CN101608180B

CN101608180B - Fusion heparinase and coding gene thereof

Info

Publication number: CN101608180B
Application number: CN200910090169XA
Authority: CN
Inventors: 邢新会; 叶逢春; 张翀; 蒋培霞
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2009-07-29
Filing date: 2009-07-29
Publication date: 2011-08-10
Anticipated expiration: 2029-07-29
Also published as: CN101608180A

Abstract

The invention discloses fusion heparinase which is the protein of the following a) or b): a) the protein formed by the amino acid sequences shown by No.8-No.1016 in a sequence 1 in a sequence table; b) the protein which has heparinase activity and is derived from a) by substitution and/or deletion of one or more amino acid in and/or addition of one or more amino acid to the amino acid sequences in the sequence 1 in the sequence table. The coding gene of the protein also belongs to the scope of protection of the invention. The enzyme activity of the triple fusion protein generated by the invention can reach 660.3IU/L culture medium by shaking culture and the specific activity can reach 1.931IU/mg protein. The invention can employ GFP to realize quick online detection of thalli concentration and enzyme activity.

Description

A kind of fusion heparinase and encoding gene thereof

Technical field

The present invention relates to enzyme engineering and biocatalysis field, particularly fusion heparinase and encoding gene thereof and application.

Background technology

Heparinase (heparinase) is the polysaceharide lyase that a class acts on heparin, in many kinds of microorganisms, find, comprise excellent bacillus Corynebacterium sp. (high Ningguo etc., heparinase produces screening and the fermentation condition of bacterium, microorganism journal 1999 Vol.39:64-67), Sphingobacterium sp. Sphingobacterium sp. (high Ningguo etc., the generation of Sphingobacterium sp. heparinase, microorganism journal 2003 Vol.43:813-816), Bacillus subtillis Bacillus subtilis (Wang Zhongyan etc., heparinase produces the screening of bacterium and the research of thick enzymatic property thereof, Sichuan University's journal (natural science edition) 2002 Vol.39:777-779), Bacillus circulans Bacillus circulans (Yasutaka Tahara et al., Purification and characterization of heparinase that degrades both heparin and heparin sulfate from Bacilluscirculans BioSci.Biotechnol.Biochem.2002 Vol.66:1181-1184), Bacteroides heparinolyticus Prevotella heparinolytica (Kazuyuki Sugahara et al., Characterization of heparinase from an oral bacterium Prevotella heparinolytica J.Biochem.1998 Vol.123:283-288), Bacteroides stercoris Bacteroides stercoris HJ-15 (Dong Hyuu Kim et al., Purification and characterization of a novel heparinase from Bacteroides stercoris HJ-15 J.Biochem.2000 Vol.128:323-328) and heparin Flavobacterium Flavabacterium heparinum (Sasiekharan, R.1991 Ph.D.Thesis, Havard University).But the heparinase from the heparin Flavobacterium is business-like unique source.

The research of heparinase has crucial meaning (Sasiekharan, Ph.D.Thesis R.1991, Havard University; Sasiekharan, R.et al., A comparative analysis of the primary sequences and characteristics of heparinase I, II, and III from Flavobacterium heparinum Biochemical and Biophysical Research Communication1996 Vol.229:770-777): heparinase is a kind of of polysaceharide lyase, is used to study the mechanism of action that interaction between heparinase and the substrate polysaccharide heparin thereof helps to illustrate polysaceharide lyase; Heparinase can be used to resolve the structure and the biological function thereof of complicated mucopolysaccharides such as heparin; Heparinase can be used to resolve intravital blood coagulation of people and anticlotting mechanism; Heparinase can prevent postoperative hemorrhage as the removal of clinical blood heparinization; Heparinase is used for the processing of the preceding blood products of PCR reaction; Heparinase can be used to prepare low molecular anticoagulation medicine low molecular weight heparin.

Heparinase from the heparin Flavobacterium mainly contains three kinds, difference called after Heparinase I (EC 4.2.2.7), II (NO EC code) and III (EC 4.2.2.8) (Robert J.Linhardt et al., Purificationand characterization of heparin lyases from Flavobacterium heparinum JBC1992 Vol.267:24347-24355).Wherein the Heparinase I of heparin Flavobacterium (HepA) is one of heparinase of studying so far fullest, and the existing report of the application in the removal of its heparin in the production of Low molecular heparin and extracorporeal circulation of blood has the huge market development and is worth.

Normally purification obtains Heparinase I from heparin Flavobacterium fermented liquid, needs the chromatogram purification through multistep usually, and yield is lower.Heparin Flavobacterium rate of growth is slow, the production stability of heparinase is poor, and, producing heparinase needs expensive heparin-induced, increased the cost of enzyme, thereby the reorganization bacterium produces Heparinase I and receives great concern, but the as easy as rolling off a log formation inclusion body of the Heparinase I of generally recombinating needs complicated renaturation process could form activated protein.

From colibacillary natural maltose binding protein MBP can with the special absorption of maltose, participate in transhipment and the utilization of intestinal bacteria to maltose.MBP not only can combine with amylose, realizes affine separation, also can with yam starch in conjunction with realizing affine the separation that (biological chemistry and biophysics are made progress 1998 Vol.25:283-284 for Lian Dejun etc., a kind of improved fusion rotein affinity chromatographic purification process; Usha Srinivasan et al., Aconvenient method for affinity purification of maltose binding proteinfusions Journal of Biotechnology 1998 Vol.62:163-167), thus can reduce the cost of the separation and purification of enzyme greatly.This research group utilizes fusion protein technology in earlier stage, MBP is obtained Heparinase I with clone from the heparin Flavobacterium to be merged, made up the engineering strain of the Heparinase I of High-efficient Production solubility, the 5L fermentor tank is produced enzyme work can reach above (the Chen Yin of 20000IU/L, Xing Xin-hui, Ye Feng-chun, Kuang Ying, LuoMing-fang.Production of MBP-HepA fusion protein in recombinant Escherichia coliby optimization of culture medium, Biochemical Engineering Journal, 2007,34:114-121).The reorganization Heparinase I that this method obtains only need carry out reaching 95% purification effect once the step affinity chromatography.This work patent applied for, the patent No. are 200410038098.6.

