CN101608170B

CN101608170B - Hydrogen-producing engineering bacteria and application thereof

Info

Publication number: CN101608170B
Application number: CN2008101152311A
Authority: CN
Inventors: 邢新会; 赵洪新; 马堃; 卢元; 王立言; 张翀; 施瑢
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2008-06-19
Filing date: 2008-06-19
Publication date: 2011-06-29
Anticipated expiration: 2028-06-19
Also published as: CN101608170A

Abstract

The invention discloses hydrogen-producing engineering bacteria and application thereof. The hydrogen-producing engineering bacteria are a) engineering bacteria obtained by inactivating delta hybO protein in E.aerogenes IAM1183 or b) engineering bacteria obtained by inactivating delta hybO protein and delta hycA protein in E.aerogenes IAM1183, wherein the amino acid sequence of the delta hybO protein is sequence 1 in a sequence list; and the amino acid sequence of the delta hycA protein is sequence 4 in the sequence list. The hydrogen-producing engineering bacteria can be applied to biological hydrogen production and are of great directive significance to biological hydrogen production. Moreover, the hydrogen-producing engineering bacteria have the advantages of strong environmental adaptability, wide substrate utilization range, strong substrate utilization capability and high hydrogen-producing efficiency.

Description

Hydrogen-producing engineering bacteria and application thereof

Technical field

The present invention relates to hydrogen-producing engineering bacteria and application thereof.

Background technology

Nowadays the fossil energy system of having set up since the world industry revolution of 18th century is being faced with two challenges greatly: 1) the fossil energy reserves reduce day by day, are faced with exhausted danger; 2) burning of fossil oil has produced a large amount of pollution substances, particularly CO ₂The Greenhouse effect that the isothermal chamber gas purging causes, the environment of depending on for existence to the mankind brings huge threat.Therefore, the renewable and clean energy resource of Sustainable Development, progressively substituting fossil energy is the grand strategy problem that concerns national energy security, environmental safety and social stability peaceful development.

Hydrogen Energy is as substituting one of clean energy the future that has potentiality, is energy carrier efficiently, has energy density height, cleaning, renewable, products of combustion and be water and characteristics such as pollution-free, is very good renewable energy source.At present, hydrogen mainly transforms (account for hydrogen source 96%) and water electrolysis hydrogen production (accounting for 4%) from the reformation of fossil oil, fails to break away from the dependence to original fossil energy.Therefore, how to utilize renewable resources to obtain the concern widely that hydrogen is subjected to people constantly.Biological hydrogen production is one of important channel that addresses this problem.Biological hydrogen production have normal temperature and pressure reaction, mild condition, environmentally friendly, can utilize discarded biological substance to be advantages such as substrate, can be with environmental pollution improvement, reduce disposal of pollutants and interrelate, be very good hydrogen production process.

The research of modern biological hydrogen production starts from the energy dilemma of the seventies in 20th century, and since the nineties, along with the further understanding of people to Greenhouse effect, biological hydrogen production has caused people's extensive attention more as the hydrogen production process of Sustainable development.Bio-hydrogen production technology comprises optical drive process and two kinds of routes of anaerobically fermenting.The former utilizes photosynthetic bacterium or algae directly conversion of solar energy to be hydrogen, is a very ideal process, but because the light utilising efficiency is very low, factors such as photoreactor difficult design are difficult to push to use at no distant date.What the latter adopted is the hydrogenogens anaerobically fermenting, and its advantage is that product hydrogen speed is fast, reactor design simple and can combines with discarded biological utilization, with respect to the former the easier industrial application that realizes in the near future.

Fermentation method hydrogen manufacturing starts from middle nineteen sixties, and the nineties comes into one's own, but progress and little.Late nineteen nineties is to the beginning of this century, and people recognize that ferment for hydrogen production is easier and realize industrialization in the near future, have increased the scientific research input of dark ferment for hydrogen production aspect greatly, have produced the basic research result of a collection of relevant culture process.The research of the hydrogen production process that combines with the abandoned biomass processing in recent years greatly increases, some of them have reached the pilot scale level, but mainly concentrate on reactor type design, the technical study, and the mixed culture hydrogen generation efficiency is lower than pure culture, total transformation efficiency is not high, and this is the bottleneck place of ferment for hydrogen production just also.Solving the key of ferment for hydrogen production bottleneck, is to realize technological breakthrough, improves the hydrogen yield.Studies show that, only, can't fundamentally break through the low problem of hydrogen generation efficiency, must pay attention to the research and development of highly effective hydrogen yield bacterial classification from the angle of technology.

For many years, the hydrogenogens kind of using in the dark ferment for hydrogen production mainly comprises enterobacter (Enterobacter), fusobacterium (Clostridium), Escherichia (Escherichia) and bacillus (Bacillus), and is wherein maximum with the correlative study of enterobacter and fusobacterium especially.Fusobacterium produces the hydrogen rate and can reach 2.36mol/mol glucose, enteroaerogen belongs to product hydrogen rate and reaches as high as 3mol/mol glucose (being 6mol/mol sucrose) [Kumar, N.and Das, D.Bioprocess Engineering 23,205-208 (2000)], [Kumar, N.andDas, D.Process Biochemistry 35,589-593 (2000)].With clostridium (Clostridium sp) is that the mechanism of the obligatory anaerobic bacteria fermentation and hydrogen production of representative is: generate pyruvic acid after the glucose glycolysis, in forming the acetic acid process, a part of electronics forms hydrogen by ferredoxin under the effect of hydrogen enzyme.One mole glucose can form 4 mol of hydrogen and 2 molecule acetic acid.Therefore, in the time of the obligatory anaerobic bacteria fermentation and hydrogen production, must follow organic acid formation such as acetic acid.Amphimicrobian hydrogenogens E.aerogenes separates approach by sugar and tricarboxylic acid cycle (TCA) approach produces NADH and ATP, the hydrogen enzyme is converted to hydrogen by NADH with proton, producing hydrogen theoretical transformation rate is that 1 mole of glucose forms 12mol hydrogen, is far longer than the hydrogen yield of obligatory anaerobic bacteria.Therefore, E.aerogenes is the important bacterial classification of the efficient ferment for hydrogen production technology of exploitation.

