CN104248761B - A kind of vaccine combination and its preparation method and application - Google Patents
A kind of vaccine combination and its preparation method and application Download PDFInfo
- Publication number
- CN104248761B CN104248761B CN201410289029.6A CN201410289029A CN104248761B CN 104248761 B CN104248761 B CN 104248761B CN 201410289029 A CN201410289029 A CN 201410289029A CN 104248761 B CN104248761 B CN 104248761B
- Authority
- CN
- China
- Prior art keywords
- streptococcus suis
- albumen
- vaccine
- antigen
- csfv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/09—Lactobacillales, e.g. aerococcus, enterococcus, lactobacillus, lactococcus, streptococcus
- A61K39/092—Streptococcus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/521—Bacterial cells; Fungal cells; Protozoal cells inactivated (killed)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5254—Virus avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/24011—Flaviviridae
- C12N2770/24311—Pestivirus, e.g. bovine viral diarrhea virus
- C12N2770/24334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Abstract
The present invention relates to veterinary biologics field.More particularly it relates to CSFV, the vaccine combination and preparation method thereof of Streptococcus suis, the composition include CSFV, Streptococcus suis antigen.The invention further relates to be used to prepare prevention by the vaccine combination and/or treat the application of disease and the composition that as CSFV, Streptococcus suis caused by infects related to CSFV, Streptococcus suis.
Description
Technical field
The present invention relates to veterinary biologics field, more particularly to a kind of vaccine combination and preparation method thereof and answers
With.More particularly it relates to CSFV (classical swine fever virus), Streptococcus suis
The vaccine combination of (Streptococcus suis) and preparation method thereof, the composition include CSFV, Streptococcus suis
Antigen.The invention further relates to the vaccine combination is used to prepare prevention and/or treated related to CSFV, Streptococcus suis
Disease and the composition infected as caused by CSFV, Streptococcus suis application.
Background technology
Streptococcus suis is a kind of important porcine pathogen, can cause many pathologic conditions such as arthritis, endocarditis, brain
Film inflammation, pneumonia and septicaemia.The important zoonosis of its still people of the pig for contact stain or their accessory substance
Pathogen, cause meningitis and endocarditis.It is currently known 33 kinds of serotypes (1-31 types, 33 and based on capsular antigen
1/2 type), be the important cause of disease for causing Streptococcus suis, although also not exclusively understand be related to Streptococcus suis pathogenesis and
The mechanism of pathogenicity, but clinically Streptococcus suis often (is particularly tonsillotome as a kind of in bacterium, the respiratory tract for being usually colonized in pig
And nasal cavity), genital tract and alimentary canal, exist in the form of stealth is infected, show as subclinical infection.
Swine fever (classical swine fever, CSF) is by CSFV (classical swine fever
Virus, CSFV) caused by a kind of acute, heating, contagious infection, seriously endanger pig industry devastating infectious disease, have height
Spend infectiousness and lethal.The sick death rate is up to 80%-90%, and OIE (OIE) is classified as OIE diseases
Register, China are also classified as a kind of infectious disease.The preventing and treating of swine fever is always that whole world swine fever has the problem that state pays much attention to,
Substantial amounts of human and material resources have all been put into for this each state, and have achieved very big achievement.Vaccine inoculation at present is still control swine fever
Important means.But hog cholera vaccine immuning failure can be caused due to immunosupress, causes serious economic loss.
The content of the invention
Inventors have surprisingly discovered that hog cholera vaccine is immunized in the pig of subclinical infection Streptococcus suis, immunosupress can be caused,
Immune response can not effectively be caused, be a reason for causing immuning failure.
It is an object of the invention to overcome prior art defect, there is provided one kind prevention and/or treatment subclinical infection pig chain
The vaccine combination of coccus pig hog cholera vaccine immuning failure, the CSFV antigen comprising immune amount, Streptococcus suis antigen and
Veterinarily acceptable supporting agent.
Preferably, described CSFV antigen is the CSFV totivirus of attenuation, the CSFV totivirus of inactivation
Or play the CSFV subunit protein fragment of immunization；It is highly preferred that hog cholera of the CSFV antigen for attenuation
Malicious totivirus or the CSFV subunit protein fragment for playing immunization；It is further preferred that the CSFV of the attenuation
Totivirus is CSFV Lapinized strain, and the CSFV subunit protein fragment of described immunization is CSFV E2
Albumen；Most preferably, the CSFV E 2 protein amino acid sequence such as SEQ ID NO：Shown in 5..
Preferably, described Streptococcus suis antigen is the full bacterium of Streptococcus suis of attenuation, the full bacterium of Streptococcus suis inactivated or risen
The Streptococcus suis subunit protein fragment of immunization；It is highly preferred that Streptococcus suis of the described Streptococcus suis antigen for inactivation
Full bacterium or the Streptococcus suis subunit protein fragment for playing immunization；It is further preferred that the full bacterium of the Streptococcus suis of the inactivation
For the full bacterium of streptococcus suis 2-type of inactivation, the Streptococcus suis subunit protein fragment of described immunization is Streptococcus suis 38KDA
The combination of albumen, SaoA albumen or 38KDA albumen and SaoA albumen；Most preferably, the full bacterium of the streptococcus suis 2-type of the inactivation is
The full bacterium of streptococcus suis 2-type SC strains of inactivation, the pig hammer 38KDA protein amino acid sequences such as SEQ ID NO：It is described shown in 3
Streptococcus suis SaoA protein amino acid sequences such as SEQ ID NO：Shown in 4.
Preferably full bacterium antigen also includes Guangdong Winsun Bio-Pharmaceutical Co., Ltd. to the Streptococcus suis antigen of the present invention
The full bacterium of streptococcus suis 2-type HA9801 strains of inactivation contained by production streptococcus suis 2-type inactivated vaccine, the grand bioengineering of Shandong China have
Animal before the full bacterium of streptococcus suis 2-type BHZZ-L4 strains, Wuhan section contained by the Streptococcus suis inactivated propolis vaccines of limit company production
The full bacterium of streptococcus suis 2-type LT strains and pig chain contained by the Streptococcus suis inactivated vaccine of biological products Co., Ltd production
The full bacterium of type YZ strains of coccus 7.
Term " the full bacterium antigen of Streptococcus suis " refers to the complete thalline of Streptococcus suis cause of disease.
As one embodiment of the present invention, vaccine combination of the invention is by CSFV Lapinized strain totivirus
Antigen and the full bacterium antigen of streptococcus suis 2-type SC strains and the supporting agent composition of inactivation.
It is complete by CSFV Lapinized strain as another embodiment of the present invention, vaccine combination of the invention
Viral antigen and Streptococcus suis 38KDA albumen, SaoA albumen and supporting agent composition.
As another embodiment of the present invention, vaccine combination of the invention is by CSFV E 2 protein and inactivation
The full bacterium antigen of streptococcus suis 2-type SC strains and supporting agent composition.
As another embodiment of the present invention, vaccine combination of the invention is by CSFV E 2 protein and pig chain
Coccus 38KDA albumen, SaoA albumen and supporting agent composition.
Preferably, the pig hammer 38KDA protein amino acid sequences such as SEQ ID NO：Shown in 3；The Streptococcus suis
SaoA protein amino acid sequences such as SEQ ID NO：Shown in 4；The CSFV E 2 protein amino acid sequence such as SEQ ID NO：5
It is shown.
For animal pig, CSFV Lapinized strain totivirus content in vaccine combination of the present invention
For 105.0~106.0TCID50/ head part or CSFV subunit antigen CSFV E 2 protein content are 20-120 μ g/ml；Go out
The full bacterial content of streptococcus suis 2-type SC strains living is 109~1010CFU/ml or Streptococcus suis subunit antigen Streptococcus suis 38KDA
Protein content is that 10-100 μ g/ml, Streptococcus suis SaoA protein content are 50-300 μ g/ml.