Green fluorescent protein GFP, since (Chalfie M such as Chalfie in 1994, Tu Y, EuskirchenG, Ward WW, Prasher DC Green fluorescent protein as a marker for geneexpression.Science 1994,263:802-805) in Bacillus coli cells, express first after, because this fluorescin is stable, pair cell nontoxicity, fluoroscopic examination are simple, and produce fluorescence and do not need characteristics such as substrate, become one of most widely used reporter protein in the research and development of physiology and biotechnology.But GFP mainly lays particular emphasis on various qualitative parsings at biology and Application in Biotechnology so far, and the Quantitative Monitoring and the process optimization that are applied to protein biological production process are new fields.(Poppenborg L such as Poppenborg, Friehs K, Flaschel E The green fluorescent protein is aversatile reporter for bioprocess monitoring.J.Biotechnol.1997 58:79-88) has proved first GFP has been fused to the fast monitored that can realize on the affine target thing such as processes such as cultivation, chromatographic separation.Therefore, GFP is the instrument with very big potentiality that is used for quantitative fast monitored cell cultures, optimizing fermentation and follows the trail of immobilized enzyme use characteristic.This laboratory utilizes fusion protein technology in earlier stage, GFP is obtained Heparinase I with clone from the heparin Flavobacterium to be merged, made up the engineering strain (ChenYin of the Heparinase I of production solubility, Xing Xin-hui, Ye Feng-chun, Kuang Ying.Soluble expression and rapidquantification of GFP-hepA fusion protein in recombinant Escherichia coli, Chinese Journal of Chemical Engineering, 2007,15:122-126).The fusion of GFP can utilize fluorescence measurement that engineering bacteria concentration and the work of Heparinase I enzyme are carried out the fast quantification tracking, help the optimization and the control of Heparinase I production process, help the preservation of heparinase and the quick evaluation of application process, help resolving the structure and the mechanism of degradation of macromole heparin.This work patent applied for, the patent No. are 200510090872.2.

In existing Heparinase I production and the Catalytic processes, lack the integrated approach of enzyme production-separation-whole process of application.Therefore, the efficient soluble-expression of Heparinase I, separation and purification, immobilization, efficient catalytic and the enzyme multifunctions such as rapid detection of living are integrated just has a crucial meaning.Fusion protein technology is to realize one of effective means that this multifunction is integrated.

Summary of the invention

The object of the present invention is to provide a kind of fusion heparinase.

Fusion heparinase provided by the invention, called after GFP-MBP-HepA, be following a) or b) albumen:

A) protein that the aminoacid sequence shown in the 8-1016 of sequence 1 is formed in the sequence table;

B) in sequence table the aminoacid sequence of sequence 1 through replacement and/or disappearance and/or add one or several amino acid and have heparanase activity by a) deutero-protein.

Above-mentioned b) proteic aminoacid sequence specifically can be the aminoacid sequence shown in the sequence 1 in the sequence table.

Above-mentioned proteic encoding gene, called after gfp-mbp-HepA also belongs within protection scope of the present invention.

The sequence of said gene is following 1) or 2) or 3) nucleotide sequence:

1) nucleotide sequence shown in the sequence 2 in the sequence table;

2) under the rigorous condition of height with sequence table in the nucleotide sequence hybridization and the above-mentioned proteic nucleotide sequence of encoding of sequence 2;

3) with sequence table in the nucleotide sequence shown in the sequence 2 have the homology more than 90% and encode above-mentioned proteic nucleotide sequence.

In the sequence 2, the coding region of gfp is the base from 5 ' end 22-735 position of sequence 2; The coding region of mbp is the base from 5 ' end 781-1881 position of sequence 2; The coding region of HepA is the base from 5 ' end 1959-3048 position of sequence 2.

The rigorous condition of described height is meant, with Hybond membrane place prehybridization solution (the 0.25mol/L sodium phosphate buffer, pH7.2,7%SDS) in, 65 ℃ of prehybridization 30min; Abandon prehybridization solution, add hybridization solution (0.25mol/L sodium phosphate buffer, pH7.2,7%SDS, isotope-labeled nucleotide fragments), 65 ℃ of hybridization 12hr; Abandon hybridization solution, (20mmol/L sodium phosphate buffer, pH7.2 5%SDS), wash film 2 times for 65 ℃, each 30min to add film washing liquid I; (20mmol/L sodium phosphate buffer, pH7.2 1%SDS), wash film 30min for 65 ℃ to add film washing liquid II.

The recombinant vectors and the transgenic cell line that contain said gene also belong within protection scope of the present invention.

Above-mentioned recombinant vectors makes up by following steps:

Dna fragmentation shown in the 1st-1881 of sequence in the sequence table 2 is inserted the multiple clone site of plasmid pMAL-c2x-HepA, obtain recombinant vectors;

Described plasmid pMAL-c2x-HepA is that the encoding gene with the Heparinase I shown in the 1959-3048 position of sequence 2 is inserted between the BamHI and HindIII restriction enzyme site of plasmid pMAL-c2x the recombinant plasmid that obtains.

The reorganization bacterium that contains the claim said gene also belongs within protection scope of the present invention.

Above-mentioned reorganization bacterium is the recombination bacillus coli that contains above-mentioned recombinant vectors.

Another object of the present invention is to provide a kind of method of producing heparinase, is with above-mentioned reorganization bacterium inducing culture, expresses to obtain heparinase.