Along with the develop rapidly of biotechnology, the simple bacterial screening and the optimization of culture process can not have been satisfied the demand that improves hydrogen generation efficiency.The research of ferment for hydrogen production need enter cell interior, by the transformation of hydrogen enzyme and metabolism network thereof being strengthened the hydrogen process of producing.On gene pool, can obtain at present to surpass 100 kinds hydrogenase gene sequence [Paulette M.Vignais, Bernard Billoud, Jacques Meyer.FEMS MicrobiologyReviews 25,455-501 (2001)], but still have the hydrogenase gene of a large amount of known hydrogenogens strains not cloned as yet, seeking more hydrogenase gene is the important directions [Kalia of biological hydrogen production research, V.C., Lal, S., Ghai, R., Mandal, M.and Chauhan, A.Trends in Biotechnology 21,152-156 (2003)].Different hydrogen enzymes have different functions, compare with other enzyme system, and people are also very limited to the understanding of hydrogen enzyme.

At present, the more clearly of research is the gene of colibacillary hydrogen enzyme I, II, III and IV, and they all belong to Ni-Fe hydrogen enzyme, relevant with product hydrogen [Andrews, S.C., Berks of hydrogen enzyme III wherein with IV, B.C., Mcclay, J., Ambler, A., Quail, M.A., Golby, P.and Guest, J.R.Microbiology143,3633-3647 (1997)], and I, II are relevant with suction hydrogen process.The hydrogen enzyme of fusobacterium all belongs to iron hydrogen enzyme, and three clostridial iron hydrogen enzymes have sequencing result, but not clear about its subsidiary gene, regulatory mechanism.Be cloned into clostridial iron hydrogenase gene, and in photosynthetic bacterium, obtained heterogenous expression, strengthened the product hydrogen process of photosynthetic bacteria.The expression of clostridial iron hydrogenase gene in intestinal bacteria be not success but, may be since clostridium and intestinal bacteria for [the Yasuo Asada that causes inequality of the subsidiary gene system of iron hydrogen expression of enzymes, Yoji Koike, JorgSchnackenberg, Masato Miyake, Ieaki Uemura, Jun Miyake.Biochimica etBiophysica Acta 1490,269-278 (2000)].Recently, the method by iron hydrogen enzyme conserved sequence design such as Mishra J. clones the iron hydrogen enzyme about 450bp from E.cloacae IIT-BT08, and in the intestinal bacteria that do not produce hydrogen heterogenous expression, verified its function, the result shows that this hydrogen enzyme is positioned at tenuigenin [Mishra, J., Kumar, N., Ghosh, A.K.and Das, D.International Journal of Hydrogen Energy27,1475-1479 (2002)], [Mishra, J., Khurana, S., Kumar, N., Ghosh, A.K.andDas, D.Biochemical and Biophysical Research Communications 324,679-685 (2004)].The early-stage Study of enteroaerogen E.aerogenes shows, on its cytolemma, the NADH effect that produces in hydrogen enzyme and the cell generates hydrogen [Nakashimada, Y., Rachman, M.A., Kakizono, T.andNishio, N.International Journal of Hydrogen Energy 27,1399-1405 (2002)].Therefore study hydrogen enzyme characteristic, gene and the biological function explore thereof of this Pseudomonas, significant for the technological breakthrough that realizes raising enteroaerogen product hydrogen yield.

Studies show that to what intestinal bacteria produced the hydrogen process intestinal bacteria can directly utilize formic acid, also the formic acid that can produce in assimilation glucide metabolic process is substrate, and under the effect of formic acid lyase system, decompose formic acid generates CO ₂And H ₂[Akihito?Yoshida，Taku?Nishimura，Hideo?Kawaguchi，1?Masayuki?Inui，andHideaki?Yukawa*.Appl?Environ?Microbiol.71：6762-6768(2005)]。It is to produce the fastest approach of hydrogen that formic acid produces the hydrogen approach.

Enteroaerogen is a facultative anaerobe, and fast growth under anaerobic can produce hydrogen, and advantage such as it is wide to have the substrate of utilization scope, and growth adaptability is strong, is the bacterial strain with good industrial proterties.Existing many reports about enteroaerogen product hydrogen, but be mostly aspect technology and cultivation [E.Palazzi, B.Fabiano, P.Perego.Bioprocess Eng.22:205-213 (2000) .], the relevant relevant gene of hydrogen that produces is also without any report.Studies show that, enteroaerogen has the utilize formic acid similar with intestinal bacteria and produces the ability [Tatsuo of hydrogen, K., Shigeharu, T.Mar Biotechnol.7:112-118 (2005) .], and it has the hydrogen of suction process, [the Y.L Ren. that exists that inhales the hydrogen enzyme is promptly arranged, X.H.Xing., C.Zhang., and Z.X.Gou.Biotechnol Lett.27 (14): 1029-1033 (2005) .].Therefore clone enteroaerogen and utilize formate transporters to produce the gene and the suction hydrogenase gene of hydrogen, utilize formic acid to produce the process of hydrogen and consumption hydrogen to understanding it, thereby utilize the formate transporters biological hydrogen production to have great importance.Clone's formic acid hydrogenase gene and suction hydrogenase gene also are to useful the replenishing of hydrogenase gene family.

Summary of the invention

The purpose of this invention is to provide hydrogen-producing engineering bacteria and application thereof.

Hydrogen-producing engineering bacteria provided by the invention, be following a) or b) engineering bacteria:

A) engineering bacteria that obtains of the Δ hybO albumen among the deactivation E.aerogenes IAM1183;

B) engineering bacteria that obtains of Δ hybO albumen among the deactivation E.aerogenes IAM1183 and Δ hycA albumen;

The proteic aminoacid sequence of described Δ hybO is the sequence 1 in the sequence table; The proteic aminoacid sequence of described Δ hycA is the sequence 4 in the sequence table.

Δ hybO albumen among the described deactivation E.aerogenes IAM1183 can be realized by dna fragmentation Q is imported among the described E.aerogenes IAM1183; Described dna fragmentation Q is followed successively by homology arm T to the downstream from the upstream ₁, dna fragmentation N, homology arm T ₂Described homology arm T ₁With homology arm T ₂Can with the proteic encoding gene generation of described Δ hybO homologous recombination, the described Δ hybO of deactivation albumen; Described dna fragmentation N is the antibiotics resistance fragment.

The nucleotide sequence of the proteic encoding gene of described Δ hybO is the sequence 2 in the sequence table; Described homology arm T ₁Nucleotide sequence be sequence 7 in the sequence table; Described homology arm T ₂Nucleotide sequence be sequence 8 in the sequence table; Described dna fragmentation N is the tetracyclin resistance fragment.

The nucleotide sequence of described dna fragmentation Q specifically can be the sequence 3 in the sequence table.

