceptable carrier or vehicle.
According to the preferred embodiments of the invention, wherein said recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain is at the enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain of invention before us (preservation registration number: (China Patent No.: on basis ZL03157537.4), import and lost the recombinant bacterial strain that obtains behind Cytotoxic stx1 and stx2 mutant gene CGMCC No.1015).
According to the preferred embodiments of the invention, wherein said vaccine composition also can contain one or more immunostimulants or immunomodulator.Wherein said immunostimulant or immunomodulator comprise but are not only limited to Freund's complete adjuvant and Freund's incomplete adjuvant.
A further object of the present invention provides prevention people EHEC O157 and infects or the method for immunization ruminating animal to stop EHEC O157 to settle down and breed at digestive tube, and this method comprises the vaccine composition that comes into operation and prevent significant quantity to be defined as above to said ruminating animal.
Can use the known ordinary method in production of vaccine field, with recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain stoste of the present invention or its diluent and one or more pharmaceutically acceptable carrier or mixed with excipients, and make the vaccine composition of the unit metering form that is suitable for oral or non-oral administration as required.The preparation that is suitable for the gi tract external administration can contain sterilized water or salt solution, polyoxyethylene glycol, vehicle that wet goods is commonly used.Particularly, can use biocompatible, biodegradable lactide polymer, poly (lactide-co-glycolide), polyoxyethylene/polyoxypropylene multipolymer, the sustained release preparation of preparation vaccine composition of the present invention as vehicle.
Specifically, can use vehicle such as lactose, glucose, sucrose, N.F,USP MANNITOL and methylcellulose gum, disintegrating agents such as starch, sodium alginate, calcium carboxymethylcellulose and crystalline cellulose, lubricant such as Magnesium Stearate and talcum, cakingagents such as gelatin, polyvinyl alcohol, polyvinylpyrrolidone, methylcellulose gum and hydroxypropylcellulose, with tensio-active agents such as sucrose fatty ester, Spans, and ancillary component such as tinting material, correctives, spices, dispersion agent, prepare the vaccine composition of tablet or capsule form with ordinary method.
Perhaps, can make water, physiological saline, vegetables oil (as sweet oil and peanut oil), ethyl oleate and propylene glycol equal solvent, isotonic agent such as sodium-chlor and glucose, sanitass such as phenol, cresols, contraposition hydroxybenzoate, trichloro-butyl alcohol, degree rice phenol and Sorbic Acid, antioxidant such as xitix and trisodium phosphate prepares the vaccine composition of injectable forms with ordinary method.
For the thermostability of improving vaccine composition of the present invention and effective storage time, bacterium stoste or its diluent can be mixed with vaccine protective material or stablizer by suitable proportion, the freeze-dried preparation of vaccine composition of the present invention is made in freeze-drying then.Wherein said protective material or stablizer can be grouped into by one-tenth such as human serum albumin or gelatin, trehalose, Sodium Glutamate, urea and sorbyl alcohol and/or N.F,USP MANNITOL.
In order to improve the immunization effect of vaccine composition of the present invention, can in composition, add one or more immunostimulants or immunomodulator.Said immunostimulant or immunomodulator comprise but are not only limited to the complete or Freund of Fu Shi.
The following example is intended to further illustrate, rather than restriction the present invention.It will be appreciated by those skilled in the art that, under the prerequisite that does not deviate from the spirit and principles in the present invention, all will fall in the claim scope that awaits the reply of the present invention any parallel change of the present invention and change.
Embodiment
Embodiment 1: the amplification and the clone of full gene of shiga toxin (Stx) and mutant gene thereof
At first carry out the clone of full gene of stx1 and mutator gene thereof.Complete sequence and two flank dna sequence dnas design primer thereof according to stx1 on the EHEC O157:H7EDL933 genome of having reported.Primers F SZ34 (SEQ NO:5) and FSZ35 (SEQ NO:6) lay respectively at the 5 ' end and the 3 ' end of amplification aim sequence, and the stx1 complete sequence is used to increase.Primers F SZ36 (SEQ NO:7) and FSZ37 (SEQ NO:8) are positioned at the toxicity active zone of stx1A subunit, and these two primers can complementary pairing, and has introduced two mutating alkali yls therein.Primers F SZ38 (SEQ NO:9) and FSZ39 (SEQ NO:10) are positioned at the transmembrane transport district of stx1A subunit, and these two primers also can complementary pairing, and has introduced two mutating alkali yls therein.