Above-mentioned inducing culture condition is: the IPTG of 0.3-1mM, 10-30 ℃ inducing culture 5-30 hour.

Shake-flask culture experimental results show that: the enzyme work of the fusion heparinase that the present invention produces can reach the 660.3IU/L substratum, can reach 1.931IU/mg albumen than enzyme work.The present invention can utilize GFP albumen to realize the quick online detection that cell concentration and enzyme are lived.All exist good linear relationship because enzyme is alive among the present invention with bacterial concentration, fluorescence intensity, can utilize fluorescence intensity to realize bacterial concentration and enzyme fast quantification alive in the culturing process.The variation that The above results explanation can be lived with the enzyme of quick acquisition cell concentration and Heparinase I by fluorescence intensity in the fermentation culture process, thus realize culturing process optimization and the control of the triple fusion heparinase I of High-efficient Production.

Description of drawings

Fig. 1 is the building process synoptic diagram of expression vector pMAL-hepA.

Fig. 2 is the Heparinase I gene electrophoretogram that pcr amplification obtains from the heparin Flavobacterium.

Fig. 3 is the building process synoptic diagram of expression vector phGMH-L2.

Fig. 4 is the SDS-PAGE electrophoretic analysis figure that intestinal bacteria TB1/phGMH-L2 and TOP10/phGMH-L2 engineering strain are expressed GFP-MBP-HepA.

Fig. 5 is that cell concentration behind intestinal bacteria TB1/phGMH-L2 and the TOP10/phGMH-L2 engineering strain 15 degree inducing culture 21h, crude enzyme liquid enzyme are lived and fluorescence volume comparable situation synoptic diagram.

Fig. 6 is that crude enzyme liquid is alives and than fluorescence intensity comparison situation synoptic diagram than enzyme behind intestinal bacteria TB1/phGMH-L2 and the TOP10/phGMH-L2 engineering strain 15 degree inducing culture 21h.

Fig. 7 is cell concn (OD in the TOP10/phGMH-L2 culturing process ₆₀₀), the enzyme of Heparinase I is lived (IU/L substratum) and the change curve of fluorescence intensity (U/L).

Fig. 8 is cell concn (OD in the TOP10/phGMH-L2 culturing process ₆₀₀), the live graph of relation of (IU/L substratum) of the enzyme of fluorescence intensity (U/L) and Heparinase I.

Embodiment

The invention will be further described below in conjunction with specific embodiment, but the present invention is not limited to following examples.

Among the following embodiment, if no special instructions, be ordinary method.

Embodiment 1. green fluorescent proteins, maltose binding protein and the triple Expression of Fusion Protein of Heparinase I

One, the structure of triple Expression of Fusion Protein carriers

1, the structure that contains the expression vector pMAL-c2x-HepA of maltose binding protein and Heparinase I two-fold fusion rotein encoding gene

The building process of expression vector pMAL-c2x-HepA as shown in Figure 1, detailed process is as follows: amplification Heparinase I gene from the genome DNA of heparin Flavobacterium (Flavabacterium heparinum) (buy from IAM), used primer is respectively:

Upstream primer: 5 '-GCCT GGATCCCAGCAAAAAAAATCCGGTAAC-3 ' (base of band underscore is the enzyme recognition site of BamHI),

Downstream primer: 5 '-CTTA AAGCTTTTACTATCTGGCAGTTTCGCTGTAC-3 ' (base of band underscore is the HindIII enzyme recognition site) after the amplification, introduces BamHI and HindIII enzyme recognition site respectively.

The reaction system of pcr amplification is: 50ng template DNA, every kind of primer of 100pmol, 1 * amplification buffer (sky, Beijing is a Bioisystech Co., Ltd), every kind of dNTP of 200 μ mol/L, the high Pfu enzyme of protecting of 1 unit; Amplification program is: 95 degrees centigrade of sex change 5 minutes, and 50-60 (51,53,55,57 or 59 ℃) degree centigrade primer annealing 45 seconds, 72 degrees centigrade of primer extensions 90 seconds, after 30 circulations, 72 degrees centigrade are extended and finished reaction in 5 minutes.This PCR result shows that amplification obtains the Heparinase I gene fragment of 1.1kb as shown in Figure 2.Order-checking shows that this fragment has 5 ' end 1959-3048 position nucleotide sequence of sequence 2 in sequence table.Among Fig. 2, it is 51,53,55,57 or 59 ℃ of amplifications that swimming lane 2-6 is respectively the primer annealing temperature, swimming lane 1 is molecular weight marker (stripe size is followed successively by 15kb, 10kb, 7500bp, 5000bp, 2500bp, 1000bp, 750bp), and arrow indication place is the 1.1kb target fragment.

Behind the above-mentioned PCR product usefulness BamHI and HindIII double digestion that obtains, be inserted into respectively between the BamHI and HindIII enzyme recognition site available from the pMAL-c2x carrier of U.S. New England Biolabs company, obtain the pMAL-c2x recombinant vectors, with pMAL-c2x recombinant vectors transformed into escherichia coli JM109, with 5 ' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC 3 ' and 5 ' CTTAAAGCTTTTACTATCTGGCAGTTTCGCTGTAC 3 ' is primer, by bacterium colony PCR screening transformant, extraction can obtain the pMAL-c2x recombinant vectors in the transformant of 1.1kbPCR product, respectively by BamHI and the checking of HindIII double digestion.To obtain the segmental plasmid of 1.1kb by BamHI and HindIII double digestion and check order, will contain the pMal-c2x recombinant vectors called after pMAL-c2x-HepA of the Heparinase I fusion rotein encoding gene of 1959-3048 position nucleotide sequence with sequence 2 in the sequence table.In pMAL-c2x-HepA, two successive termination codon TAGTAA are arranged between HepA gene and the lacZ α gene, can not express lacZ α albumen thereby can stop protein translation effectively.