Δ hybO albumen among the described deactivation E.aerogenes IAM1183 and Δ hycA albumen can be realized by dna fragmentation P and dna fragmentation Q are imported among the described E.aerogenes IAM1183; In the actually operating, the importing of dna fragmentation P and dna fragmentation Q can be taked order arbitrarily successively, and as importing dna fragmentation P earlier, screening obtains recombinating and imports dna fragmentation Q again in the reorganization bacterium behind the bacterium;

Described dna fragmentation P is followed successively by homology arm T to the downstream from the upstream ₃, dna fragmentation M, homology arm T ₄Described homology arm T ₃With homology arm T ₄Can with the proteic encoding gene generation of described Δ hycA homologous recombination, the described Δ hycA of deactivation albumen; Described dna fragmentation M is the antibiotics resistance fragment;

Described dna fragmentation Q is followed successively by homology arm T to the downstream from the upstream ₁, dna fragmentation N, homology arm T ₂Described homology arm T ₁With homology arm T ₂Can with the proteic encoding gene generation of described Δ hybO homologous recombination, the described Δ hybO of deactivation albumen; Described dna fragmentation N is the antibiotics resistance fragment.

The nucleotide sequence of the proteic encoding gene of described Δ hybO is the sequence 2 in the sequence table; Described homology arm T ₁Nucleotide sequence be sequence 7 in the sequence table; Described homology arm T ₂Nucleotide sequence be sequence 8 in the sequence table; Described dna fragmentation N is the tetracyclin resistance fragment; The nucleotide sequence of the proteic encoding gene of described Δ hycA is the sequence 5 in the sequence table; Described homology arm T ₃Nucleotide sequence be sequence 9 in the sequence table; Described homology arm T ₄Nucleotide sequence be sequence 10 in the sequence table; Described dna fragmentation M is the kalamycin resistance fragment.

The nucleotide sequence of described dna fragmentation Q specifically can be the sequence 3 in the sequence table; The nucleotide sequence of described dna fragmentation P specifically can be the sequence 6 in the sequence table.

The present invention also protects a kind of dna fragmentation Q, and dna fragmentation Q is followed successively by homology arm T to the downstream from the upstream ₁, dna fragmentation N, homology arm T ₂Described homology arm T ₁With homology arm T ₂Can with the proteic encoding gene generation of the Δ hybO homologous recombination of E.aerogenes IAM1183, deactivation Δ hybO albumen; The proteic aminoacid sequence of described Δ hybO is the sequence 1 in the sequence table; Described dna fragmentation N is the antibiotics resistance fragment.

The nucleotide sequence of described dna fragmentation Q most preferably is the sequence 3 in the sequence table.

Contain the expression cassette of described dna fragmentation Q or recombinant expression vector or transgenic cell line or the reorganization bacterium all belongs to protection scope of the present invention.

The present invention is a starting strain with enteroaerogen E.aerogenes, by the hydrogen production associated protein encoding gene among the enteroaerogen E.aerogenes is carried out deactivation, obtained the bacterial strain that two strain formate transporters hydrogen production potentials improve, can be applicable to biological hydrogen production, biological hydrogen production is had huge directive significance.

The engineering bacteria that the present invention obtains has the following advantages:

1) starting strain E.aerogenes IAM1183 is a facultative anaerobe, all can grow fast under aerobic, anaerobic condition, and is strong to environmental compatibility; Utilize its carry out biological hydrogen production have the substrate of utilization scope wide, utilize the substrate ability strong and produce the hydrogen advantage of higher, be to have the potential strain excellent that is applied to industrialization hydrogen manufacturing.

2) the engineering bacteria E.aerogenes IAM1183-O and the engineering bacteria E.aerogenesIAM1183-AO of the present invention's acquisition, except having original bacterium 1) advantage, it is stronger also to have the substrate utilization ability, characteristics, especially E.aerogenes IAM1183-AO that hydrogen production potential further improves.

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.

Description of drawings

Fig. 1 is monoclonal antibody and the two anti-screening figure of engineering bacteria E.aerogenes IAM1183-O

Fig. 2 is that the PCR of engineering bacteria E.aerogenes IAM1183-O identifies figure

Fig. 3 is monoclonal antibody and the two anti-screening figure of engineering bacteria E.aerogenes IAM1183-A

Fig. 4 is that the PCR of engineering bacteria E.aerogenes IAM1183-A identifies figure

Fig. 5 is that the PCR of engineering bacteria E.aerogenes IAM1183-AO identifies figure

The growth curve OD of Fig. 6 engineering bacteria ₆₀₀

PH in Fig. 7 engineering bacteria process of growth changes

The H of Fig. 8 engineering bacteria ₂Generate and analyze

The CO of Fig. 9 engineering bacteria ₂Generate and analyze

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

Used primer is as follows in following examples:

hycA-Km-fw： CTGCA?ATTCGCTGGT?TCAGGGCATC?ACCCTGTCAA?AAGCGATAGGCTCCGCCCCCCTGA；

hycA-Km-rv： GGCTTAAATCCACCGGCTGGTCGTGTTCCATGGCGTCATACAGGTGGCAC?TTTTCGGGG；

HybO-tet-fw： AATCTCTGCTTCGTGCAACGCATCCAACGGTAGAAAACCTTTTGGTGACTGCGCTCCTC；

HybO-tet-rv： GATACCTTCT?TCGTTACAGC?CATAGCAAGG?GTGACCAATCTGTTGTTGCTCAGGTCGCA；

hycA-fw：CTGCAATTCGCTGGT?TCAGGGCATC；

hycA-rv：GGCTTAAATCCACCG?GCTGGTCGTG；

hybO-fw：AATCTCTGCT?TCGTGCAACGCATC；

hybO-rv：GATACCTTCT?TCGTTACAGCCATA。

Culture medium prescription and purposes related in following examples are as follows:

(1) LB substratum (L ^-1): peptone 10g, yeast soak powder 5g, NaCl 10g, agar powder 15g (adding during solid medium); Be used for bacterial classification short term storage and activation culture.

(2) dextrose culture-medium (L ^-1): glucose 15g, peptone 5g, K ₂HPO ₄3H ₂O 14g, KH ₂PO ₄6g, (NH ₄) ₂SO ₄2g, MgSO ₄7H ₂O 0.2g; Be used for ferment for hydrogen production.

The acquisition of embodiment 1, enteroaerogen E.aerogenes IAM1183-O

Starting strain enteroaerogen (E.aerogenes IAM1183) is available from using microbe institute of Tokyo Univ Japan (IAM) strain library.

(Genbank NO:EF601126) carries out sequential analysis to the enteroaerogen gene order among the NCBI, designs a pair of primer HybO-tet-fw and HybO-tet-rv, and sequence is as follows:

HybO-tet-fw：

5’- AATCTCTGCTTCGTGCAACGCATCCAACGGTAGAAAACCTTTTGGTGACTGCGCTCCTC-3’；

HybO-tet-rv：

5’- GATACCTTCTTCGTTACAGCCATAGCAAGGGTGACCAATCTGTTGTTGCTCAGGTCGCA-3’。

The sequence of the band line in the primer is the homologous sequence of Δ hybO gene in the enteroaerogen (E.aerogenes IAM1183).