It is highly preferred that CSFV Lapinized strain totivirus content is 10 in vaccine combination of the present invention6.0TCID50/ head
Part or CSFV subunit antigen CSFV E 2 protein content are 50 μ g/ml；The full bacterium of streptococcus suis 2-type SC strains of inactivation contains
Measure as 109CFU/mL or Streptococcus suis subunit antigen Streptococcus suis 38KDA protein contents are 50 μ g/ml, Streptococcus suis SaoA
Protein content is 150 μ g/ml.
The composition of the composition of the present invention or " the immune amount " of component are preferably " therapeutically effective amount ".It is described that " treatment has
Effect amount " refers to play their immunological role without causing excessive side effect institute necessary amounts in the host that composition is applied.
Composition used and the accurate amount of composition to be administered are by according to factor such as the type of disease treated, animal to be treated
Type and age, the mode of administration, and other compositions in composition and change.
Term " prevention ", which refers to, to be blocked or is prolonged by the symptom of its infection related to swine fever, strains of streptococcus or disease
Late；Term " treatment " refers to what is be alleviated or be completely eliminated by the symptom of the infection related to swine fever, strains of streptococcus or disease
Process.
Term " subclinical infection Streptococcus suis " is also known as " Streptococcus suis subclinical infection ", refers to and pig chain is carried in pig body
Coccus cause of disease, it is positive with Streptococcus suis serum, but without typical clinical symptom, characterizes health；Main field planting position is pig
The upper respiratory tract (particularly tonsillotome and nasal cavity), genital tract, alimentary canal, being invaded without other cause of diseases will not send out under nature
Disease.
Term " veterinarily acceptable supporting agent " includes any and whole adjuvants, stabilizer and such.
Term " adjuvant ", which refers to, to be added in the composition of the present invention to increase the material of the immunogenicity of composition.It is known
Adjuvant includes, but are not limited to：Oily adjuvant, water-soluble adjuvant, Alum adjuvant, Cytokine adjuvant.
Term used herein " oily adjuvant " is also known as " oil adjuvant " or " oil emulsion adjuvant ", is by including vegetable oil, animal
One or more of compositions in oil, mineral oil, for delaying RT of the immunogene in body, are allowed to continue slowly to release
Put, strengthen phagocytosis and the sterilizing ability of macrophage.
Term used herein " water-soluble adjuvant " is also known as " water-based adjuvant " or " water adjuvant ", is a kind of polymeric water-soluble
Dispersion, can be by high molecular weight polypropylene acids synthetic polymer group the effect of for improving water-soluble vaccines and security
Into.
Term used herein " Alum adjuvant ", also known as " aluminium glue adjuvant " or " aluminium adjuvant ", including aluminum hydroxide adjuvant and
Aluminium phosphate adjuvant, its major function is sustained release, but has the activation to immunocyte simultaneously.By antigen and aluminium hydroxide or
Aluminum phosphate hybrid injection, antigen can be made to be stored in injection site, there is antigen sustained release and nonspecific immunity stimulation.
Term used herein " Cytokine adjuvant ", including IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7,
IL-10, IL-12, IL-15, IL-18, INF- γ, GM-CSF, TNF-α, TNF-β, TCA-3 etc., also known as " cell factor " or " thin
Born of the same parents' element ", it is that the secretion of live body host cell by diffusion, cell contact or blood circulation reaches other cells of host, in body
A kind of non-immunoglobulin, local native protein or the glycoprotein to be played a role in liquid with extremely low concentration, and one kind is by body
The immunocyte of activation and some nonimmune cells produce, secretion, can adjust cell growth, differentiation, with hematopoiesis, inflammatory reaction,
The general designation of the closely related high activity multi-functional small molecules albumen such as immune response and wound healing, can stimulate or suppress
Immunologic function, promote cell development differentiation, regulation cell physiological function and cell-tocell transmission in immune response, immune
Very important regulating and controlling effect is played in system.
Effective dose is preferably suitable for the amount of the adjuvant of the composition of the present invention." effective dose " refers to adjuvant same
Played in host during antigen combined administration of the invention for their immunological role must or it is enough excessive without causing
Side effect institute necessary amounts.The accurate amount of adjuvant to be administered is by according to factor composition for example used and the class of the disease for the treatment of
Type, the type of animal to be treated and age, the mode of administration, and other compositions in composition and change.
Term " stabilizer " refers to the stability chemicals that can increase solution, colloid, solid, mixture, and it can slow down
Reaction, chemical balance is kept, reduce surface tension, prevent light, thermal decomposition or oxidation Decomposition etc. from acting on.Stabilization of the present invention
Agent espespecially heat resisting protective, including glutamic acid, aspartic acid, apple propylhomoserin, lactic acid, glucose, inositol, lactose, sucrose, cottonseed
Sugar, trehalose, sorbierite, DL- threonines, inositol, xylitol, arginine, histidine, albumin, stickiness albumen, gelatin, egg
White peptone, soluble starch, dextrin, gravy, pectin, Arabic gum, hydroxymethyl cellulose, algae, skim milk, serum etc. are wherein
One or more.
The present invention a purpose be to provide a kind of preparation method of vaccine combination, wherein, methods described includes：(1)
Prepare CSFV antigen, Streptococcus suis antigen；(2) CSFV antigen and Streptococcus suis antigen point prepared step (1)
Not Jia Ru supporting agent each prepare vaccine or in proportion mix after add supporting agent prepare polyvalent vaccine.
Preferably, the CSFV antigen and Streptococcus suis antigen prepared step (1) in step (2) is separately added into supporting agent
Each preparing vaccine includes：CSFV antigen addition heat resisting protective is prepared into freeze-dried live vaccine, and inactivation Streptococcus suis
Antigen simultaneously adds adjuvant and prepares inactivated vaccine.
Preferably, the CSFV antigen for preparing CSFV freeze-dried live vaccine is the CSFV totivirus of attenuation, is made
The Streptococcus suis antigen of standby Streptococcus suis inactivated vaccine is the full bacterium of Streptococcus suis of inactivation；It is highly preferred that the CSFV of attenuation
Totivirus is that CSFV emulsifies low virulent strain, and the full bacterium of Streptococcus suis of inactivation is the full bacterium of streptococcus suis 2-type of inactivation；Most preferably
Ground, the full bacterium of streptococcus suis 2-type of inactivation are the full bacterium of streptococcus suis 2-type SC strains of inactivation.
Preferably, the heat resisting protective that CSFV antigen adds is gelatin and lactose；The assistant that Streptococcus suis antigen adds
Agent is a kind of gel adjuvants in water-soluble adjuvant.
Preferably, with the Streptococcus suis inactivated vaccine dilute CSFV live vaccine, produce containing CSFV antigen,
The bivalent vaccine composition of Streptococcus suis antigen.
Preferably, after the CSFV antigen and Streptococcus suis antigen prepared step (1) in step (2) mixes in proportion
Addition supporting agent, which prepares polyvalent vaccine, to be included：CSFV antigen and Streptococcus suis antigen are mixed in proportion, add heat-resisting protective
Agent, which prepares freeze dried vaccine or adds adjuvant, prepares inactivated vaccine or subunit vaccine.
Preferably, the CSFV antigen for preparing freeze dried vaccine is the CSFV totivirus of attenuation, Streptococcus suis antigen
To play the Streptococcus suis subunit protein fragment of immunization；It is highly preferred that the CSFV totivirus of attenuation is CSFV
Emulsify low virulent strain, rise immunization Streptococcus suis subunit protein fragment for Streptococcus suis 38KDA albumen, SaoA albumen or
The combination of 38KDA albumen and SaoA albumen；Most preferably, pig hammer 38KDA protein amino acid sequences such as SEQ ID NO：3 institutes
Show, Streptococcus suis SaoA protein amino acid sequences such as SEQ ID NO：Shown in 4.