From EDL933 strain gene group, amplify the dna fragmentation that comprises full gene of stx1 and flanking sequence with primers F SZ34 (SEQ NO:5) and FSZ35 (SEQ NO:6) with polymerase chain reaction (PCR) method, it is cloned between the NdeI and XbaI site of plasmid pUC18 construction recombination plasmid pSTX1; With primers F SZ36 (SEQ NO:7) and FSZ37 (SEQ NO:8) point mutation is carried out in stx1 genotoxicity active zone, with the sudden change after fragment cloning between the NdeI/XbaI site of plasmid pUC18, construction recombination plasmid pSTX1.1; With primers F SZ38 (SEQ NO:9) and FSZ39 (SEQ NO:10) stx1 gene transmembrane transport district is carried out point mutation, with the sudden change after fragment cloning between the NdeI/XbaI site of plasmid pUC18, construction recombination plasmid pSTX1.2; Suddenly change simultaneously with the toxicity active zone and the transmembrane transport district of above-mentioned primer again to the stx1 gene, with the sudden change after fragment cloning to construction recombination plasmid pSTX1.3 between the NdeI/XbaI site of plasmid pUC18.
Carry out the clone of full gene of stx2 and mutator gene thereof then.Complete sequence and two flank dna sequence dnas design primer thereof according to stx2 on the EHEC O157:H7EDL933 genome of having reported.Primers F SZ31 (SEQ NO:3) and FSZ32 (SEQ NO:4) lay respectively at the 5 ' end and the 3 ' end of amplification aim sequence, and the stx2 complete sequence is used to increase.Primers F SZ26 (SEQ NO:1) and FSZ27 (SEQ NO:2) are positioned at the toxicity active zone of stx2A subunit, and these two primers can complementary pairing, and has introduced two mutating alkali yls therein.Primers F SZ40 (SEQ NO:11) and FSZ41 (SEQ NO:12) are positioned at the transmembrane transport district of stx2A subunit, and these two primers can complementary pairing, and has introduced two mutating alkali yls therein.
From EDL933 strain gene group, amplify the dna fragmentation that comprises full gene of stx2 and flanking sequence with primers F SZ31 (SEQ NO:3) and FSZ32 (SEQ NO:4) with polymerase chain reaction (PCR) method, it is cloned between the BamHI/EcoRI site of plasmid pUC18 construction recombination plasmid pSTX2; With primers F SZ26 (SEQ NO:1) and FSZ27 (SEQ NO:2) point mutation is carried out in stx2 genotoxicity active zone, with the sudden change after fragment cloning between the BamHI/EcoRI site of plasmid pUC18, construction recombination plasmid pSTX2.1; With primers F SZ40 (SEQ NO:11) and FSZ41 (SEQ NO:12) stx2 gene transmembrane transport district is carried out point mutation, with the sudden change after fragment cloning between the BamHI/EcoRI site of plasmid pUC18, construction recombination plasmid pSTX2.2; Suddenly change simultaneously with the toxicity active zone and the transmembrane transport district of above-mentioned primer again to the stx2 gene, with the sudden change after fragment cloning between the BamHI/EcoRI site of plasmid pUC18, construction recombination plasmid pSTX2.3.
Then, above-mentioned stx1 toxicity active zone of increasing and transmembrane transport region mutation fragment and stx2 toxicity active zone and transmembrane transport region mutation fragment are cloned into respectively between the NdeI/XbaI and BamHI/EcoRI site of plasmid pUC18, construct and contain stx1 and the segmental recombinant plasmid pSTX1.3-STX2.3 of stx2 mutator gene simultaneously.