The mode that transforms by electricity with the pYM-red plasmid (in plum, Zhou Jianguang, Chen Wei, Li Shanhu, Huang Cuifen, the foundation of a kind of transferable recombined engineering pYM-Red of system. biological chemistry and biophysics progress .2005,32 (4) .) enteroaerogen of shocking by electricity is (among the E.aerogenes IAM1183, carry out paraxin (24mg/mL) resistance screening, from positive strain, extract the pYM-red plasmid and identify, obtained to contain the enteroaerogen (E.aerogenes IAM1183) of pYM-red recombinant plasmid.

With pACYC184 plasmid (Chang, A.C., and S.N.Cohen.1978.Construction andcharacterization of amplifiable multicopy DNA cloning vehicles derived fromthe P15A cryptic miniplasmid.J.Bacteriol.134:1141-1156.) DNA is a template, carry out pcr amplification with primer HybO-tet-fw and HybO-tet-rv, acquisition contains the linear DNA of tetracycline marker, with this linear DNA as targeting vector.Mode by electricity transforms imports targeting vector the enteroaerogen (E.aerogenes IAM1183) that contains the pYM-red plasmid.

Bacterium after transforming is coated on the monoclonal antibody LB flat board of the tsiklomitsin (4ug/ml) that contains, cultivated 1 day for 30 ℃; Then the bacterium that grows is transferred and contain on the two anti-LB flat board of tsiklomitsin (4ug/ml) and paraxin (24ug/ml), cultivated 1 day for 30 ℃.Monoclonal antibody and two anti-results of screening are seen Fig. 1, and left side figure is the figure of monoclonal antibody screening among Fig. 1, and right figure is the figure of two anti-screenings.

The clone who grows on the several two anti-substratum of picking at random, extract genomic dna, method by PCR identify targeting vector whether with karyomit(e) on target site homologous recombination has taken place, the used a pair of primer of PCR reaction is hybO-fw and hybO-rv, and the sequence of hybO-fw and hybO-rv is as follows:

hybO-fw?5’-AATCTCTGCT?TCGTGCAACG?CATC-3’；

hybO-rv?5’-GATACCTTCT?TCGTTACAGC?CATA-3’。

The PCR qualification result is seen Fig. 2, among Fig. 2, and 1:DNA 2000marker; 2:E.aerogenes IAM1183-O.As seen from the figure, the amplified production of E.aerogenes IAM1183-O has obtained the 1800bp object tape, and is consistent with expected results.The result shows that among the clone of acquisition, homologous recombination has taken place the target site on targeting vector and the karyomit(e).Will the saltant called after E.aerogenes IAM1183-O of homologous recombination have taken place.

The acquisition of embodiment 2, enteroaerogen E.aerogenes IAM1183-A

(Genbank NO:EF601125) carries out sequential analysis to the enteroaerogen gene order among the NCBI, designs a pair of primer hycA-Km-fw and hycA-Km-rv, and the sequence of hycA-Km-fw and hycA-Km-rv is as follows:

hycA-Km-fw：

5’- CTGCAATTCGCTGGTTCAGGGCATCACCCTGTCAAAAGCGATAGGCTCCGCCCCCCTGA-3’；

hycA-Km-rv：

5’- GGCTTAAATCCACCGGCTGGTCGTGTTCCATGGCGTCATACAGGTGGCACTTTTCGGGG-3’。

The sequence of the band line in the primer is the homology arm of enteroaerogen (E.aerogenes IAM1183) Δ hycA.

With the pET28a plasmid DNA is template, carries out pcr amplification with primer hycA-Km-fw and hycA-Km-rv, obtains to contain the linear DNA of kantlex mark, with this linear DNA as targeting vector.Mode by electricity transforms imports targeting vector the enteroaerogen (E.aerogenes IAM1183) that contains the pYM-red recombinant plasmid.Bacterium after transforming is coated on the monoclonal antibody LB flat board that contains kantlex (50mg/mL), cultivated 1 day for 30 ℃; Then the bacterium that grows is transferred and contain on the two anti-LB flat board of kantlex (50mg/mL) and paraxin (30mg/mL), cultivated 1 day for 30 ℃.Monoclonal antibody and two anti-results of screening are seen Fig. 3, and left side figure is the figure of monoclonal antibody screening among Fig. 3, and right figure is the figure of two anti-screenings.

The clone who grows on the several two anti-substratum of picking at random, extract genomic dna, method by PCR identify targeting vector whether with karyomit(e) on target site homologous recombination has taken place, the used a pair of primer of PCR reaction is hycA-fw and hycA-rv, and the sequence of hycA-fw and hycA-rv is as follows:

hycA-fw：5’-CTGCAATTCGCTGGTTCAGGGCATC-3’；

hycA-rv：5’-GGCTTAAATCCACCGGCTGGTCGTG-3’。

The PCR qualification result is seen Fig. 4, among Fig. 4, and 1:E.aerogenes IAM1183-A; (2:E.aerogenesIAM1183 contrast); 3:DNA 2000marker.As seen from the figure, the amplified production of E.aerogenes IAM1183-A has obtained the 1700bp object tape; The amplified production of E.aerogenes IAM1183 has obtained the band of 550bp, and is consistent with expected results.The result shows that among the clone of acquisition, homologous recombination has taken place the target site on targeting vector and the karyomit(e).Will the saltant called after E.aerogenesIAM1183-A of homologous recombination have taken place.

The acquisition of embodiment 3, enteroaerogen E.aerogenes IAM1183-AO

With E.aerogenes IAM1183-O is starting strain, deactivation Δ hycA albumen (method is with embodiment 2); Or be starting strain with E.aerogenes IAM1183-A, deactivation Δ hycO albumen (method is with embodiment 1) all can obtain mutant strain E.aerogenes IAM1183-AO.Below be starting strain with E.aerogenes IAM1183-A, make up E.aerogenes IAM1183-AO.