Preferably, the CSFV antigen for preparing inactivated vaccine has been the CSFV subunit protein piece of immunization
Section, Streptococcus suis antigen are the full bacterium of Streptococcus suis of inactivation；It is highly preferred that play the CSFV subunit protein piece of immunization
Section is CSFV E 2 protein, and the full bacterium of Streptococcus suis of inactivation is the full bacterium of streptococcus suis 2-type of inactivation；Most preferably, hog cholera
Malicious E2 protein amino acid sequences such as SEQ ID NO：Shown in 5, the full bacterium of streptococcus suis 2-type of inactivation is the streptococcus suis 2-type of inactivation
The full bacterium of SC strains.
Preferably, the CSFV antigen for preparing subunit vaccine has been the CSFV subunit protein piece of immunization
Section, Streptococcus suis antigen has been the Streptococcus suis subunit protein fragment of immunization；It is highly preferred that play the swine fever of immunization
Viral sub-units protein fragments are CSFV E 2 protein, and the Streptococcus suis subunit protein fragment for playing immunization is pig hammer
The combination of bacterium 38KDA albumen, SaoA albumen or 38KDA albumen and SaoA albumen；Most preferably, CSFV E 2 protein amino acid
Sequence such as SEQ ID NO：Shown in 5, pig hammer 38KDA protein amino acid sequences such as SEQ ID NO：Shown in 3, Streptococcus suis SaoA
Protein amino acid sequence such as SEQ ID NO：Shown in 4.
A variety of methods well known by persons skilled in the art can be passed through by playing the preparation of the subunit protein fragment of immunization
Carry out, including genetic engineering means, such as pass through the clone comprising polynucleotides of the present invention or expression vector.Term " carrier " relates to
And it is designed to the polynucleotide constructs of transduction/transfection one or more cell type.Carrier can be, such as " clone
Carrier ", it is designed to the nucleotides for separating, breeding and replicating insertion；" expression vector ", it is designed to thin in host
Nucleotide sequence is expressed in born of the same parents；Or " viral vector ", it is designed to produce recombinant virus or virus-like particle；Or " shuttle
Carrier ", it includes the property of the carrier of more than one type.It is adapted to prepare CSFV of the present invention, Streptococcus suis subunit egg
It is adjoint that the publicly available carrier of white tiles section includes plasmid, adenovirus, baculoviral, yeast baculoviral, plant virus, gland
Virus, retroviruse, herpes simplex virus, α viruses, slow virus etc., can also be built as carrier method.This
The preparation of invention CSFV, Streptococcus suis subunit protein fragment also includes realizing by artificial synthesized mode.
Preferably, the heat resisting protective of addition is gelatin and lactose.
Preferably, the adjuvant of addition is a kind of gel adjuvants in water-soluble adjuvant.
It is a further object to provide a kind of vaccine combination to prepare prevention and/or treatment subclinical infection pig
Application in the medicine of streptococcus pig hog cholera vaccine immuning failure and preparing prevention and/or treatment CSFV, pig chain
It is in coccus relevant disease or the medicine of infection and apply.
The present invention has advantage following prominent：
(1) a kind of the reason for present invention have found hog cholera vaccine immuning failure first --- Streptococcus suis subclinical infection,
It is immunized using vaccine combination of the present invention, can solves the problems, such as hog cholera vaccine immuning failure；
(2) the Streptococcus suis 38KDA albumen and SaoA protein combinations that vaccine combination of the present invention includes, which can induce, produces association
The immune effect of same-action；
(3) containing two or more antigen, the combined vaccine of two or more disease can be prevented with its side
Just the characteristics of, multiple-effect, low cost turn into vaccine research of new generation；Compared with single vaccine, combined vaccine can reduce vaccine
Inoculation times, avoid that because leaking kind Full-access immunization can not be obtained；In addition, vaccine is mostly thermo-labile, it produces, transported, storage is
To all being both needed to carry out at a lower temperature using process, i.e., so-called " cold chain ", this cold chain running all linked with one another, expense
It is high, vaccine cost is remained high, and use combined vaccine, then the expense of cold chain running can be substantially reduced, therefore have
Significant superiority；
(4) vaccine combination of the invention be it was unexpectedly observed that can strengthen the immune response of CSFV antigen, and such as this
Invention subsequent embodiment is proved, in the case where hog cholera vaccine failure is immunized in the pig of Streptococcus suis subclinical infection, this
Invention vaccine combination can produce good immune response, and this exceeds those of ordinary skill in the art's expectation.
Embodiment
The invention will now be further described with reference to specific embodiments, and advantages of the present invention and feature will be with description more
To be clear.But these embodiments are only exemplary, do not form any restrictions to the scope of the present invention.Those skilled in the art
It should be understood that the details and form of technical solution of the present invention can be carried out without departing from the spirit and scope of the invention
Modifications or substitutions, but these modifications and replacement are each fallen within protection scope of the present invention.
In the embodiment of the present invention PBS used unless otherwise instructed, using pH7.4 PBS, compound method：
NaCl8.0g, KCl0.2g, KH2PO40.24g, Na2HPO4·12H2O3.628g, it is dissolved in 800ml distilled water, pH is adjusted with hydrochloric acid
It is worth for 7.4, distilled water is settled to 1000ml, 121 DEG C of autoclaving 20min, room temperature preservation.
CSFV Lapinized strain involved in the present invention is purchased from ZhongGuanCun south Street, Haidian District, BeiJing City 8, in
The preservation of veterinary medicament supervision institute of state, preserving number AV1412；Streptococcus suis 2-type SC strains, by the limited public affairs of Pu Laike bioengineering shares
Department's separation, is preserved in China typical culture collection center preservation (CCTCC), numbering CCTCCM2011351, address is Hubei
Wuchang, wuhan area of province Luo Jia Shan road 16 Wuhan University, preservation date are on October 12nd, 2011；Streptococcus suis 2-type
CVCC606 bacterial strains are purchased from China Veterinery Drug Inspection Office of BeiJing, China；The strong arsenic bloom door system strain of CSFV is purchased from Chinese animal doctor
Medicine supervises institute.
Embodiment 1
The preparation of swine fever, Streptococcus suis antigen
The preparation of 1 swine fever antigen
1.1 by the ST cell (be purchased from ATCC) high sensitive to CSFV Lapinized strain for growing up to good individual layer with containing
The digestive juice of 0.125% pancreatin and 0.03%EDTA, carry out digestion and disperse, Tissue Culture Flask is inoculated with after cell count, add 3%
The MEM cell culture fluids of calf serum, while connect toxic agent amount according to M.O.I.=0.1 and add kind of a poison, it is placed in 37 DEG C of incubators
Row culture.
Culture is carried out receiving poison for the first time after three days, and the cell maintenance medium containing 1.5% calf serum is added after receiving poison, later every
Poison was received every 2 days once, can continuously receive poison 5 times.Antigen is mixed after receipts poison and is placed in -20 DEG C of storages.
1.2 CSFV assays：IIF progress TCID is respectively adopted in each time virus-culturing fluid of receiving50Survey
It is fixed.It is 10 per ml viral levels6.5TCID50。
The preparation of 2 Streptococcus suis antigens
The breeding of 2.1 first order seeds
Streptococcus suis 2-type SC strains freeze-drying lactobacillus is diluted with buffering martin's bouillon, streak inoculation is in Clumbia sheep blood respectively
Agar (French Cimmeria company), 37 DEG C culture 24h, selection have obvious zone of hemolysis, smooth, slightly larger colony inoculation in
Clumbia sheep blood agars (French Cimmeria company) inclined-plane, 37 DEG C of 18~24h of culture are as first order seed.