In the recombinant plasmid pSTX1.3-STX2.3 that makes up, the L-glutamic acid that Stx1 toxicity active zone is the 167th is mutated into aspartic acid (E167D), and the 170th arginine is mutated into leucine (R170L); The alanine mutation of striding the 231st in film district becomes aspartic acid (A231D), and the 234th glycine mutation becomes L-glutamic acid (G234E).The L-glutamic acid that Stx2 toxicity active zone is the 166th is mutated into aspartic acid (E166D); The alanine mutation of striding the 219th in film district becomes aspartic acid (A219D), and the 232nd glycine mutation becomes L-glutamic acid (G232E).
Embodiment 2: the preparation of shiga toxin (Stx) nontoxicity mutant, screening and evaluation
The recombinant plasmid that will have stx1 and stx2 different mutants sequence is transformed into respectively in the bacillus coli DH 5 alpha competent cell.Because comprising shiga toxin, we clone's Stx1 and Stx2 sequence upstream express required regulating and controlling sequence, purpose is after changing toxin gene and mutant gene thereof over to intestinal bacteria, can utilize himself expression regulation element to start the expression of toxin gene or mutant gene, to give expression to shiga toxin and mutant thereof as far as possible, make it have natural conformation and immunogenicity with natural structure.Owing to utilized the expression regulation element of shiga toxin self, and with intestinal bacteria as the host, therefore can expressed toxin be secreted in the inoculum with the same in Enterohemorrhagic E.coli.
Utilize the vero cell as target cell then, detect the cytotoxic effect that carries stx1 and stx2 different mutants recombinant bacterial strain respectively.Recombinant bacterial strain is inoculated in the 5mL LB substratum spends the night, use 0.22 μ m membrane filtration bacterial cultures supernatant then in 37 ℃ of shaking culture.With in contrast through the DH5 α culture supernatant filtrate of same treatment.
The bacterial cultures supernatant is filtered the back join in the cultured vero cell, continue to cultivate 72 hours by 10 times of gradient dilutions.At first examine under a microscope cell.Outwell nutrient solution then, wash gently 3 times with PBS, in each hole, add 100 μ l violet staining liquid normal dyeings and decolouring (33% acetum) respectively after, measure absorbance in the 570nm wavelength with microplate reader, calculate cell inhibitory rate by following formula.
Inhibiting rate=(control group OD value-experimental group OD value)/control group OD value * 100%
Draw out wild-type Stx1, Stx2 and mutant thereof the inhibition curve to the growth of vero cell after the repeated experiments 3 times, more different toxin mutant are to the toxicity of vero cell, observe the toxicity variation after the shiga toxin sudden change.
The result shows, with respect to the Stx1 of sudden change not, mutant Stx1.1 and Stx1.3 toxicity descend obviously, have reduced by 1000 times approximately, the cytotoxicity of can having thought basically eliminate.And with respect to the Stx2 that does not suddenly change, the toxicity of mutant Stx2.1, Stx2.2 and Stx2.3 all has obvious decline, and wherein the decline of Stx2.3 toxicity is maximum, can think and eliminate cytotoxicity fully.
Embodiment 3: the structure of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain
The recombinant plasmid pSTX1.3-STX2.3 that will have the stx1 that eliminated toxic action and stx2 mutant sequence changes enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain (the preservation registration number CGMCC No.1015 that this laboratory made up in the past over to; China Patent No.: ZL03157537.4), make up and obtain recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention.
The applicant is according to the regulation of budapest treaty, on June 16th, 2008 recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention is kept at China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC), its preservation registration number is: CGMCC No.2539.
Embodiment 4: the cytotoxicity experiment of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain
After the bacterial cultures supernatant filtration with EHEC O157:H7 EDL933 and recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention, with bacillus coli DH 5 alpha culture supernatant filtrate is contrast, draw the inhibition curve of these two strain culturing supernatants by aforementioned cytotoxicity experiment method, this two strains bacterium is compared analysis to the toxic action of vero cell vero cell growth.
The result shows that EHEC O157:H7 wild-type virulent strain EDL933 has very strong toxic action to the vero cell, and recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention has been lost the toxic action to the vero cell substantially.