With the pACYC184 plasmid DNA is template, carries out pcr amplification with primer HybO-tet-fw and HybO-tet-rv, obtains to contain the linear DNA of tetracycline marker, with this linear DNA as targeting vector.Mode by electricity transforms imports targeting vector the enteroaerogen E.aerogenes IAM1183-A that contains the pYM-red plasmid.Bacterium after transforming is coated on the two anti-LB flat board that contains kantlex (50mg/mL) and tsiklomitsin (4mg/mL), cultivated 1 day for 30 ℃.

hybO-fw?5’-AATCTCTGCT?TCGTGCAACG?CATC-3’；

hybO-rv?5’-GATACCTTCT?TCGTTACAGC?CATA-3’。

The PCR qualification result is seen Fig. 5, among Fig. 5, and 1:DNA 2000 marker; 2:E.aerogenes IAM1183-AO.As seen from the figure, the amplified production of E.aerogenes IAM1183-AO has obtained the 1800bp object tape, and is consistent with expected results.The result shows that among the clone of acquisition, homologous recombination has taken place the target site on targeting vector and the karyomit(e).Will the saltant called after E.aerogenes IAM1183-AO of homologous recombination have taken place.

The product hydrogen performance of embodiment 4, engineering bacteria and physiological property are measured

In different 70mL serum bottles, adorn the 20mL dextrose culture-medium respectively, engineering bacteria E.aerogenes IAM1183-O after will activating respectively and engineering bacteria E.aerogenes IAM1183-AO carry out shake-flask culture, and the wild bacterium after will activating simultaneously carries out the similarity condition shake-flask culture, in contrast.The concrete operations step is as follows:

(1) seed culture: adopt the 15ml centrifuge tube, LB substratum liquid amount 5ml is from solid plate inoculation, 37 ℃ of culture temperature, airbath shaking speed 170rpm, incubated overnight.

(2) anaerobism shake-flask culture: adopt 70ml serum bottle anaerobism culturing bottle, dextrose culture-medium liquid amount 20ml (using the air in nitrogen replacement culturing bottle top and the substratum in advance); Plant the inoculum size 2.5% (v/v) of daughter bacteria, 37 ℃ of culture temperature, airbath, shaking speed 170rpm.Cultivated 24 hours.

Three repetitions are established in test, and all results are multiple mean value three times, represent with mean+SD.

Collect the gas that engineering bacteria and wild bacterium produce respectively, utilize syringe to measure the gas volume that generates; Utilize spectrophotometer (UV-1206, SHIMADZU company (Japan)) to measure the growing state of thalline; Utilize pH meter (CHNO60 (828), ORION company (U.S.)) to measure the changing conditions of pH.The OD of engineering bacteria and wild bacterium ₆₀₀Variation see Fig. 6, the pH of the nutrient solution of engineering bacteria and wild bacterium changes and sees Fig. 7, the hydrogen generation situation of engineering bacteria and wild bacterium is seen Fig. 8, the CO of engineering bacteria and wild bacterium ₂Generate situation map 9.

The maximum hydrogen-producing speed of maximum specific growth rate of engineering bacteria and wild bacterium and thalline relatively sees Table 1.

Table 1 maximum growth rate and hydrogen-producing speed (n=3)

Above result shows that after cultivating through batch formula of 12h, the cell density of wild bacterium reaches the highest (OD ₆₀₀Be 2.26), and interim at the fastest logarithmic growth of product hydrogen, the cell density of two strain engineering bacterias is all than wild bacterium height.Hydrogen is and cell growth link coupled primary metabolite that 2 strain engineering bacterias also show higher hydrogen-producing speed when logarithmic phase, and final hydrogen output is also higher, reaches 76.8mM and 83.0mM respectively.The pH variation tendency of 3 strain bacterium is consistent, all produces acid during the fermentation and makes fermented liquid be acid, and pH drops between the 4.7-4.9 from initial value 6.9.Faster than wild bacterium, this is relevant with them in the high value-added speed of logarithmic phase in the pH of logarithmic phase fall off rate outline for engineering bacteria E.aerogenes IAM1183-O and E.aerogenes IAM1183-AO.The carbonic acid gas output of engineering bacteria E.aerogenes IAM1183-AO will be starkly lower than other two strains bacterium.Compare with the maximum specific growth rate of 2 strain engineering bacterias and maximum hydrogen-producing speed and with wild bacterium, the maximum specific growth rate of wild bacterium is higher than 2 strain engineering bacterias, reaches 0.523h ^-1, and the maximum specific growth rate of engineering bacteria E.aerogenes IAM1183-AO is minimum, is 0.523h ^-1Maximum hydrogen-producing speed reflection be the high yield output of hydrogen of unit cell unit time, compare with wild bacterium, the maximum hydrogen-producing speed of the thalline of 2 strain engineering bacterias all is improved to some extent, and is respectively 1.18 and 1.45 times of wild-type.

The metabolic flux analysis of embodiment 5, engineering bacteria

Detect the distribution of each metabolic flux in wild bacterium and the engineering bacteria cell respectively, concrete steps are as follows:

(1) seed culture: adopt the 15ml centrifuge tube, LB substratum liquid amount 5ml is from solid plate inoculation bacterium, 37 ℃ of culture temperature, airbath shaking speed 170rpm, incubated overnight.

(2) anaerobism shake-flask culture: adopt 70ml serum bottle anaerobism culturing bottle, dextrose culture-medium liquid amount 20ml (using the air in nitrogen replacement culturing bottle top and the substratum in advance); Plant the inoculum size 2.5% (v/v) of daughter bacteria, 37 ℃ of culture temperature, airbath shaking speed 170rpm.Cultivated 16 hours.

(3) behind the anaerobism shake-flask culture 16h meta-bolites is detected.Behind fermented product centrifuging and taking supernatant, filter.Utilize the output and the composition of high-pressure liquid chromatography metabolite.High-pressure liquid phase gas spectrum is (HPLC-10A, SHIMADZU company (Japan).Concrete detection method is as follows: the 10ml sample is at 12000rpm, 4 ℃ centrifugal 5 minutes, get supernatant frozen in-80 ℃ of refrigerators until measurement.Adopt high performance liquid chromatography (HPLC) to measure glucose, lactic acid, succsinic acid, formic acid, acetate, 2,3-butyleneglycol and concentration of ethanol.

Analytical procedure and condition: chromatographic column is selected Tianjin, island Shim-pack SCR-102H for use, and matrix is PS/DVB, and functional group is-SO ₃H.This column dimension is: 300mm (length) * 8mm (internal diameter), particle diameter are 7 μ m.Chromatographiccondition is as follows: 40 ℃ of column temperatures, moving phase 5mM perchloric acid, flow velocity 1.0mlmin ^-1Differential detector (RID); Sample feeding amount 20 μ l.The HPLC computer control software CLASS-VP workstation that adopts Tianjin, island company to provide carries out the analyzing and processing of data.

The experiment triplicate, experimental result is as shown in table 2.Data in the table 2 are mean+SD.