The breeding of 2.2 secondary seeds
The blood agar slant culture of first order seed is rinsed with a small amount of buffering martin's bouillon, is inoculated in containing 1.5% (v/v) calf
The buffering martin's bouillon of cow's serum, while 0.2% glucose (being proportionally added into after 50% solution sterilization is made) is added, 37 DEG C are quiet
16~18h of culture is put, is secondary seed after examining purely.
Buffer the preparation of martin's bouillon：By peptone 20g, sodium chloride 2g is added in 1000ml steamed beef soup, it is heated to 80~
90 DEG C, be 7.2 with sodium hydroxide adjustment pH value, then is slowly added into disodium hydrogen phosphate 1g, sodium acid carbonate 2g, is boiled 90 minutes, quiet
Put 2~8h, Aspirate supernatant, 116 DEG C of autoclavings 40 minutes, pH value is 7.6~8.0 after sterilizing.Glucose is made into 50%
Solution, 116 DEG C of autoclavings 30 minutes, added in inoculation.
The preparation of 2.3 seedling bacterium solutions
Buffering martin's bouillon is preheated to 37 DEG C or so, by 10%~20% inoculation secondary seed solution, 37 DEG C of quiescent cultures
16~18h, shaken 2~3 times during culture, after harvest bacterium solution does purely inspection, put 2~8 DEG C and save backup.
It is prepared by 2.4 antigens
Nutrient solution is carried out with Mi Libo (Millipore companies) film bag (molecule interception is 1000Kda dalton) dense
Contracting, is pressed《Republic of China Veterinary Pharmacopoeia》(version in 2005) annex method carries out count plate, and inactivates.The pig hammer of preparation
The type SC strains antigenic content of bacterium 2 is before inactivation 1011CFU/ml。
The preparation of 3 Streptococcus suis subunit antigens
3.1 material
The pMD18-T carriers that the present invention uses are purchased from precious bioengineering (Dalian) Co., Ltd, bacillus coli DH 5 alpha impression
State is purchased from precious bioengineering (Dalian) Co., Ltd.
Escherichia coli culture medium:LB liquid mediums and solid medium (every liter of 5g containing yeast extract, tryptone
10g, NaCl10g, pH to 7.5 is adjusted with 10mol/LNaOH, 121 DEG C of autoclaving 20min, 4 DEG C save backup.At every 100 milliliters
It is solid LB media that 1.5g agar is added in LB fluid nutrient mediums, and 121 DEG C of autoclaving 20min, 4 DEG C save backup).
Design of primers and synthesis：
According to the 38KDA gene orders shown in SEQ ID NO.1, upstream primer is designed
CGGGATCCCGATGGATATTAGACAGGTTAGA and anti-sense primer GCTGCAGCTTAGTTCTTAAAGCTATGA amplifications 38KDA
Gene.Primer is synthesized by Shanghai Sheng Gong bioengineering Co., Ltd.
According to the SaoA gene orders shown in SEQ ID NO.2, sense primer is designed
AAAGGATCCGCAACCTGATGGGGGAC and anti-sense primer GGGCTGCAGTCATTACATTGCTTCCTTA amplification SaoA genes.
Primer is synthesized by Shanghai Sheng Gong bioengineering Co., Ltd.
It is prepared by 3.2 antigen proteins
Streptococcus suis 2-type strain CVCC606 strains are inoculated in the TSA solid mediums containing 10% inactivation NBCS
On (being purchased from Sigma companies), picking single bacterium colony is inoculated in TSB fluid nutrient mediums (being purchased from Sigma companies), is placed in shaking table
(150r/min), 37 DEG C of concussion and cultivates are stayed overnight.
Carried in accordance with TIANGEN bacterial genomes extracts kit (being purchased from Wuhan strong wind Bioisystech Co., Ltd) specification
The operating method extraction genomic DNA of confession.
PCR reaction systems are shown in Table 1.
The PCR reaction systems of table 1
| Genomic templates | 3μl |
| 10XPCR Buffer(Mg2+plus) | 5μl |
| Upstream and downstream primer (50pmol/ μ l) | 2X0.5μl |
| Taq enzyme | 2μl |
| Sterile deionized water | 35μl |
| 2.5mmol/L dNTP Mixture | 4μl |
Response procedures are:94 DEG C of pre-degeneration 5min；94℃1min；52 DEG C, 30sec, 72 DEG C, 1min, 30 circulations；Extension
72℃10min。
PCR primer reclaims:Tried using the UNIQ-10 pillar DNA glue reclaims of Shanghai Sheng Gong biotechnologies Co., Ltd
Agent box reclaim DNA fragmentation, according to the centrifugal DNA gel QIAquick Gel Extraction Kit of UNIQ-10 pillars specification the step of carry out.
The TA clones of antigen gene：Respectively by target gene 38KDA albumen, the PCR recovery products of SaoA albumen and carrier
PMD18-T is attached reaction overnight in 16 DEG C of water-baths, converts DH5 α competent cells, 37 DEG C are containing ampicillin
Cultivated on the LB solid mediums of (AMP, 50 μ g/mL), therefrom select multiple single bacterium colonies at random, be respectively put into containing ammonia benzyl mould
37 DEG C of cultures therefrom extract plasmid after 12 hours in the LB fluid nutrient mediums of plain (AMP, 50 μ g/mL), are screened after digestion is identified
Positive recombinant plasmid is obtained, is respectively designated as pMD-38KDA and pMD-SaoA.
The double digestion identification of recombinant plasmid:Utilize BamHI and PstI difference digestion pMD-38KDA and pMD-SaoA expression matter
Grain, the purpose fragment and carrier segment for occurring expected size after digestion are correct recombinant plasmid.
The structure of recombinant strains:Be separately recovered above-mentioned steps digestion products 38KDA and SaoA, and respectively with pQE30
(BamHI with PstI linearization for enzyme restriction) connects overnight in 16 DEG C of water-baths.Connection product converts JM109 competent cells, in 37 DEG C
Cultivated on LB solid mediums, therefrom select multiple single bacterium colonies at random, be respectively put into 37 DEG C of culture 12h in LB fluid nutrient mediums
Therefrom extract plasmid afterwards, after digestion is identified screening obtain positive recombinant plasmid, and be respectively designated as pQE30-38KDA and
pQE30-SaoA。
The induced expression of target gene:By pQE30-38KDA containing recombinant plasmid and pQE30-SaoA expression inoculation
In the 3ml LB fluid nutrient mediums containing 25 μ g/ml Kna, in 37 DEG C of shaking table cultures.100 μ l are taken to connect from cultured bacterium solution
Kind is in the fresh LB fluid nutrient mediums that 10mL contains 25 μ g/ml Kna, in 37 DEG C of shaken cultivation about 3h, to OD600Reach 0.6-
When 1.0, add IPTG to final concentration of 0.8mmol/l, continue to collect thalline after cultivating 3h.
Recombination bacillus coli after induction is centrifuged into 15min in 8000r/min.The 50mMTris- of 1/10 volume of precipitation
Cl (pH5.0) is resuspended, and adds lysozyme to final concentration lmg/ml, ice bath 30min.It is broken broken that ultrasound is carried out under condition of ice bath, directly
No longer sticky, the 10000r/min to bacterium solution, centrifuge 30min.Collect albumen.It is dense with Bradford albuminometries measurement albumen
Degree, and will be adjusted to 1mg/ml with the PBS solution that PH is 7.4 respectively.