Embodiment 5: the experiment of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 The stability of strain
Vaccine strains of the present invention continuous passage in LB is cultivated, do not use microbiotic in the process of cultivating that goes down to posterity, to check under the situation that does not have microbiotic pressure the stability of recombinant plasmid in vaccine strains.Every biography will be laid on behind the subculture doubling dilution on the nonresistant LB agar plate after 10 generations.The single bacterium colony of picking from flat board is inoculated in the LB agar plate that has added the blue or green toxin of ammonia benzyl then, simultaneously mark is carried out in each bacterium colony point sample position.There is not the blue or green toxin resistance of ammonia benzyl owing to lost the bacterial strain of recombinant plasmid, so on the LB agar plate that contains the blue or green toxin of ammonia benzyl, can not grow; Do not lose the bacterial strain of recombinant plasmid and then can grow, thereby analyzed the stability of recombinant plasmid in the recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain.Each 100 bacterium colonies of picking are inoculated, and are recorded in the colony number that can grow on the LB agar plate that contains the blue or green toxin of ammonia benzyl, and calculate the per-cent of the bacterium colony that carries recombinant plasmid.The result shows that under the situation of antibiotic-free pressure, vaccine strains of the present invention passed in 10 generations, had satisfactory stability.
Embodiment 6: the safety experiment of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain
14-18 age in days, the about 10-12g of body weight be divided into 2 groups at random from newborn rat.Irritate stomach inoculation EHECO157:H7 EDL933 (group in contrast) and recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention respectively, dosage of inoculation is 4 * 10
9CFU/ only.Simultaneously to mouse peritoneal injection mitomycin (2.5mg/kg body weight).Observe every day and record mouse growth conditions.
The result shows that the experimental mice growth of inoculation vaccine strains of the present invention is normal, does not have visible clinical symptom; The control group mice body weight of inoculation wild-type virulent strain O157:H7 EDL933 alleviates rapidly, and mouse is all dead in 4 days.Confirm that recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention lost pathogenic to experiment mice, have good security.
Embodiment 7: the mouse discharge of bacteria experiment after the immunity of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain
Kunming mouse about 20 20g is divided into 2 groups: blank group (irritating stomach with same dose physiological saline) and recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain immune group of the present invention at random.Immunity is irritated stomach with virulent strain EHEC O157:H7 EDL933 after 14 days and is attacked poison, and attacking the toxic agent amount is 5 * 10
9CFU/ only.Then every day aseptic collection mouse fresh excreta, 1g ight soil adds 10mL physiological saline, abundant vibrating dispersion mixing, and 4 ℃ left standstill 30 minutes, on LB (Nal 50 μ g/mL) agar plate, carry out enumeration behind the doubling dilution, measure and write down the average discharge of bacteria situation of immune group and control group.
The result shows, not immune control group mice with physiological saline, up to attacking also can detect in malicious back 13 days EHEC O157:H7 EDL933 is arranged still in the ight soil, and the immune group mouse was attacked the poison back the 6th day, from ight soil, promptly detect EDL933 less than EHEC O157:H7, after recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention immunity is described, can effectively shorten virulent strain settling down the time in animal intestinal.
Ruminating animal such as ox, sheep is the main carrier of EHEC O157, also is that EHEC O157 propagates the main contagium that infects the mankind.Therefore, consider, can carry out immunization to these animals with vaccine of the present invention fully, to reduce bacterium settling down quantity or shortening bacterium settling down the time in animal intestinal in animal intestinal from the epidemiology angle.Thereby can the directly generation of control EHEC O157 infection on the food source.
Embodiment 8: the passive immunization protectiveness experiment of recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain
With 40 of the female mouse about 28g, be divided into 2 groups at random: not immune blank group (physiological saline with same dose is irritated stomach) and vaccine strains immune group of the present invention (immunizing dose about 10
10CFU/ mouse).After the first immunisation 7 days, public mouse and female mouse are raised together with mating.After 7 days, to female mouse booster immunization 1 time.