Table 2 metabolic flux analysis (n=3)

The result shows, the hydrogen of 2 strain engineering bacterias reaches 1.27 and 1.36mol-hydrogen mol-glucose respectively to the yield of glucose ^-1, all be higher than analog value (the 1.16mol-hydrogen mol-glucose of wild bacterium ^-1).This explanation can both increase the flux of product hydrogen pathways metabolism effectively to the deactivation of Δ hycA with to the deactivation of Δ hybO, produces the hydrogen yield thereby improve cell.Meanwhile, the said gene modification also has certain influence to the distribution of other meta-bolites.2,3-butyleneglycol, lactic acid, succsinic acid and ethanol all are to rely on NADH in the born of the same parents and the meta-bolites that produces, compare with wild bacterium, and the yield of these materials all increases in 2 strain engineering bacterias to some extent, demonstrate the increase of available reducing power in the born of the same parents, and this is an essential condition that helps producing hydrogen.The acetate of 2 strain engineering bacterias and ethanol production sum all have the raising of certain amplitude than wild type strain, show that formic acid produces the hydrogen approach and is reinforced in producing the hydrogen process, and this has also reached hydrogenlyase negative regulator gene deactivation expected effect.

Test shows, the deactivation meeting of target gene is caused the variation of corresponding enzymic activity in the born of the same parents, and then changes metabolic flux, increases the output of target product.The engineering strain that the present invention obtained has higher hydrogen production potential, can be applicable to ferment for hydrogen production.

Sequence table

＜110〉Tsing-Hua University

＜120〉hydrogen-producing engineering bacteria and application thereof

<130>CGGNARY81442

<160>10

<210>1

<211>263

<212>PRT

＜213〉enteroaerogen (E.aerogenes)

<400>1

Val?Ile?Trp?Ile?Gly?Ala?Gln?Glu?Cys?Thr?Gly?Cys?Thr?Glu?Ser?Leu

1 5 10 15

Leu?Arg?Ala?Thr?His?Pro?Thr?Val?Glu?Asn?Leu?Val?Leu?Glu?Thr?Ile

20 25 30

Ser?Leu?Glu?Tyr?His?Glu?Val?Leu?Ser?Ala?Ala?Phe?Gly?His?Gln?Val

35 40 45

Glu?Glu?Asn?Lys?His?Asn?Ala?Leu?Glu?Lys?Tyr?Lys?Gly?Gln?Tyr?Val

50 55 60

Leu?Val?Val?Asp?Gly?Ser?Ile?Pro?Leu?Lys?Asp?Asn?Gly?Ile?Tyr?Cys

65 70 75 80

Met?Val?Ala?Gly?Glu?Pro?Ile?Val?Asp?His?Ile?Arg?Lys?Ala?Ala?Glu

85 90 95

Gly?Ala?Ala?Ala?Ile?Ile?Ala?Ile?Gly?Ser?Cys?Ser?Ala?Trp?Gly?Gly

100 105 110

Val?Ala?Ala?Ala?Gly?Val?Asn?Pro?Thr?Gly?Ala?Val?Ser?Leu?Gln?Glu

115 120 125

Val?Leu?Pro?Gly?Lys?Thr?Val?Ile?Asn?Ile?Pro?Gly?Cys?Pro?Pro?Asn

130 135 140

Pro?His?Asn?Phe?Leu?Ala?Thr?Val?Ala?His?Ile?Ile?Thr?Tyr?Gly?Lys

145 150 155 160

Pro?Pro?Lys?Leu?Asp?Asp?Lys?Asn?Arg?Pro?Thr?Phe?Ala?Tyr?Gly?Arg

165 170 175

Leu?Ile?His?Glu?His?Cys?Glu?Arg?Arg?Pro?His?Phe?Asp?Ala?Gly?Arg

180 185 190

Phe?Ala?Lys?Glu?Phe?Gly?Asp?Glu?Gly?His?Arg?Glu?Gly?Trp?Cys?Leu

195 200 205

Tyr?His?Leu?Gly?Cys?Lys?Gly?Pro?Glu?Thr?Tyr?Gly?Asn?Cys?Ser?Thr

210 215 220

Leu?Gln?Phe?Cys?Asp?Val?Gly?Gly?Val?Trp?Pro?Val?Ala?Ile?Gly?His

225 230 235 240

Pro?Cys?Tyr?Gly?Cys?Asn?Glu?Glu?Gly?Ile?Gly?Phe?His?Lys?Gly?Ile

245 250 255

His?Gln?Leu?Ala?Asn?Val?Glu

260

<210>2

<211>789

<212>DNA

＜213〉enteroaerogen (E.aerogenes)