Embodiment 2
The preparation of swine fever, Streptococcus suis vaccine combination
Form is used in combination in 1 inactivated vaccine dilution live vaccine
1.1 Examples 1 prepare swine fever totivirus antigen, add heat resisting protective (2wt% aqueous gelatin solutions with
15wt% lactose aqueous solutions are with 1:1 (v/v) ratio is prepared) with 1:Fully mixed after the mixing of 1 (v/v) ratio, quantitative separating, rapidly
Carry out vacuum freezedrying, as live vaccines of hog cholera.
The full bacterium antigen of Streptococcus suis prepared by 1.2 Examples 1, it is added slowly to (the France's match of water-soluble adjuvant gel adjuvants
BIC Corp) in, constantly with rotating speed it is 800rpm mulsers stirring 12min during adding, mixes, 4 DEG C of preservations, as pig chain
Coccus inactivated vaccine.
1.3 with Streptococcus suis inactivated vaccine in use, dilute live vaccines of hog cholera, and vaccine specifically matches somebody with somebody such as table 2.
The swine fever of table 2, the composition proportion of Streptococcus suis vaccine combination
2 Streptococcus suis subunit antigens are combined with swine fever antigen prepares freeze dried vaccine
Swine fever totivirus antigen prepared by Example 1 with Streptococcus suis 38KDA albumen and SaoA proteantigens in proportion
Mixing, adding heat resisting protective, (2wt% aqueous gelatin solutions are with 15wt% lactose aqueous solutions with 1:1 (v/v) ratio is prepared) with 1:1
(v/v) fully mixed after ratio mixing, quantitative separating, carry out vacuum freezedrying rapidly, as swine fever, Streptococcus suis bigeminy is frozen
Dry vaccine combination.Specific proportioning is shown in Table 3.
The composition proportion of the swine fever of table 3, Streptococcus suis freeze dried vaccine composition
Embodiment 3
The Study On Immunogenicity of swine fever, Streptococcus suis vaccine combination
The immune programme for children of 1 piglet
It is by the negative piglet 170 of 25-30 ages in days swine fever, Streptococcus suis antigen-antibody, 17 groups of experiment point, 1-2 groups
The immune group of vaccine 1,3-4 groups are the immune group of vaccine 2, and 5-6 groups are the immune group of vaccine 3, and 7-8 groups are the immune group of vaccine 4, the
9-10 groups are the immune group of vaccine 5, and 11-12 groups are the immune group of vaccine 6, and 13-14 groups are the immune group of vaccine 7, and 15-17 groups are
PBS control group.Every pig injection 1ml of PBS control group matches the PBS of 10% (V/V) gel adjuvants, every pig neck of vaccine immunity group
Portion's intramuscular injection vaccine 1ml, single immunization.
2 immune piglet protest tests
21 days after immune, the 1st group, the 3rd group, the 5th group, the 7th group, the 9th group, the 11st group, the 13rd group, the 15th group are used respectively
The strong arsenic bloom door system strain intramuscular injection 1ml (10 of CSFV5MLD), observe 14 days, immune group is all protected, and the 15th group whole
Morbidity.Streptococcus suis 2-type is used respectively to the 2nd group, the 4th group, the 6th group, the 8th group, the 10th group, the 12nd group, the 14th group, the 16th group
Velogen strain SC strains carry out intraperitoneal injection and attack poison, attack toxic agent amount as 5 × 108CFU, observed 10 days after attacking poison, the daily set time is seen
Examine clinical condition.Daily clinical score is the posture of every animal and the summation of motility scoring, and it is based on nerve, flesh bone
Or the index of respiratory disease is as follows：
Posture：
Normal postures of 0=and to stimulate the reaction
1=is inactive and reacts slow；Eye nose has secretion
2=only has reaction to the stimulation repeated, apathy
3=is inactive, reactionless, and environment is not realized
4=is dead
Motility：
0=normal gaits and position
1=slightly misaligneds, it is lame, and/or arthroncus, but there is no auxiliary to stand
2=is obvious uncoordinated or lame, but does not have auxiliary to stand
Lame, imbalance serious 3=, it is impossible to keep standing
4=is dead
As a result start clinical symptoms occur after 24 hours after the 16th group of piglet under this attacks toxic agent amount attacks poison, show as body temperature
Suddenly persistently raise, walk lamely, lie prone it is sleeping, tremble, do not feed, four limbs are struck and all dead in 5 days after poison is attacked；The He of immune group 2
The all protections of immune group 4；Immune group 6 dead 1,9 head protections have no obvious clinical symptoms；Immune group 8 and immune group 10 are each dead
1 is died, remaining protection has no obvious clinical symptoms；Immune group 12 dead 3, remaining survival, wherein 2 of short duration clinical body occur
Levy and gradually recover after 36 hours normal；Immune group 14 dead 2, remaining survival, wherein 2 of short duration clinical sign occur simultaneously
Gradually recover after 36 hours normal.17th group of PBS control group survival, phenomenon without exception occur.Concrete outcome is shown in Table 4.
Table 4 is immunized piglet and attacks poison protection result
Judge for animal, the clinical sign for assessing disease is carried out in the case of all individual immunities are not known
, clinical score the results are shown in Table 5.Clinical score is by the measure to disease indicators and combines the death rate and the incidence of disease, uses
Mann-Whitney is analyzed to compare effect of the vaccine to clinical score.As a result vaccine 1, vaccine 2, vaccine 3, the and of vaccine 4 are shown
Not significantly (P ＞ 0.05), vaccine 6 and the difference of vaccine 7 is not notable (P ＞ 0.05), and vaccine 1, vaccine for the immune effect difference of vaccine 5
2nd, vaccine 3, vaccine 4, vaccine 5 are extremely notable (P ＜ 0.01) with difference between vaccine 6, vaccine 7, and all vaccine immunity groups are attacked together
Difference is extremely notable (P ＜ 0.01) between malicious control group.
Piglet streptococcus suis infection clinical score result is immunized in table 5
| Group | 1 day | 2 days | 3 days | 4 days | 5 days | 6 days | 7 days | 8 days | 9 days | 10 days |
| 2 | 1.2 | 2 | 2.2 | 1.6 | 0 | 0 | 0 | 0 | 0 | 0 |
| 4 | 1 | 2 | 1.8 | 1.4 | 0 | 0 | 0 | 0 | 0 | 0 |
| 6 | 1 | 2 | 2.1 | 1.8 | 1.6 | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 |
| 8 | 1.2 | 1.6 | 2 | 1.8 | 1.4 | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 |
| 10 | 1 | 2 | 1.8 | 1.8 | 1.4 | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 |
| 12 | 1.6 | 3.2 | 3.8 | 4.3 | 4 | 3.6 | 3.4 | 3 | 3 | 2.5 |
| 14 | 1.4 | 3.2 | 3.8 | 4 | 3.4 | 3 | 3 | 2.6 | 2.4 | 2.2 |
| 16 | 4.2 | 6.2 | 6.8 | 7.4 | 8 | 8 | 8 | 8 | 8 | 8 |
Pass through the immune efficacy clinic evaluation result correlation of more each vaccine, it can be seen that vaccine 3, vaccine 4 and vaccine 5
Immune effect to be significantly higher than vaccine 6 and vaccine 7.Demonstrate the present invention and include Streptococcus suis subunit antigen 38KDA albumen
It is better than single antigen vaccine with the vaccine combination immune effect of two kinds of antigens of SaoA albumen, by comparing vaccine to clinic
The influence of disease, vaccine combination clinical disease of the present invention illustrate vaccine combination of the present invention considerably less than single antigen vaccine
Comprising Streptococcus suis subunit antigen 38KDA albumen and SaoA albumen two kinds of antigens synergy enhance immune response, go out
What people expected has reached preferable immune protective effect.