2, the structure of triple fusion protein expression vector phGMH

Different with the amino acid residue sequence of maltose binding protein according to connecting green fluorescent protein in triple fusion roteins, we have made up the phGMH expression vector, called after phGMH-L2.The amino acid residue sequence that connects GFP and MBP among the phGMH-L2 is (EAAAK) ₃, building process as shown in Figure 3.Detailed process is as follows:

The building process of phGMH-L2

With plasmid pSG1729 (obtaining from Bacillus Genetic Stock Center) is template, with upstream primer 5 ' CGAGCACTTCACGAACAAGGACCATAGCAT ATTAATCATCATCATCATCATCATATGAGTAAAGGAGAAG 3 ' (base of band underscore is the AseI enzyme recognition site) and downstream primer 5 ' GTTATTGCGGCCGCTTCTTTTGCTGCAGCTTCTTTGTATAGTTCATCCAT 3 ' (base of band underscore is the NotI enzyme recognition site) amplification have histidine mark His ₆Green fluorescence protein gene his-gfp, introduce AseI and NotI enzyme recognition site respectively.

With plasmid pMAL-c2x-HepA is template, with upstream primer 5 ' TCACGA GCGGCCGCAAAAGAAGCAGCAGCAAAAATGAAAATCGAAGAAGGTA 3 ' (base of band underscore is the NotI enzyme recognition site) and downstream primer 5 ' CCGCTGCCAACC GAATTCTGAAATCCTTCCCTCGATCCCG 3 ' (base of band underscore is the EcoRI enzyme recognition site) amplification maltose binding protein protein gene mbp introduces NotI and EcoRI enzyme recognition site respectively.

The reaction system of pcr amplification is: 50ng template DNA, every kind of primer of 100pmol, 2 * TransTaq HighFidelity (HiFi) PCR SuperMix II; Amplification program is: 95 degrees centigrade of sex change 5 minutes, and 60 ℃ of annealing 45 seconds, 72 degrees centigrade of primer extensions 90 seconds, after 30 circulations, 72 degrees centigrade are extended and finished reaction in 10 minutes.Order-checking shows that his-gfp has SEQ ID №: 5 ' end 1-735 position nucleotide sequence in 2; Mbp has SEQ ID №: 5 ' end 781-1881 position nucleotide sequence in 2.

With above-mentioned the PCR product his-gfp that obtains Ase I and NotI double digestion, after mbp uses NotI and EcoRI double digestion, with the big segment T4DNA ligase enzyme of pMAL-c2x-HepA behind NdeI (restriction enzyme site is CATATG) and EcoRI double digestion, obtain recombinant vectors, just its transformed into escherichia coli DH5 α.Recombinant plasmid is cut evaluation and is confirmed (American I nvitrogen company) by sequencing through enzyme.The recombinant vectors called after phGMH-L2 that will contain the encoding gene (shown in sequence in the sequence table 2) of triple fusion roteins.Wherein, the coding region of gfp is the base from 5 ' end 22-735 position of sequence 2; The coding region of mbp is the base from 5 ' end 781-1881 position of sequence 2; The coding region of HepA is the base from 5 ' end 1959-3048 position of sequence 2.

Two, triple Expression of Fusion Protein

1, abduction delivering

Contain the plasmid in the bacillus coli DH 5 alpha of phGMH-L2 in the extraction step one, according to ordinary method transformed into escherichia coli TB1 and TOP10, through penbritin screening with utilize in the step 12 primers that provide to carry out bacterium colony PCR and identify, obtain containing intestinal bacteria TB1 and the TOP10 of phGMH-L2, promptly TB1/phGMH-L2 and TOP10/phGMH-L2 are as the engineering bacteria of expressing GFP-MBP-HepA.

With plasmid pMAL-c2x transformed into escherichia coli TB1 and TOP10, obtain empty carrier contrast TB1/pMAL-c2x and TOP10/pMAL-c2x.

Below operation is carried out top engineering bacteria is parallel.

Empty carrier contrast and engineering bacteria are cultured to OD for 37 ℃ at LB substratum (containing 100 μ g/ml penbritins) respectively ₆₀₀After near being about 0.600, adding final concentration is that 0.3mM IPTG carries out inducing culture 21h for 15 ℃.10000rpm, the centrifugal collection thalline of 8min is also used 20mmol/L Tris-HCl (pH 7.4) washed twice, and is resuspended to OD ₆₀₀Be about near 8.000, the 40 μ l that take a sample do cell whole protein component S DS-PAGE electrophoresis.With top OD ₆₀₀Be about 8.00 resuspended liquid and carry out ultrasonication (output rating is 300W, each ultrasonic 3 seconds and intermittently 3 seconds processing 198 times), 12000rpm, 30min get supernatant liquor 40 μ l and do soluble protein component S DS-PAGE electrophoresis.The result as shown in Figure 4,3 M are marker (molecular weight is 120kDa, 100kDa, 65kDa, 50kDa successively from top to down) among Fig. 4, C1 is an empty carrier contrast TOP10/pMAL-c2x whole protein component; C2 is the whole protein component of empty carrier contrast TB1/pMAL-c2x; S5, S6 are respectively whole protein component and the soluble protein component of intestinal bacteria TB1 (phGMHS-L2); S7, S8 are respectively whole protein component and the soluble protein component of intestinal bacteria TOP10 (phGMHS-L2).

The result shows: no fluorescence does not have enzyme work behind empty carrier control strain TB1/pMAL-c2x and the TOP10/pMAL-c2x inducing culture, other engineering bacteria has all given expression to the triple fusion roteins of GFP-MBP-HepA of solubility, and wherein the expression effect among the intestinal bacteria TOP10 all is better than intestinal bacteria TB1.And through order-checking, the proteic aminoacid sequence that TB1/phGMH-L2, TOP10/phGMH-L2 give expression to is shown in sequence table sequence 1; And the aminoacid sequence of the GFP of this fusion rotein as sequence 1 from shown in the aminoterminal 8-245 position; The aminoacid sequence of the MBP of this fusion rotein as sequence 1 from shown in the aminoterminal 261-627; The aminoacid sequence of the HepA of this fusion rotein as sequence 1 from shown in the aminoterminal 654-1016.