<400>2

gttatctgga?ttggcgcgca?ggagtgcacc?ggttgtacgg?aatctctgct?tcgtgcaacg 60

catccaacgg?tagaaaacct?cgtactggag?actatctctc?tggagtatca?cgaagtgctt 120

tccgccgcct?tcggtcatca?ggtcgaagag?aacaaacata?acgctcttga?gaagtacaaa 180

gggcagtatg?tgttagtggt?ggatggttcc?atcccattaa?aagataacgg?tatttattgc 240

atggttgccg?gtgagccgat?tgtggatcac?atccgcaaag?cggcggaagg?cgcagcagcc 300

attatcgcta?tcggttcctg?ctctgcgtgg?ggcggtgttg?ccgcagctgg?agttaaccca 360

actggcgcag?tcagcctgca?agaagttctg?ccaggcaaaa?ccgttatcaa?tattccgggc 420

tgcccgccga?acccgcacaa?cttcctcgcg?accgttgcgc?acatcatcac?ttacggcaaa 480

ccgccgaaac?tggatgacaa?aaaccgtccg?accttcgcct?atggccgtct?gattcacgaa 540

cactgcgaac?gtcgcccgca?cttcgatgct?ggtcgttttg?ccaaagagtt?cggtgatgaa 600

ggccaccgcg?aaggctggtg?cctgtaccac?ctcggctgta?aagggccaga?aacttacggc 660

aactgctcaa?cgctgcaatt?ctgcgatgtt?ggcggtgtgt?ggccggtggc?gattggtcac 720

ccttgctatg?gctgtaacga?agaaggtatc?ggcttccata?aaggcatcca?tcaactggcc 780

aacgtcgaa 789

<210>3

<211>1910

<212>DNA

＜213〉artificial sequence

<400>3

aatctctgct?tcgtgcaacg?catccaacgg?tagaaaacct?tttggtgact?gcgctcctcc 60

aagccagtta?cctcggttca?aagagttggt?agctcagaga?accttcgaaa?aaccgccctg 120

caaggcggtt?ttttcgtttt?cagagcaaga?gattacgcgc?agaccaaaac?gatctcaaga 180

agatcatctt?attaatcaga?taaaatattt?ctagatttca?gtgcaattta?tctcttcaaa 240

tgtagcacct?gaagtcagcc?ccatacgata?taagttgtaa?ttctcatgtt?tgacagctta 300

tcatcgataa?gctttaatgc?ggtagtttat?cacagttaaa?ttgctaacgc?agtcaggcac 360

cgtgtatgaa?atctaacaat?gcgctcatcg?tcatcctcgg?caccgtcacc?ctggatgctg 420

taggcatagg?cttggttatg?ccggtactgc?cgggcctctt?gcgggatatc?gtccattccg 480

acagcatcgc?cagtcactat?ggcgtgctgc?tagcgctata?tgcgttgatg?caatttctat 540

gcgcacccgt?tctcggagca?ctgtccgacc?gctttggccg?ccgcccagtc?ctgctcgctt 600

cgctacttgg?agccactatc?gactacgcga?tcatggcgac?cacacccgtc?ctgtggatcc 660

tctacgccgg?acgcatcgtg?gccggcatca?ccggcgccac?aggtgcggtt?gctggcgcct 720

atatcgccga?catcaccgat?ggggaagatc?gggctcgcca?cttcgggctc?atgagcgctt 780

gtttcggcgt?gggtatggtg?gcaggccccg?tggccggggg?actgttgggc?gccatctcct 840

tgcatgcacc?attccttgcg?gcggcggtgc?tcaacggcct?caacctacta?ctgggctgct 900

tcctaatgca?ggagtcgcat?aagggagagc?gtcgaccgat?gcccttgaga?gccttcaacc 960

cagtcagctc?cttccggtgg?gcgcggggca?tgactatcgt?cgccgcactt?atgactgtct 1020

tctttatcat?gcaactcgta?ggacaggtgc?cggcagcgct?ctgggtcatt?ttcggcgagg 1080

accgctttcg?ctggagcgcg?acgatgatcg?gcctgtcgct?tgcggtattc?ggaatcttgc 1140

acgccctcgc?tcaagccttc?gtcactggtc?ccgccaccaa?acgtttcggc?gagaagcagg 1200

ccattatcgc?cggcatggcg?gccgacgcgc?tgggctacgt?cttgctggcg?ttcgcgacgc 1260

gaggctggat?ggccttcccc?attatgattc?ttctcgcttc?cggcggcatc?gggatgcccg 1320

cgttgcaggc?catgctgtcc?aggcaggtag?atgacgacca?tcagggacag?cttcaaggat 1380

cgctcgcggc?tcttaccagc?ctaacttcga?tcactggacc?gctgatcgtc?acggcgattt 1440

atgccgcctc?ggcgagcaca?tggaacgggt?tggcatggat?tgtaggcgcc?gccctatacc 1500

ttgtctgcct?ccccgcgttg?cgtcgcggtg?catggagccg?ggccacctcg?acctgaatgg 1560

aagccggcgg?cacctcgcta?acggattcac?cactccaaga?attggagcca?atcaattctt 1620

gcggagaact?gtgaatgcgc?aaaccaaccc?ttggcagaac?atatccatcg?cgtccgccat 1680

ctccagcagc?cgcacgcggc?gcatctcggg?cagcgttggg?tcctggccac?gggtgcgcat 1740

gatcgtgctc?ctgtcgttga?ggacccggct?aggctggcgg?ggttgcctta?ctggttagca 1800

gaatgaatca?ccgatacgcg?agcgaacgtg?aagcgactgc?tgctgcaaaa?cgtctgcgac 1860

ctgagcaaca?gattggtcac?ccttgctatg?gctgtaacga?agaaggtatc 1910

<210>4

<211>134

<212>PRT

＜213〉enteroaerogen (E.aerogenes)

<400>4

Arg?His?Arg?Arg?Tyr?Gln?Asp?Gln?Trp?Arg?Gln?Tyr?Cys?Asn?Ser?Leu

1 5 10 15

Val?Gln?Gly?Ile?Thr?Leu?Ser?Lys?Ala?Arg?Leu?His?His?Ala?Met?Ser

20 25 30

Cys?Ala?Pro?Asp?Lys?Glu?Leu?Cys?Phe?Val?Leu?Phe?Glu?His?Phe?Gln

35 40 45

Val?Tyr?Val?Ala?Leu?Ala?Glu?Gly?Phe?Asn?Asn?His?Thr?Ile?Glu?Tyr

50 55 60

Tyr?Val?Glu?Thr?Arg?Asn?Gly?Asp?Asp?Lys?Arg?Leu?Ile?Ala?Gln?Ala

65 70 75 80

Thr?Leu?Ala?Ser?Asp?Gly?Thr?Val?Asp?Gly?Arg?Ile?Ser?Asn?Arg?Ser

85 90 95

Arg?Glu?Gln?Val?Leu?Glu?His?Tyr?Leu?Ala?Ile?Ile?Ala?Ser?Val?Tyr

100 105 110

Asp?Arg?Leu?Tyr?Asp?Ala?Met?Glu?His?Asp?Gln?Pro?Val?Asp?Leu?Ser

115 120 125

His?Leu?Ala?Leu?Ala?His

130

<210>5

<211>405

<212>DNA

＜213〉enteroaerogen (E.aerogenes)

<400>5

cgtcaccgcc?gctatcagga?tcagtggcgc?cagtactgca?attcgctggt?tcagggcatc 60

accctgtcaa?aagcgcgttt?gcatcatgcg?atgagctgcg?cgccggacaa?agagctgtgc 120

ttcgtcctgt?ttgaacattt?tcaggtgtat?gtcgcgctgg?cggaagggtt?caacaaccac 180

accatcgagt?actacgtcga?aacgcgcaat?ggtgatgata?agcgattgat?tgctcaggca 240

acgctggcat?ccgacggtac?cgttgacggc?cggatcagca?accgttcgcg?cgaacaggtg 300

ctggaacatt?acctggccat?tattgccagc?gtctatgacc?gtctgtatga?cgccatggaa 360

cacgaccagc?cggtggattt?aagccatctg?gcgctggccc?attaa 405

<210>6

<211>1693

<212>DNA

<213>6

＜400〉artificial sequence

ctgcaattcg?ctggttcagg?gcatcaccct?gtcaaaagcg?ataggctccg?cccccctgac 60

gagcatcaca?aaaatcgacg?ctcaagtcag?aggtggcgaa?acccgacagg?actataaaga 120

taccaggcgt?ttccccctgg?aagctccctc?gtgcgctctc?ctgttccgac?cctgccgctt 180

accggatacc?tgtccgcctt?tctcccttcg?ggaagcgtgg?cgctttctca?tagctcacgc 240

tgtaggtatc?tcagttcggt?gtaggtcgtt?cgctccaagc?tgggctgtgt?gcacgaaccc 300

cccgttcagc?ccgaccgctg?cgccttatcc?ggtaactatc?gtcttgagtc?caacccggta 360

agacacgact?tatcgccact?ggcagcagcc?actggtaaca?ggattagcag?agcgaggtat 420

gtaggcggtg?ctacagagtt?cttgaagtgg?tggcctaact?acggctacac?tagaaggaca 480

gtatttggta?tctgcgctct?gctgaagcca?gttaccttcg?gaaaaagagt?tggtagctct 540

tgatccggca?aacaaaccac?cgctggtagc?ggtggttttt?ttgtttgcaa?gcagcagatt 600

acgcgcagaa?aaaaaggatc?tcaagaagat?cctttgatct?tttctacggg?gtctgacgct 660

cagtggaacg?aaaactcacg?ttaagggatt?ttggtcatga?acaataaaac?tgtctgctta 720

cataaacagt?aatacaaggg?gtgttatgag?ccatattcaa?cgggaaacgt?cttgctctag 780

gccgcgatta?aattccaaca?tggatgctga?tttatatggg?tataaatggg?ctcgcgataa 840

tgtcgggcaa?tcaggtgcga?caatctatcg?attgtatggg?aagcccgatg?cgccagagtt 900

gtttctgaaa?catggcaaag?gtagcgttgc?caatgatgtt?acagatgaga?tggtcagact 960

aaactggctg?acggaattta?tgcctcttcc?gaccatcaag?cattttatcc?gtactcctga 1020

tgatgcatgg?ttactcacca?ctgcgatccc?cgggaaaaca?gcattccagg?tattagaaga 1080

atatcctgat?tcaggtgaaa?atattgttga?tgcgctggca?gtgttcctgc?gccggttgca 1140

ttcgattcct?gtttgtaatt?gtccttttaa?cagcgatcgc?gtatttcgtc?tcgctcaggc 1200

gcaatcacga?atgaataacg?gtttggttga?tgcgagtgat?tttgatgacg?agcgtaatgg 1260

ctggcctgtt?gaacaagtct?ggaaagaaat?gcataaactt?ttgccattct?caccggattc 1320

agtcgtcact?catggtgatt?tctcacttga?taaccttatt?tttgacgagg?ggaaattaat 1380

aggttgtatt?gatgttggac?gagtcggaat?cgcagaccga?taccaggatc?ttgccatcct 1440

atggaactgc?ctcggtgagt?tttctccttc?attacagaaa?cggctttttc?aaaaatatgg 1500

tattgataat?cctgatatga?ataaattgca?gtttcatttg?atgctcgatg?agtttttcta 1560

agaattaatt?catgagcgga?tacatatttg?aatgtattta?gaaaaataaa?caaatagggg 1620

ttccgcgcac?atttccccga?aaagtgccac?ctgtatgacg?ccatggaaca?cgaccagccg 1680

gtggatttaa?gcc 1693

<210>7

<211>40

<212>DNA

＜213〉artificial sequence

<400>7

aatctctgct?tcgtgcaacg?catccaacgg?tagaaaacct 40

<210>8

<211>40

<212>DNA

＜213〉artificial sequence

<400>8

gataccttct?tcgttacagc?catagcaagg?gtgaccaatc 40

<210>9

<211>40

<212>DNA

＜213〉artificial sequence

<400>9

ctgcaattcg?ctggttcagg?gcatcaccct?gtcaaaagcg 40

<210>10

<211>40

<212>DNA

＜213〉artificial sequence

<400>10

ggcttaaatc?caccggctgg?tcgtgttcca?tggcgtcata 40

Claims

1. hydrogen-producing engineering bacteria, be following a) or b) engineering bacteria:

The proteic aminoacid sequence of described Δ hybO is the sequence 1 in the sequence table; The nucleotide sequence of the proteic encoding gene of described Δ hybO is the sequence 2 in the sequence table;

Δ hybO albumen among the described deactivation E.aerogenes IAM1183 is realized by dna fragmentation Q is imported among the described E.aerogenes IAM1183;

Described dna fragmentation Q is followed successively by homology arm T to the downstream from the upstream ₁, dna fragmentation N, homology arm T ₂Described homology arm T ₁With homology arm T ₂Can with the proteic encoding gene generation of described Δ hybO homologous recombination, the described Δ hybO of deactivation albumen; Described dna fragmentation N is the antibiotics resistance fragment;

Described homology arm T ₁Nucleotide sequence be sequence 7 in the sequence table; Described homology arm T ₂Nucleotide sequence be sequence 8 in the sequence table; Described dna fragmentation N is the tetracyclin resistance fragment;

The proteic aminoacid sequence of described Δ hycA is the sequence 4 in the sequence table; The nucleotide sequence of the proteic encoding gene of described Δ hycA is the sequence 5 in the sequence table;

Δ hybO albumen among the described deactivation E.aerogenes IAM1183 and Δ hycA albumen are realized by dna fragmentation Q and dna fragmentation P are imported among the described E.aerogenes IAM1183;

Described homology arm T ₃Nucleotide sequence be sequence 9 in the sequence table; Described homology arm T ₄Nucleotide sequence be sequence 10 in the sequence table; Described dna fragmentation M is the kalamycin resistance fragment.

2. engineering bacteria as claimed in claim 1 is characterized in that: the nucleotides sequence of described dna fragmentation Q is classified the sequence 3 in the sequence table as.

3.DNA fragment Q is followed successively by homology arm T to the downstream from the upstream ₁, dna fragmentation N, homology arm T ₂Described homology arm T ₁With homology arm T ₂Can with the proteic encoding gene generation of the Δ hybO homologous recombination of E.aerogenes IAM1183, deactivation Δ hybO albumen; The proteic aminoacid sequence of described Δ hybO is the sequence 1 in the sequence table; The nucleotide sequence of the proteic encoding gene of described Δ hybO is the sequence 2 in the sequence table;

Described homology arm T ₁Nucleotide sequence be sequence 7 in the sequence table; Described homology arm T ₂Nucleotide sequence be sequence 8 in the sequence table; Described dna fragmentation N is the tetracyclin resistance fragment.

4. dna fragmentation Q as claimed in claim 3 is characterized in that: the nucleotides sequence of described dna fragmentation N is classified the sequence 3 in the sequence table as.

5. the expression cassette that contains claim 3 or 4 described dna fragmentation Q.

6. the recombinant expression vector that contains claim 3 or 4 described dna fragmentation Q.

7. the transgenic cell line that contains claim 3 or 4 described dna fragmentation Q.

8. the reorganization bacterium that contains claim 3 or 4 described dna fragmentation Q.