Embodiment 4
Streptococcus suis subclinical infection is tested
15-20 age in days Streptococcus suis antigen-antibody feminine genders are had no to the piglet 30 of other pathogen infections, random point 3 groups,
Every group 10.Wherein the 1st group of artificial collunarium infection streptococcus suis 2-type velogen strain SC strain, dosage 105CFU；2nd group of artificial mark spraying
Mist infects streptococcus suis 2-type velogen strain SC strains, dosage 105CFU；3rd group compares.Observation 10 days, the 1st group and the 2nd group without
Obvious clinical symptoms, the 3rd group of phenomenon without exception occur.By aseptic collection nose swab carry out Streptococcus suis separation, as a result the 1st group
Streptococcus suis is all separated to the 2nd group, the 3rd group is not separated to Streptococcus suis.Concrete outcome is shown in Table 6.
The Streptococcus suis subclinical infection of table 6 experiment Streptococcus suis separation situation
| Group | Mode of infection | Infective dose (CFU) | Quantity | Bacteria distribution rate (%) |
| 1st group | Collunarium | 105 | 10 | 100 |
| 2nd group | Spraying | 105 | 10 | 100 |
| 3rd group | — | — | 10 | 0 |
Detected by PCR, all pigs are not detected by Streptococcus suis bacteremia before the test.Artificial challenge the 7th day, the
1 group and the 2nd group has 6 and 5 hair live pig strepticemias respectively；Artificial challenge the 10th day, the 1st group and the 2nd group all sends out
Raw bacteremia；3rd group of control group phenomenon without exception occurs, and does not detect Streptococcus suis bacteremia all the time.Concrete outcome is shown in Table 7.
The test pig Streptococcus suis bacteremia testing result of table 7
Prove after a small amount of Streptococcus suis of artificial challenge, a number of bacterium is carried in pig body, and then bacterium occurs
Mass formed by blood stasis, but with regard to its whole experiment during, infection pig is without obvious clinical sign.Analysis Streptococcus suis subclinical infection causes
The reason for hog cholera vaccine immuning failure, although infected pig surface still appears to keep fit, subclinical infection pig
Bacteremia occurs for streptococcus, can cause its compromised immune, immunity degradation, immunological unresponsiveness reaction, cause immuning failure,
The generation of clinical symptom can be particularly caused in the case of exogenous pathogen intrusion.
Embodiment 5
Swine fever, Streptococcus suis vaccine combination are tested the immune effect of subclinical infection Streptococcus suis
The immune programme for children of 1 piglet
By the negative piglet 60 of 15-20 ages in days swine fever, Streptococcus suis antigen-antibody, random point 6 groups, every group 10, its
In the 2nd group, the 3rd group and the 4th group artificial collunarium infection streptococcus suis 2-type velogen strain SC strain, dosage 105CFU.Observed after infection
Occur without obvious clinical symptoms, the 1st group, the 5th group and the 6th group phenomenon without exception within 10 days, the 2nd group, the 3rd group and the 4th group.
Observation carries out vaccine immunity after 10 days, wherein the live vaccine of vaccine 2 prepared by the 1st group and the 2nd group immune embodiment 2
Part live vaccines of hog cholera, vaccine 2 prepared by the 3rd group of immune embodiment 2, vaccine 5 prepared by the 4th group of immune embodiment 2, the 5th group
It is immunized with the 6th group.Every pig musculi colli of vaccine immunity group vaccinates 1ml, single immunization.
2 antibody detections
Taken a blood sample weekly after immune, after separating serum, detected using the blocking ELISA kit of IDEXX companies production
Hog cholera antibody, specific testing result are shown in Table 8.After the live vaccine partial immunity for showing the 1st group of vaccine 2, antibody against swine fever virus is presented
The trend of liter, 21 days after being immunized, hog cholera antibody blocking rate is positive up to 47%；3rd group and the 4th group of vaccine difference immune vaccine 2
With vaccine 5, antibody against swine fever virus is also in rising trend, and 21 days after being immunized, antibody blocking rate respectively reaches 51% and 45%, is in
It is positive；And the live vaccine part of the 2nd group of immune vaccine 2 after artificial subclinical infection Streptococcus suis, however, its CSFV resists
Body is horizontal little with immune preceding change, and 21 days after being immunized, hog cholera antibody blocking rate is feminine gender still≤30%；5th group and the 6th
Group occurs without infection, without immune group, phenomenon without exception, and antibody level is negative.Demonstrate the 2nd group of CSFV immuning failure
The Streptococcus suis that has been due to subclinical infection, it is unresponsive after single hog cholera vaccine is immune, and the swine fever of the present invention, Streptococcus suis
Vaccine combination but can still cause hog cholera antibody immune response in the case of same subclinical infection Streptococcus suis, 21 days
Afterwards, hog cholera antibody is positive, and exceeds those skilled in the art's expectation.
Piglet produces the dynamic change (10 average value) of antibody against swine fever virus after the vaccine immunity of table 8
Judge that blocking rate=(N-S)/N*100%, wherein N is standard negative control OD values, and S is sample blood with blocking rate
Clear detection OD values.The average OD of negative control450More than 0.50, the blocking rate of positive control is more than 50%, the testing result into
It is vertical.Serum to be checked works as blocking rate >=40%, is judged to the positive；When blocking rate≤30%, feminine gender is judged to；When blocking rate is between 30%-
Between 40%, it is judged to suspicious.
3 protest tests
4 groups of immune swines and the 5th group of control group were noted with the strong arsenic bloom door system strain muscle of CSFV respectively in 28 days after immune
Penetrate 1ml (105MLD), observe 14 days, the 1st group, the 3rd group and the 4th group of immune group is all protected, the 2nd group of immune group with attack poison
All morbidity is dead for the 5th group of control group, and the 6th group of control group survival, phenomenon without exception occurs.Concrete outcome is shown in Table 9.
Table 9 is immunized piglet and attacks within 28 days poison protection result
| Group | Body temperature (>=40.5 DEG C) | Clinical symptoms | Pathological change | Protective rate (%) |
| 1 | 0/10 | 0/10 | 0/10 | 100 |
| 2 | 10/10(≥7) | 10/10 | 10/10 | 0 |
| 3 | 0/10 | 0/10 | 0/10 | 100 |
| 4 | 0/10 | 0/10 | 0/10 | 100 |
| 5 | 10/10(≥7) | 10/10 | 10/10 | 0 |
| 6 | 0 | 0 | 0 | — |
Note：Numeral represents the number of days continuously having a fever in ()
Protest test is further demonstrated in the case of subclinical infection Streptococcus suis, vaccine combination of the invention
Thing can still resist the infection of CSFV, and complete immanoprotection action is played to swine fever virus infection.
The immuning effect test of the swine fever of embodiment 6, Streptococcus suis bigeminy freeze dried vaccine
The immune programme for children of 1 piglet
By the negative piglet 70 of 25-30 ages in days swine fever, Streptococcus suis antigen-antibody, 7 groups of experiment point, 1-2 groups are real
The immune group of vaccine 2 of the preparation of example 2 is applied, 3-4 groups are the immune group of vaccine 5 prepared by embodiment 2, and 5-7 groups are PBS control group.
Every pig injection 1ml of PBS control group matches the PBS of 10% (V/V) gel adjuvants, the every pig musculi colli injection of vaccine immunity group
Vaccine 1ml, single immunization.
2 immune piglet protest tests
21 days after immune, to the 1st group, the 3rd group, the 5th group respectively with the strong arsenic bloom door system strain intramuscular injection 1ml of CSFV
(105MLD), observe 10 days.As a result immune group is all protected, the 5th group of all morbidity.Attack poison protection and the results are shown in Table 10.Demonstrate
Vaccine composition vaccine 2 of the present invention and infection of the vaccine 5 to CSFV have complete protective effect, can effectively prevent
The infection of CSFV.