About the 2nd immunity about 2 weeks of back, divide cage with the female mouse of pregnancy.And the 7 age in days suckling mouses that given birth to are irritated stomach with virulent strain EHEC O157:H7 EDL933 attack poison (dosage about 5.4 * 10
8CFU/ only).Record dead mouse situation, the immune protective effect of evaluation vaccine.
The result attacked the poison back the 3rd day, and the part suckling mouse begins death.The suckling mouse survival rate is shown in Table 1, and the survival rate of the female mouse of not immune control group institute lactogenesis mouse has only 16.8%, and the survival rate of the female mouse of immune group institute lactogenesis mouse is 83.0%.After showing the female mouse of vaccine strains of the present invention immunity, the suckling mouse that is given birth to can obtain maternal antibody when sucking breast milk, thereby suckling mouse is had passive immunization provide protection preferably.
The experiment of table 1 recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain passive immunization protectiveness
More than to recombinant vaccine for enterohemorrhagic Escherichia coli O 157 The stability of strain of the present invention, security, cytotoxicity with virulent strain is settled down the influence of time at mouse intestinal; and the immune protective experimental result of carrying out with suckling mouse; can fully confirm; recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of the present invention has satisfactory stability, security and immunogenicity; and have good immunoprotective effect, can be used as a kind of valuable recombinant vaccine strain fully.This vaccine strain can be used to the immunoprophylaxis that people's enterohemorrhagic Escherichia coli O 157 infects, and also can be used for the ruminating animal immunization, with the settling down and breeding in intestine of ruminants of prevention enterohemorrhagic Escherichia coli O 157, reduces environment and the food contamination of bacterium.
Sequence table
＜110〉Feng Shuzhang
＜120〉recombinant vaccine for enterohemorrhagic Escherichia coli O 157
<141>
<160>12
<210>1
<211>19
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ26) as pcr amplification.
<400>1
GCGTAAGGCG?TCTGCTGTG
<210>2
<211>19
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ27) as pcr amplification.
<400>2
CACAGCAGAC?GCCTTACGC
<210>3
<211>26
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ31) as pcr amplification.
<400>3
CGGGATCCTT?CACAAAGCGG?AGGGGA
<210>4
<211>26
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ32) as pcr amplification.
<400>4
CGGAATTCTG?TATACTGCAT?GGTGCC
<210>5
<211>26
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ34) as pcr amplification.
<400>5
CGGAATTCTG?TATACTGCAT?GGTGCC
<210>6
<211>31
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ35) as pcr amplification.
<400>6
GAATTCCATA?TGCAGTGCTG?TGACGATGAT?G
<210>7
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ36) as pcr amplification.
<400>7
ACTGTGACAG?CTCAAGCTTT?ACTTTTTCGG?CA
<210>8
<211>32
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ37) as pcr amplification.
<400>8
TGCCGAAAAA?GTAAAGCTTG?AGCTGTCACA?GT
<210>9
<211>35
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ38) as pcr amplification.
<400>9
TAATGCCACG?CTCTCGAGGA?TATCATTAAT?GCTTC
<210>10
<211>35
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ39) as pcr amplification.
<400>10
GAAGCATTAA?TGATATCCTC?GAGAGCGTGG?CATTA
<210>11
<211>30
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ40) as pcr amplification.
<400>11
TAATATATCA?GACATACTGG?AGACTGTGGC
<210>12
<211>30
<212>DNA
＜213〉artificial sequence
<220>
＜223〉according to the specific nucleotide sequence design, with primer (FSZ41) as pcr amplification.
<400>12
GCCACAGTCT?CCAGTATGTC?TGATATATTA
Claims (7)
1, recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain, be characterised in that this bacterial strain is on existing enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain basis, import the avirulent shiga toxin mutant gene behind the rite-directed mutagenesis, thereby further strengthened the immunogenicity of this vaccine strains.
2, according to the recombiant vaccine bacterial strain of claim 1, wherein said enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain is to limit as China Patent No. ZL03157537.4, and preservation registration number is the vaccine strains of CGMCCNo.1015.
3, according to the recombiant vaccine bacterial strain of claim 1, wherein said shiga toxin GENE SOURCES autohemorrhage Escherichia coli O 157: stx1 in the H7 genome and stx2 gene.
4, produce the method for recombinant vaccine for enterohemorrhagic Escherichia coli O 157, this method comprises:
(1) amplification obtains stx1 and full gene of stx2 and the part flanking sequence thereof of enterohemorrhagic Escherichia coli O 157: H7, and the gene fragment clone that will increase is in appropriate carriers;
(2) stx1 that respectively amplification is obtained and the gene of stx2A subunit carry out point mutation, and the gene clone after will suddenling change is in carrier;
(3) recombinant cloning vector that obtains with step (2) transforms appropriate host cell;
(4) the reconstitution cell culture supernatant that step (3) is obtained carries out cytotoxicity experiment, therefrom filters out to have lost Cytotoxic stx1 and stx2 mutant;
(5) forfeiture that obtains with step (4) the recombinant plasmid transformed enterorrhagia Bacillus coil 0157 gene-deleted vaccine bacterial strain of Cytotoxic stx1 and stx2 mutant, obtain the vaccine strains of claim 1.
5, method according to claim 4, it is wherein said in the step (2) that to have lost Cytotoxic Stx1 mutant sequence be that the 167th L-glutamic acid is mutated into aspartic acid (E167D), the 170th arginine is mutated into leucine (R170L), the 231st alanine mutation becomes aspartic acid (A231D) to become L-glutamic acid (G234E) with the 234th glycine mutation, and wherein said to have lost Cytotoxic Stx2 mutant sequence be that the 166th L-glutamic acid is mutated into aspartic acid (E166D), and the 219th alanine mutation becomes aspartic acid (A219D) to become L-glutamic acid (G232E) with the 232nd glycine mutation.
6, be used for preventing people's enterohemorrhagic Escherichia coli O 157 to infect and the application of the vaccine that the prevention enterohemorrhagic Escherichia coli O 157 is settled down and bred at the ruminating animal digestive tube according to the recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain of claim 1 in production.
7, the recombinant vaccine for enterohemorrhagic Escherichia coli O 157 bacterial strain that contains with good grounds claim 1, and the vaccine composition of one or more pharmaceutically acceptable carriers or vehicle.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810050967A CN101629158A (en) | 2008-07-17 | 2008-07-17 | Recombinant vaccine for enterohemorrhagic escherichia coli O157 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810050967A CN101629158A (en) | 2008-07-17 | 2008-07-17 | Recombinant vaccine for enterohemorrhagic escherichia coli O157 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101629158A true CN101629158A (en) | 2010-01-20 |
Family
ID=41574438
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810050967A Pending CN101629158A (en) | 2008-07-17 | 2008-07-17 | Recombinant vaccine for enterohemorrhagic escherichia coli O157 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101629158A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012037779A1 (en) * | 2010-09-25 | 2012-03-29 | 中国人民解放军军事医学科学院微生物流行病研究所 | FUSION PROTEIN SAmB, CODING GENE AND APPLICATION THEREOF |
| CN104099364A (en) * | 2014-07-15 | 2014-10-15 | 遵义医学院 | Method for researching stability of recombinant bifidobacteria vaccine for taenia solium |
| CN108018228A (en) * | 2017-09-28 | 2018-05-11 | 江苏省农业科学院 | One plant of Escherichia coli O 157:H7 low virulent strains and its application |
| CN111948397A (en) * | 2020-06-09 | 2020-11-17 | 江苏海洋大学 | Double-antibody sandwich ELISA method for rapidly detecting Escherichia coli O157: H7 |
| CN112851769A (en) * | 2014-01-27 | 2021-05-28 | 分子模板公司 | Deimmunized Shiga toxin subunit A effector polypeptides for use in mammals |
| RU2816500C1 (en) * | 2023-12-21 | 2024-04-01 | Федеральное государственное бюджетное учреждение "Всероссийский государственный Центр качества и стандартизации лекарственных средств для животных и кормов" (ФГБУ "ВГНКИ") | Strain of bacteria escherichia coli - producer of shiga-like toxin 2 (stx2) |