2, enzyme is lived and the fluorescence intensity check and analysis

Crude enzyme liquid is in the top step supernatant liquor of centrifugal gained after the ultrasonication.The optical absorption method of 232nm is adopted in the detection of enzyme activity (unit is IU/L), and the enzyme of 1IU is lived and is defined as the reaction effectiveness that 30 ℃ of per minutes produce 1 μ mol unsaturated link(age).Taking heparin substrate solution 0.5ml (25g/L heparin, 40mM NaCl, 3.5mM CaCl ₂, 17mM Tris-HCl, pH 7.4), the crude enzyme liquid of gained in the adding step 3, other volume replenishes with the Tris damping fluid, and final reaction solution volume is 1.5ml, surveys the absorbancy changes delta A of inherent 232nm of unit time ₂₃₂Optical extinction coefficient ∈=3800M ^-1Be defined as the ratio of enzyme activity and crude enzyme liquid protein concentration (unit is mg/L) than enzyme (unit is an IU/mg albumen) alive.Conventional Bradford method is adopted in the protein concentration monitoring.Fluorescence intensity (unit is U/L) detects and adopts spectrophotofluorometer HITACHI F-2500, and excitation wavelength is 488nm, and the detection absorbing wavelength is 512nm.Be defined as the ratio of fluorescence intensity and crude enzyme liquid protein concentration (unit is mg/L) than fluorescence intensity.

Behind 15 ℃ of inducing culture engineering bacteria 21h, OD ₆₀₀, enzyme lives, fluorescence intensity result as shown in Figure 5, live and as shown in Figure 6 than enzyme than fluorescence intensity result, nos fluorescence does not have enzyme work and does not show on figure behind its hollow carrier contrast inducing culture, numerical value enzyme work when recombinant vectors is phGMH-L2 can reach the 360.8IU/L substratum, 1.931IU/mg albumen can be reached than enzyme work, 0.758IU/mg albumen can be reached than fluorescence intensity.

The fluorescent quantitation that embodiment 2. triple fusion rotein heparinase enzymes are lived is followed the trail of

Choose intestinal bacteria TOP10/phGMH-L2 and carried out the fluorescent quantitation chase experiment that triple fusion rotein heparinase enzymes are lived.With M9YE substratum (the 17.1g/L Na that contains 100 μ g/ml penbritins ₂HPO ₄12H ₂O, 3.0g/L KH ₂PO ₄, 0.5g/L NaCl; 1.0g/L NH ₄Cl, 12.5g/L yeast extract, 12g/L glucose) TOP10/phGMH-L2 is cultivated, cultivate about 3.5 hours (to OD at 37 ℃ ₆₀₀Be 0.735) after, adding final concentration is the IPTG of 0.3mM, and changes culture temperature into 15 ℃ and carry out inducing culture.Every 2 hours, get 2ml bacterium liquid and survey its cell concn (OD respectively afterwards ₆₀₀), the enzyme of Heparinase I lived and fluorescence intensity (spectrophotofluorometer HITACHI F-2500), until inducing culture 30 hours.

The enzyme work of Heparinase I is to measure according to the method for the step 2 in embodiment 1 step 2, and the result shows the prolongation of the enzyme work of Heparinase I along with induction time, and expression amount increases gradually.The mensuration of fluorescence intensity is divided into dual mode: mode 1 is directly to utilize bacterium liquid to measure fluorescence intensity level, mode 2 is that the centrifugal back of bacterium liquid is resuspended with the Tris damping fluid (pH7.4) of the 20mM of equal volume, and the centrifugal supernatant that goes is measured fluorescence intensity level after the method ultrasonication with the step 1 in the step 2 among the embodiment 1.

Cell concn (the OD of culturing process ₆₀₀), the enzyme of Heparinase I is lived (IU/L substratum) and the variation of fluorescence intensity (RFU) as shown in Figure 7, the highest enzyme work can reach the 660.3IU/L substratum.Along with the increase of induction time, cell concn, enzyme are lived and fluorescence volume all increases, but because the influence of cell scattering, and the measured fluorescence intensity of mode 1 is less than normal, and cell concn is big more, and deviation is big more.This moment, but pass-through mode 2 was accurately measured fluorescence volume.

Realize the quick online detection that cell concentration and enzyme are lived for further research and utilization GFP albumen, we have studied enzyme and have lived and OD ₆₀₀, fluorescence intensity relation, the result is as shown in Figure 8.The result shows that enzyme is lived and bacterial concentration, fluorescence intensity all exist good linear relationship, can utilize fluorescence intensity to realize bacterial concentration and enzyme fast quantification alive in the culturing process.The variation that The above results explanation can be lived with the enzyme of quick acquisition cell concentration and Heparinase I by fluorescence intensity in the fermentation culture process, thus realize culturing process optimization and the control of the triple fusion heparinase I of High-efficient Production.

Sequence table

＜110〉Tsing-Hua University

＜120〉fusion heparinase and encoding gene thereof

<130>CGGNARL92434

<160>2

<210>1

<211>1016

<212>PRT

＜213〉artificial sequence

<220>

<230>

<400>1

Met?His?His?His?His?His?His?Met?Ser?Lys?Gly?Glu?Glu?Leu?Phe?Thr

1 5 10 15

Gly?Val?Val?Pro?Ile?Leu?Val?Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His

20 25 30

Lys?Phe?Ser?Val?Ser?Gly?Glu?Gly?Glu?Gly?Asp?Ala?Thr?Tyr?Gly?Lys

35 40 45

Leu?Thr?Leu?Lys?Phe?Ile?Cys?Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp

50 55 60

Pro?Thr?Leu?Val?Thr?Thr?Leu?Thr?Tyr?Gly?Val?Gln?Cys?Phe?Ser?Arg

65 70 75 80

Tyr?Pro?Asp?His?Met?Lys?Gln?His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro

85 90 95

Glu?Gly?Tyr?Val?Gln?Glu?Arg?Thr?Ile?Phe?Phe?Lys?Asp?Asp?Gly?Asn

100 105 110

Tyr?Lys?Thr?Arg?Ala?Glu?Val?Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn

115 120 125

Arg?Ile?Glu?Leu?Lys?Gly?Ile?Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu

130 135 140

Gly?His?Lys?Leu?Glu?Tyr?Asn?Tyr?Asn?Ser?His?Asn?Val?Tyr?Ile?Met

145 150 155 160

Ala?Asp?Lys?Gln?Lys?Asn?Gly?Ile?Lys?Val?Asn?Phe?Lys?Ile?Arg?His

165 170 175

Asn?Ile?Glu?Asp?Gly?Ser?Val?Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn

180 185 190

Thr?Pro?Ile?Gly?Asp?Gly?Pro?Val?Leu?Ser?Pro?Asp?Asn?His?Tyr?Leu

195 200 205

Ser?Thr?Gln?Ser?Ala?Leu?Ser?Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His

210 215 220

Met?Val?Leu?Leu?Glu?Phe?Val?Thr?Ala?Ala?Gly?Ile?Thr?His?Gly?Met

225 230 235 240

Asp?Glu?Leu?Tyr?Lys?Glu?Ala?Ala?Ala?Lys?Glu?Ala?Ala?Ala?Lys?Glu

245 250 255

Ala?Ala?Ala?Lys?Met?Lys?Ile?Glu?Glu?Gly?Lys?Leu?Val?Ile?Trp?Ile

260 265 270

Asn?Gly?Asp?Lys?Gly?Tyr?Asn?Gly?Leu?Ala?Glu?Val?Gly?Lys?Lys?Phe

275 280 285

Glu?Lys?Asp?Thr?Gly?Ile?Lys?Val?Thr?Val?Glu?His?Pro?Asp?Lys?Leu

290 295 300

Glu?Glu?Lys?Phe?Pro?Gln?Val?Ala?Ala?Thr?Gly?Asp?Gly?Pro?Asp?Ile

305 310 315 320

Ile?Phe?Trp?Ala?His?Asp?Arg?Phe?Gly?Gly?Tyr?Ala?Gln?Ser?Gly?Leu

325 330 335

Leu?Ala?Glu?Ile?Thr?Pro?Asp?Lys?Ala?Phe?Gln?Asp?Lys?Leu?Tyr?Pro

340 345 350

Phe?Thr?Trp?Asp?Ala?Val?Arg?Tyr?Asn?Gly?Lys?Leu?Ile?Ala?Tyr?Pro

355 360 365

Ile?Ala?Val?Glu?Ala?Leu?Ser?Leu?Ile?Tyr?Asn?Lys?Asp?Leu?Leu?Pro

370 375 380

Asn?Pro?Pro?Lys?Thr?Trp?Glu?Glu?Ile?Pro?Ala?Leu?Asp?Lys?Glu?Leu

385 390 395 400

Lys?Ala?Lys?Gly?Lys?Ser?Ala?Leu?Met?Phe?Asn?Leu?Gln?Glu?Pro?Tyr

405 410 415

Phe?Thr?Trp?Pro?Leu?Ile?Ala?Ala?Asp?Gly?Gly?Tyr?Ala?Phe?Lys?Tyr

420 425 430

Glu?Asn?Gly?Lys?Tyr?Asp?Ile?Lys?Asp?Val?Gly?Val?Asp?Asn?Ala?Gly

435 440 445

Ala?Lys?Ala?Gly?Leu?Thr?Phe?Leu?Val?Asp?Leu?Ile?Lys?Asn?Lys?His

450 455 460

Met?Asn?Ala?Asp?Thr?Asp?Tyr?Ser?Ile?Ala?Glu?Ala?Ala?Phe?Asn?Lys

465 470 475 480

Gly?Glu?Thr?Ala?Met?Thr?Ile?Asn?Gly?Pro?Trp?Ala?Trp?Ser?Asn?Ile

485 490 495

Asp?Thr?Ser?Lys?Val?Asn?Tyr?Gly?Val?Thr?Val?Leu?Pro?Thr?Phe?Lys

500 505 510

Gly?Gln?Pro?Ser?Lys?Pro?Phe?Val?Gly?Val?Leu?Ser?Ala?Gly?Ile?Asn

515 520 525

Ala?Ala?Ser?Pro?Asn?Lys?Glu?Leu?Ala?Lys?Glu?Phe?Leu?Glu?Asn?Tyr

530 535 540

Leu?Leu?Thr?Asp?Glu?Gly?Leu?Glu?Ala?Val?Asn?Lys?Asp?Lys?Pro?Leu

545 550 555 560

Gly?Ala?Val?Ala?Leu?Lys?Ser?Tyr?Glu?Glu?Glu?Leu?Ala?Lys?Asp?Pro

565 570 575

Arg?Ile?Ala?Ala?Thr?Met?Glu?Asn?Ala?Gln?Lys?Gly?Glu?Ile?Met?Pro

580 585 590

Asn?Ile?Pro?Gln?Met?Ser?Ala?Phe?Trp?Tyr?Ala?Val?Arg?Thr?Ala?Val

595 600 605

Ile?Asn?Ala?Ala?Ser?Gly?Arg?Gln?Thr?Val?Asp?Glu?Ala?Leu?Lys?Asp

610 615 620

Ala?Gln?Thr?Asn?Ser?Ser?Ser?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn

625 630 635 640

Asn?Leu?Gly?Ile?Glu?Gly?Arg?Ile?Ser?Glu?Phe?Gly?Ser?Gln?Gln?Lys

645 650 655

Lys?Ser?Gly?Asn?Ile?Pro?Tyr?Arg?Val?Asn?Val?Gln?Ala?Asp?Ser?Ala

660 665 670

Lys?Gln?Ser?Glu?Ile?Ile?Asp?Asn?Lys?Trp?Val?Ala?Val?Gly?Ile?Asn

675 680 685

Lys?Pro?Tyr?Ala?Leu?Gln?Tyr?Asp?Asp?Lys?Leu?Arg?Phe?Asn?Gly?Lys

690 695 700

Pro?Ser?Tyr?Arg?Phe?Glu?Leu?Lys?Ala?Glu?Asp?Asn?Ser?Leu?Glu?Gly

705 710 715 720

Tyr?Ala?Ala?Gly?Glu?Thr?Lys?Gly?Arg?Ile?Glu?Leu?Ser?Tyr?Ser?Tyr

725 730 735

Ala?Thr?Thr?Asn?Asp?Phe?Lys?Lys?Phe?Pro?Pro?Ser?Val?Tyr?Gln?Asn

740 745 750

Ala?Gln?Lys?Leu?Lys?Thr?Val?Tyr?His?Tyr?Gly?Lys?Gly?Ile?Cys?Glu

755 760 765

Gln?Gly?Ser?Ser?Arg?Ser?Tyr?Thr?Phe?Ser?Val?Tyr?Ile?Pro?Ser?Ser

770 775 780

Phe?Pro?Asp?Asn?Ala?Thr?Thr?Ile?Phe?Ala?Gln?Trp?His?Gly?Ala?Pro

785 790 795 800

Ser?Arg?Thr?Leu?Val?Ala?Thr?Pro?Glu?Gly?Glu?Ile?Lys?Thr?Leu?Ser

805 810 815

Ile?Glu?Glu?Phe?Leu?Ala?Leu?Tyr?Asp?Arg?Met?Ile?Phe?Lys?Lys?Asn

820 825 830

Ile?Ala?His?Asp?Lys?Val?Glu?Lys?Lys?Asp?Lys?Asp?Gly?Lys?Ile?Thr

835 840 845

Tyr?Val?Ala?Gly?Lys?Pro?Asn?Gly?Trp?Lys?Val?Glu?Gln?Gly?Gly?Tyr

850 855 860

Pro?Pro?Leu?Ala?Phe?Gly?Phe?Ser?Lys?Gly?Tyr?Phe?Tyr?Ile?Lys?Ala

865 870 875 880

Asn?Ser?Asp?Arg?Gln?Trp?Leu?Thr?Asp?Lys?Ala?Asp?Arg?Asn?Asn?Ala

885 890 895

Asn?Pro?Glu?Asn?Ser?Glu?Val?Met?Lys?Pro?Tyr?Ser?Ser?Glu?Tyr?Lys

900 905 910

Thr?Ser?Thr?Ile?Ala?Tyr?Lys?Met?Pro?Phe?Ala?Gln?Phe?Pro?Lys?Asp

915 920 925

Cys?Trp?Ile?Thr?Phe?Asp?Val?Ala?Ile?Asp?Trp?Thr?Lys?Tyr?Gly?Lys

930 935 940

Glu?Ala?Asn?Thr?Ile?Leu?Lys?Pro?Gly?Lys?Leu?Asp?Val?Met?Met?Thr

945 950 955 960

Tyr?Thr?Lys?Asn?Lys?Lys?Pro?Gln?Lys?Ala?His?Ile?Val?Asn?Gln?Gln

965 970 975

Glu?Ile?Leu?Ile?Gly?Arg?Asn?Asp?Asp?Asp?Gly?Tyr?Tyr?Phe?Lys?Phe

980 985 990

Gly?Ile?Tyr?Arg?Val?Gly?Asn?Ser Thr?Val?Pro?Val?Thr Tyr?Asn?Leu

995 1000 1005

Ser?Gly Tyr?Ser?Glu?Thr?Ala Arg

1010 1015

<210>2

<211>3054

<212>DNA

＜213〉artificial sequence

<220>

<230>

<400>2

atgcaccacc?accaccacca?catgagtaaa?ggagaagaac?ttttcactgg?agttgtccca 60

attcttgttg?aattagatgg?tgacgttaat?gggcacaaat?tttctgtcag?tggagagggt 120

gaaggtgatg?caacatacgg?aaaacttacc?cttaaattta?tttgcactac?tggaaaacta 180

cctgttccat?ggccaacact?tgtcactact?ctgacttatg?gtgttcaatg?cttttcaaga 240

tacccagatc?atatgaaaca?gcatgacttt?ttcaagagtg?ccatgcccga?aggttatgta 300

caggaaagaa?ctatattttt?caaagatgac?gggaactaca?agacacgtgc?tgaagtcaag 360

tttgaaggtg?atacccttgt?taatagaatc?gagttaaaag?gtattgattt?taaagaagat 420

ggaaacattc?ttggacacaa?attggaatac?aactataact?cacacaatgt?atacattatg 480

gcagacaaac?aaaagaatgg?aatcaaagtt?aacttcaaaa?ttagacacaa?cattgaagat 540

ggaagcgttc?aactagcaga?ccattatcaa?caaaatactc?caattggcga?tggccctgtc 600

ctttcaccag?acaaccatta?cctgtccaca?caatctgccc?tttcgaaaga?tcccaacgaa 660

aagagagacc?acatggtcct?tcttgagttt?gtaacagctg?ctgggattac?acatggcatg 720

gatgaactat?acaaagaagc?tgcagcaaaa?gaagcggccg?caaaagaagc?agcagcaaaa 780

atgaaaatcg?aagaaggtaa?actggtaatc?tggattaacg?gcgataaagg?ctataacggt 840

ctcgctgaag?tcggtaagaa?attcgagaaa?gataccggaa?ttaaagtcac?cgttgagcat 900

ccggataaac?tggaagagaa?attcccacag?gttgcggcaa?ctggcgatgg?ccctgacatt 960

atcttctggg?cacacgaccg?ctttggtggc?tacgctcaat?ctggcctgtt?ggctgaaatc 1020

accccggaca?aagcgttcca?ggacaagctg?tatccgttta?cctgggatgc?cgtacgttac 1080

aacggcaagc?tgattgctta?cccgatcgct?gttgaagcgt?tatcgctgat?ttataacaaa 1140

gatctgctgc?cgaacccgcc?aaaaacctgg?gaagagatcc?cggcgctgga?taaagaactg 1200

aaagcgaaag?gtaagagcgc?gctgatgttc?aacctgcaag?aaccgtactt?cacctggccg 1260

ctgattgctg?ctgacggggg?ttatgcgttc?aagtatgaaa?acggcaagta?cgacattaaa 1320

gacgtgggcg?tggataacgc?tggcgcgaaa?gcgggtctga?ccttcctggt?tgacctgatt 1380

aaaaacaaac?acatgaatgc?agacaccgat?tactccatcg?cagaagctgc?ctttaataaa 1440

ggcgaaacag?cgatgaccat?caacggcccg?tgggcatggt?ccaacatcga?caccagcaaa 1500

gtgaattatg?gtgtaacggt?actgccgacc?ttcaagggtc?aaccatccaa?accgttcgtt 1560

ggcgtgctga?gcgcaggtat?taacgccgcc?agtccgaaca?aagagctggc?aaaagagttc 1620

ctcgaaaact?atctgctgac?tgatgaaggt?ctggaagcgg?ttaataaaga?caaaccgctg 1680

ggtgccgtag?cgctgaagtc?ttacgaggaa?gagttggcga?aagatccacg?tattgccgcc 1740

actatggaaa?acgcccagaa?aggtgaaatc?atgccgaaca?tcccgcagat?gtccgctttc 1800

tggtatgccg?tgcgtactgc?ggtgatcaac?gccgccagcg?gtcgtcagac?tgtcgatgaa 1860

gccctgaaag?acgcgcagac?taattcgagc?tcgaacaaca?acaacaataa?caataacaac 1920

aacctcggga?tcgagggaag?gatttcagaa?ttcggatccc?agcaaaaaaa?atccggtaac 1980

atcccttacc?gggtaaatgt?gcaggccgac?agtgctaagc?agagcgagat?tattgacaac 2040

aaatgggtgg?cagtaggcat?caataaacct?tatgcattac?aatatgacga?taaactgcgc 2100

tttaatggaa?aaccatccta?tcgctttgag?cttaaagccg?aagacaattc?gcttgaaggt 2160

tatgctgcag?gagaaacaaa?gggccgtata?gaattgtcgt?acagctatgc?aaccaccaat 2220

gattttaaga?aatttccccc?aagcgtatac?caaaatgcgc?aaaagctaaa?aaccgtttat 2280

cattacggca?aagggatttg?tgaacagggg?agctcccgca?gctatacctt?ttcagtgtac 2340

ataccctcct?ccttccccga?caatgcgact?actatttttg?cccaatggca?tggtgcaccc 2400

agcagaacgc?ttgtagctac?accagaggga?gaaattaaaa?cactgagcat?agaagagttt 2460

ttggccttat?acgaccgcat?gatcttcaaa?aaaaatatcg?cccatgataa?agttgaaaaa 2520

aaagataagg?acggaaaaat?tacttatgta?gccggaaagc?caaatggctg?gaaggtagaa 2580

caaggtggtt?atccaccgct?ggcctttggt?ttttctaaag?ggtattttta?catcaaggca 2640

aactccgacc?ggcagtggct?taccgacaaa?gccgaccgta?acaatgccaa?tcccgagaat 2700

agtgaagtaa?tgaagcccta?ttcctcggaa?tacaaaactt?ctaccattgc?ctataaaatg 2760

ccctttgccc?agttccctaa?agattgctgg?attacttttg?atgtcgccat?agactggacg 2820

aaatatggaa?aagaggccaa?tacaattttg?aaacccggta?agctggatgt?gatgatgact 2880

tataccaaga?ataagaaacc?acaaaaagcg?catatcgtaa?accagcagga?aatcctgatc 2940

ggacgtaacg?atgacgatgg?ctattacttc?aaatttggaa?tttacagggt?cggtaacagc 3000

acggtcccgg?ttacttataa?cctgagcggg?tacagcgaaa?ctgccagata?gtaa 3054

Claims

1. albumen, the protein of forming by the aminoacid sequence shown in the 8-1016 of sequence in the sequence table 1.

2. the described proteic encoding gene of claim 1.

3. gene according to claim 2 is characterized in that: the nucleotide sequence of described gene is the nucleotide sequence shown in the sequence 2 in the sequence table.

4. the transgenic cell line that contains claim 2 or 3 described genes.

5. the recombinant vectors that contains claim 2 or 3 described genes.

6. recombinant vectors according to claim 5 is characterized in that: described recombinant vectors makes up by following steps:

7. the reorganization bacterium that contains claim 2 or 3 described genes.

8. reorganization bacterium according to claim 7 is characterized in that: described reorganization bacterium is the recombination bacillus coli that contains claim 5 or 6 described recombinant vectorss.

9. a method of producing heparinase is with claim 7 or 8 described reorganization bacterium inducing culture, expresses to obtain heparinase.

10. method according to claim 9 is characterized in that: described inducing culture condition is: the IPTG of 0.3-1mM, 10-30 ℃ inducing culture 5-30 hour.