Intraperitoneal injection is carried out respectively to the 2nd group, the 4th group, the 6th group and attacks poison, poison is attacked and includes 33 kinds with Streptococcus suis bacterium solution
The Streptococcus suis of serotype, toxic agent amount is attacked as 5 × 108CFU, observed 10 days after attacking poison, and according to malicious piglet of attacking against each other in embodiment 3
Clinical indices scored.
As a result the 6th group of piglet starts clinical symptoms occur after attacking poison after 24 hours, shows as body temperature and persistently raises suddenly, lame
Row, lie prone it is sleeping, tremble, do not feed, four limbs are struck and all dead in 5 days after poison is attacked；Immune group 2 dead 5,5 head protections, 2
Once there is the gradual after 36 hours of of short duration clinical sign and recovers normal in head, finally kept fit；First 9 guarantors of immune group 4 dead 1
Shield has no obvious clinical symptoms.7th group of PBS control group survival, phenomenon without exception occur.Concrete outcome is shown in Table 10.
Table 10 is immunized piglet and attacks poison protection result
| Group | Immunization wayses | Immunological classes | Quantity | Attack toxic agent amount | Death toll | Protective rate (%) |
| 1 | Intramuscular injection | Vaccine 2 | 10 | 105MLD | 0 | 100 |
| 2 | Intramuscular injection | Vaccine 2 | 10 | 5×108CFU | 5 | 50 |
| 3 | Intramuscular injection | Vaccine 5 | 10 | 105MLD | 0 | 100 |
| 4 | Intramuscular injection | Vaccine 5 | 10 | 5×108CFU | 1 | 90 |
| 5 | Intramuscular injection | Adjuvant PBS | 10 | 105MLD | 10 | 0 |
| 6 | Intramuscular injection | Adjuvant PBS | 10 | 5×108CFU | 10 | 0 |
| 7 | Intramuscular injection | Adjuvant PBS | 10 | — | 0 | — |
Prove that vaccine combination vaccine 5 of the present invention has more preferable protective effect compared with vaccine 2, not only to the sense of CSFV
Dye has complete protective effect, and the also unexpected infection to various serotype Streptococcus suis has preferable immunoprotection
Effect.
Judge for animal, the clinical sign for assessing disease is carried out in the case of all individual immunities are not known
, clinical score the results are shown in Table 11.Clinical score is by the measure to disease indicators and combines the death rate and the incidence of disease, uses
Mann-Whitney is analyzed to compare effect of the vaccine to clinical score.As a result show vaccine 5 with the difference of vaccine 2 extremely significantly (P ＜
0.01), all immune groups are extremely notable (P ＜ 0.01) with difference between attacking malicious control group.Pass through the immune efficacy of more each vaccine
Clinical evaluation result correlation, it can be seen that the immune effect of vaccine 5 will be significantly higher than vaccine 2.
Piglet Streptococcus suis clinical score result is immunized in table 11
| Group | 1 day | 2 days | 3 days | 4 days | 5 days | 6 days | 7 days | 8 days | 9 days | 10 days |
| 2 | 1.2 | 3.6 | 4 | 4.4 | 4.4 | 4 | 4 | 4 | 4 | 4 |
| 4 | 1 | 1.6 | 1.8 | 1.4 | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 |
| 6 | 4.5 | 6.5 | 7 | 7.2 | 8 | 8 | 8 | 8 | 8 | 8 |
Vaccine combination of the present invention comprising two kinds of Streptococcus suis subunit antigens is demonstrated in resistance various serotype pig
The protecting effect of streptococcal infection is better than the full bacterium antigenc vaccine compositions of single serotype, by comparing vaccine to clinical disease
Influence, vaccine combination clinical disease of the present invention comprising two kinds of Streptococcus suis subunit antigens is also considerably less than single serum
The full bacterium antigenc vaccine compositions of type.Vaccine combination of the present invention comprising two kinds of Streptococcus suis subunit antigens is effective against pig
While the infection of pestivirus, be also effective against the infection of different serotypes Streptococcus suis, there is provided one kind improve prevention and/or
Treat CSFV, the approach of streptococcus suis infection.
Described above is only the preferred embodiments of the present invention, not does any formal limitation to the present invention, though
So the present invention is disclosed above with preferred embodiment, but is not limited to the present invention, any to be familiar with this professional technology people
Member, in the range of technical solution of the present invention is not departed from, when the technology contents using the disclosure above make a little change or repair
The equivalent embodiment for equivalent variations is adornd, as long as being the content without departing from technical solution of the present invention, the technology according to the present invention is real
Any simple modification, equivalent change and modification that confrontation above example is made, still fall within the scope of technical solution of the present invention
It is interior.
Claims (6)
1. a kind of vaccine combination, it is characterised in that the vaccine combination includes the CSFV antigen of immune amount, immune amount
Streptococcus suis antigen and veterinarily acceptable supporting agent；Wherein, the CSFV antigen is the weak poison of CSFV rabbitization
Strain C strain AV1412 strains；
The Streptococcus suis antigen has been the Streptococcus suis subunit protein fragment of immunization；
The Streptococcus suis subunit protein fragment of described immunization is Streptococcus suis 38KDA albumen and SaoA albumen；It is described
Streptococcus suis 38KDA albumen be by SEQ ID NO.3 encode albumen, described Streptococcus suis SaoA albumen is by SEQ ID
The albumen of NO.4 codings；The CSFV Lapinized strain totivirus content is 105.0~106.0TCID50/ head part；The pig
Streptococcus subunit antigen Streptococcus suis 38KDA protein contents are that 10-100 μ g/ml, Streptococcus suis SaoA protein contents are 50-
300μg/ml。
2. vaccine combination according to claim 1, it is characterised in that described Streptococcus suis 38KDA albumen is by SEQ
The albumen of ID NO.3 codings, described Streptococcus suis SaoA albumen are the albumen encoded by SEQ ID NO.4；Described swine fever
Viral Lapinized strain totivirus content is 106.0TCID50/ head part；Described Streptococcus suis subunit antigen Streptococcus suis
38KDA protein contents are 50 μ g/ml, and Streptococcus suis SaoA protein contents are 150 μ g/ml.
3. a kind of vaccine combination, it is characterised in that described vaccine combination is by CSFV Lapinized strain C strains AV1412
Strain totivirus antigen and Streptococcus suis 38KDA albumen, SaoA albumen and supporting agent composition；Described Streptococcus suis 38KDA albumen
It is the albumen encoded by SEQ ID NO.3, described Streptococcus suis SaoA albumen is the albumen encoded by SEQ ID NO.4.
A kind of 4. method for preparing any one of the claim 1-3 vaccine combinations, it is characterised in that described preparation method
Including：
1) CSFV antigen, Streptococcus suis antigen are prepared, wherein, the CSFV antigen is CSFV Lapinized strain
C strain AV1412 strains；
2) by step (1) prepare CSFV antigen and Streptococcus suis antigen be separately added into supporting agent each prepare vaccine or by than
Supporting agent, which is added, after example mixing prepares polyvalent vaccine, wherein, the Streptococcus suis antigen has been that the Streptococcus suis of immunization is sub- single
Position protein fragments；The Streptococcus suis subunit protein fragment of described immunization is Streptococcus suis 38KDA albumen and SaoA eggs
In vain, described Streptococcus suis 38KDA albumen is the albumen encoded by SEQ ID NO.3, and described Streptococcus suis SaoA albumen is
The albumen encoded by SEQ ID NO.4；The CSFV Lapinized strain totivirus content is 105.0~106.0TCID50/ head
Part；The Streptococcus suis subunit antigen Streptococcus suis 38KDA protein contents are 10-100 μ g/ml, Streptococcus suis SaoA albumen
Content is 50-300 μ g/ml.