-
2008
- 2008-07-17 CN CN200810050967A patent/CN101629158A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012037779A1 (en) * | 2010-09-25 | 2012-03-29 | 中国人民解放军军事医学科学院微生物流行病研究所 | FUSION PROTEIN SAmB, CODING GENE AND APPLICATION THEREOF |
| CN112851769A (en) * | 2014-01-27 | 2021-05-28 | 分子模板公司 | Deimmunized Shiga toxin subunit A effector polypeptides for use in mammals |
| CN104099364A (en) * | 2014-07-15 | 2014-10-15 | 遵义医学院 | Method for researching stability of recombinant bifidobacteria vaccine for taenia solium |
| CN108018228A (en) * | 2017-09-28 | 2018-05-11 | 江苏省农业科学院 | One plant of Escherichia coli O 157:H7 low virulent strains and its application |
| CN111948397A (en) * | 2020-06-09 | 2020-11-17 | 江苏海洋大学 | Double-antibody sandwich ELISA method for rapidly detecting Escherichia coli O157: H7 |
| RU2816500C1 (en) * | 2023-12-21 | 2024-04-01 | Федеральное государственное бюджетное учреждение "Всероссийский государственный Центр качества и стандартизации лекарственных средств для животных и кормов" (ФГБУ "ВГНКИ") | Strain of bacteria escherichia coli - producer of shiga-like toxin 2 (stx2) |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Vendrell et al. | Lactococcus garvieae in fish: a review | |
| CN101117627B (en) | Pig epidemic diarrhea virus attenuated vaccine strain and uses thereof | |
| EP2522358B1 (en) | Peptides against rotavirus infection | |
| CN103725651B (en) | One plant of Porcine epidemic diarrhea virus and its application | |
| CN101144062B (en) | Lactobacillus casei strain and application for products thereof in bird immunity | |
| US6656478B1 (en) | Cross-protective salmonella vaccines | |
| CN102895677B (en) | Multivalent carrier vaccine for shrimp and application thereof | |
| JP2013522315A (en) | Method of using Bacillus subtilis strains for the prevention and treatment of gastrointestinal conditions | |
| CN101629158A (en) | Recombinant vaccine for enterohemorrhagic escherichia coli O157 | |
| CA2930645A1 (en) | Fish vaccine | |
| JP4565057B2 (en) | Novel lactic acid bacteria with high ability to induce immunoglobulin A | |
| CN101575586B (en) | Bordetella bronchiseptica gene deleted vaccine and application | |
| WO2016119078A1 (en) | Combined use of haemophilus parasuis lc strain and lz-20100109 strain | |
| JP2838098B2 (en) | Salmonella live vaccine | |
| CN110075289A (en) | A kind of haemophilus parasuis, Streptococcus suis and Actinobacillus pleuropneumoniae triple inactivated vaccine and its application | |
| CN108410784A (en) | It Streptococcus suis △ CPS/SsnA-mSly (P353L)-SC19 engineering bacterias and is applied in vaccine | |
| CN110079477B (en) | Lactobacillus plantarum for preventing and treating pullorum disease salmonella, preparation and application thereof | |
| TW200843789A (en) | Vaccine against fish-pathogenic bacteria | |
| JP6117336B2 (en) | Newly isolated Bacillus licheniformis and probiotics using it | |
| CN103933561A (en) | Porcine epidemic diarrhea live vaccine | |
| KR20040033616A (en) | Pediococcus pentosaceus CBT-8 which produces antimicrobial materials for restraining Helicobacter pylori and Listeria monocytogenes, and Production method of antimicrobial materials from Pediococcus pentosaceus CBT-8, and Application process for functional foods and/or drugs using the strain and the antimicrobial materials | |
| CN104248761B (en) | A kind of vaccine combination and its preparation method and application | |
| CN102949713B (en) | Bacillus subtilis multi-valent vector-based vaccine and application thereof | |
| CN103421731B (en) | A kind of haemophilus parasuis attenuation salmonella seedling | |
| CN110124022A (en) | A kind of mycoplasma hyopneumoniae and haemophilus parasuis, Streptococcus suis, Actinobacillus pleuropneumoniae tetrad inactivated vaccine and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100120 |