5. prevention and/or treatment subclinical infection pig hammer are being prepared according to any one of the claim 1-3 vaccine combinations
Application in the medicine of bacterium pig hog cholera vaccine immuning failure.
6. prevention and/or treatment CSFV, Streptococcus suis are being prepared according to any one of the claim 1-3 vaccine combinations
Application in relevant disease or the medicine of infection.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711105009.9A CN107837391A (en) | 2014-06-24 | 2014-06-24 | A kind of vaccine combination and its preparation method and application |
| CN201410289029.6A CN104248761B (en) | 2014-06-24 | 2014-06-24 | A kind of vaccine combination and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410289029.6A CN104248761B (en) | 2014-06-24 | 2014-06-24 | A kind of vaccine combination and its preparation method and application |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711105009.9A Division CN107837391A (en) | 2014-06-24 | 2014-06-24 | A kind of vaccine combination and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104248761A CN104248761A (en) | 2014-12-31 |
| CN104248761B true CN104248761B (en) | 2018-02-02 |
Family
ID=52184235
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711105009.9A Pending CN107837391A (en) | 2014-06-24 | 2014-06-24 | A kind of vaccine combination and its preparation method and application |
| CN201410289029.6A Active CN104248761B (en) | 2014-06-24 | 2014-06-24 | A kind of vaccine combination and its preparation method and application |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711105009.9A Pending CN107837391A (en) | 2014-06-24 | 2014-06-24 | A kind of vaccine combination and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN107837391A (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106117365B (en) * | 2016-06-23 | 2018-07-27 | 湖南农业大学 | Anti-streptococcus suis is sick and with the active fusion protein of autoimmunity and its preparation and application |
| CN110013550A (en) * | 2019-04-09 | 2019-07-16 | 上海创宏生物科技有限公司 | A kind of composite adjuvant and its application and pig bacterial inactivated vaccine |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102600469A (en) * | 2012-03-07 | 2012-07-25 | 齐鲁动物保健品有限公司 | Classical swine fever live vaccine |
| CN103536914A (en) * | 2005-12-29 | 2014-01-29 | 贝林格尔.英格海姆维特梅迪卡有限公司 | Multivalent pcv2 immunogenic compositions and methods of producing such compositions |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2205275A1 (en) * | 2007-10-31 | 2010-07-14 | Novartis Ag | Protection of an animal against pestivirus infection |
| CN101736017B (en) * | 2008-11-17 | 2013-06-05 | 黄金城 | Classical swine fever virus E2 subunit vaccine and preparation thereof |
| CN101979501B (en) * | 2010-09-17 | 2012-05-23 | 华中农业大学 | Recombinant Salmonella choleraesuis for expressing surface antigen gene sao of streptococcus suis type 2, vaccine and application |
| CN103157101B (en) * | 2011-12-08 | 2015-02-11 | 普莱柯生物工程股份有限公司 | Combined inactivate vaccine for haemophilus parasuis disease and streptococcus suis disease and preparation method for same |
| WO2014033149A1 (en) * | 2012-08-29 | 2014-03-06 | Intervet International B.V. | Marker vaccine |
| TWI506135B (en) * | 2012-10-24 | 2015-11-01 | Mutants of escherichia coli heat-labile toxin, method of manufacturing the same, adjuvant increasing immune response, and vaccine | |
| CN103751774B (en) * | 2013-07-17 | 2016-05-18 | 哈尔滨维科生物技术开发公司 | The recombinant cell lines of stably express CSFV E 2 protein and in the application of preparing in subunit vaccine for swine fever and diagnostic reagent |
-
2014
- 2014-06-24 CN CN201711105009.9A patent/CN107837391A/en active Pending
- 2014-06-24 CN CN201410289029.6A patent/CN104248761B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103536914A (en) * | 2005-12-29 | 2014-01-29 | 贝林格尔.英格海姆维特梅迪卡有限公司 | Multivalent pcv2 immunogenic compositions and methods of producing such compositions |
| CN102600469A (en) * | 2012-03-07 | 2012-07-25 | 齐鲁动物保健品有限公司 | Classical swine fever live vaccine |
Non-Patent Citations (2)
| Title |
|---|
| 猪瘟、猪丹毒、猪链球菌苗混合注射应用效果报告;章国祥;《江西畜牧兽医杂志》;19831231(第4期);51 * |
| 表达猪链球菌2型保护性抗原重组猪痘病毒的构建、特性分析及其小鼠免疫评估;黄冬艳;《中国博士学文论文全文数据库农业科技辑》;20131215;正文第17页第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107837391A (en) | 2018-03-27 |
| CN104248761A (en) | 2014-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101633909B (en) | Attenuated live vaccine strain for preventing pig-pig infection breeding and respiratory syndrome | |
| CN103263666B (en) | Porcine circovirus 2 type, porcine mycoplasmal pneumonia bivalent inactivated vaccine and preparation method thereof | |
| CN104513827A (en) | Porcine epizootic diarrhea virus strain, attenuated vaccine strain thereof and application thereof | |
| CN104498441B (en) | Duck hepatitis A virus (HAV) type III low virulent strain and live vaccine prepared therefrom and application | |
| CN108486067A (en) | The inactivated vaccine and application of Porcine epidemic diarrhea virus variant and its preparation | |
| CN107537031A (en) | A kind of vaccine combination for preventing porcine reproductive and respiratory syndrome and its preparation method and application | |
| CN103849632A (en) | S1 gene of low virulent strain of infectious bronchitis and low virulent strain and application thereof | |
| CN103908665B (en) | A kind of vaccine combination and its preparation method and application | |
| CN104248761B (en) | A kind of vaccine combination and its preparation method and application | |
| RU2403063C1 (en) | Inactivated combined vaccine against viral diarrhea, rota-, corona-virus diseases and escherichiosis of cattle | |
| CN104096222B (en) | A kind of vaccine combination and its preparation method and application | |
| CN106190988B (en) | Inactivated vaccine of feline calicivirus CH-JL5 strain | |
| CN102727883A (en) | Combined live vaccine against porcine reproductive and respiratory syndrome and swine fever, and application thereof | |
| CN108251382A (en) | A kind of porcine pseudorabies virus causes weak method and its causes weak Strain, vaccine composition and application | |
| CN107164273A (en) | A kind of strong type Streptococcus suis of serum 2 of immunogenicity and its application | |
| CN104248754B (en) | Streptococcus suis vaccine combination and its preparation method and application | |
| CN103920146A (en) | Porcine circovirus II type-porcine pseudorabies double-combination vaccine, and preparation methods and application thereof | |
| CN106929480A (en) | Porcine reproductive and respiratory syndrome virus strain and its application | |
| CN106520623B (en) | A kind of serum 7-type haemophilus parasuis low virulent strain and its application | |
| CN113832113B (en) | Novel duck reovirus attenuated strain and application thereof | |
| CN103127497A (en) | Bigeminy inactivated vaccine of porcine circovirus type 2 and swine mycoplasma hyopneumoniae and preparation method of bigeminy inactivated vaccine | |
| CN106267176A (en) | Infectious coryza of chicken vaccine combination and its preparation method and application | |
| CN106139137A (en) | A kind of vaccine combination and application thereof | |
| CN104195114A (en) | Avian pneumovirus and application thereof | |
| CN105497885B (en) | A kind of subunit vaccine and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Xiangdong Inventor after: Tian Kegong Inventor after: Zhang Haiyang Inventor after: Zhang Xuke Inventor after: Sun Jinzhong Inventor before: Zhang Xuke Inventor before: Sun Jinzhong Inventor before: Zhang Haiyang Inventor before: Tian Kegong |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |