CN101608170B - Hydrogen-producing engineering bacteria and its application - Google Patents

Abstract

The invention discloses hydrogen-producing engineering bacteria and application thereof. The hydrogen-producing engineering bacteria are a) engineering bacteria obtained by inactivating delta hybO protein in E.aerogenes IAM1183 or b) engineering bacteria obtained by inactivating delta hybO protein and delta hycA protein in E.aerogenes IAM1183, wherein the amino acid sequence of the delta hybO protein is sequence 1 in a sequence list; and the amino acid sequence of the delta hycA protein is sequence 4 in the sequence list. The hydrogen-producing engineering bacteria can be applied to biological hydrogen production and are of great directive significance to biological hydrogen production. Moreover, the hydrogen-producing engineering bacteria have the advantages of strong environmental adaptability, wide substrate utilization range, strong substrate utilization capability and high hydrogen-producing efficiency.

Description

Hydrogen-producing engineering bacteria and its application

technical field

The invention relates to hydrogen-producing engineering bacteria and applications thereof.

Background technique

The fossil energy system established since the world industrial revolution in the 18th century is now facing two major challenges: 1) The reserves of fossil energy are decreasing day by day, facing the danger of depletion; 2) The combustion of fossil fuels produces a large amount of pollutants, especially CO The greenhouse effect caused by the emission of _second- class greenhouse gases poses a huge threat to the environment on which human beings depend. Therefore, developing sustainable renewable clean energy and gradually replacing fossil energy is an important strategic issue related to national energy security, environmental security and social stability and peaceful development.

Hydrogen energy, as one of the potential alternative clean energy sources in the future, is an efficient energy carrier with the characteristics of high energy density, cleanness, regeneration, and the combustion product is water and non-polluting. It is an ideal renewable energy source. At present, hydrogen mainly comes from the reforming conversion of fossil fuels (accounting for 96% of hydrogen sources) and hydrogen production by electrolysis of water (accounting for 4%), failing to get rid of the dependence on the original fossil energy. Therefore, how to use renewable resources to continuously obtain hydrogen has attracted widespread attention. Biological hydrogen production is one of the important ways to solve this problem. Biological hydrogen production has the advantages of normal temperature and pressure reaction, mild conditions, environmental friendliness, and the use of waste biomass as substrates. It can be linked with environmental pollution control and pollution reduction, and is an ideal hydrogen production method.

The research on modern biohydrogen production began with the energy crisis in the 1970s. Since the 1990s, with people's further understanding of the greenhouse effect, biohydrogen production has attracted more and more attention as a sustainable hydrogen production method. Biological hydrogen production technology includes two routes: light-driven process and anaerobic fermentation. The former uses photosynthetic bacteria or algae to directly convert solar energy into hydrogen, which is a very ideal process. However, due to factors such as low light utilization efficiency and difficult design of photoreactors, it is difficult to push it into application in the near future. The latter uses hydrogen-producing bacteria anaerobic fermentation, which has the advantages of fast hydrogen production, simple reactor design, and the ability to combine with the utilization of waste organisms. Compared with the former, it is easier to realize industrial application in the near future.

Hydrogen production by fermentation began in the mid-1960s and received attention in the 1990s, but little progress has been made. From the end of the 1990s to the beginning of this century, people realized that hydrogen production by fermentation is easier to realize industrialization in the near future, which greatly increased the scientific research investment in hydrogen production by dark fermentation, and produced a number of basic research results on the cultivation process. In recent years, the research on the hydrogen production process combined with waste biomass treatment has increased greatly, some of which have reached the pilot test level, but they mainly focus on reactor type design and process research, and the hydrogen production efficiency of mixed culture is lower than that of pure culture , the overall conversion rate is not high, which is where the bottleneck of fermentation hydrogen production lies. The key to solving the bottleneck of fermentation hydrogen production is to achieve technological breakthroughs and increase the yield of hydrogen. Studies have shown that only from the perspective of technology, it is impossible to fundamentally break through the problem of low hydrogen production efficiency, and we must pay attention to the research and development of high-efficiency hydrogen-producing strains.

For many years, the hydrogen-producing bacteria used in dark fermentation hydrogen production mainly include Enterobacter, Clostridium, Escherichia and Bacillus, especially Enterobacter Bacillus and Clostridium have been most studied. The highest hydrogen production rate of Clostridium can reach 2.36mol/mol glucose, and the highest hydrogen production rate of Enterobacter aerogenes can reach 3mol/mol glucose (ie 6mol/mol sucrose) [Kumar, N. and Das, D. Bioprocess Engineering 23 , 205-208 (2000)], [Kumar, N. and Das, D. Process Biochemistry 35, 589-593 (2000)]. The mechanism of hydrogen production by the fermentation of obligate anaerobic bacteria represented by Clostridium sp is as follows: glucose is fermented to generate pyruvate, and in the process of forming acetic acid, some electrons pass through ferredoxin to form hydrogen under the action of hydrogenase . One mole of glucose can form 4 moles of hydrogen and 2 molecules of acetic acid. Therefore, the fermentation of obligate anaerobic bacteria to produce hydrogen must be accompanied by the formation of organic acids such as acetic acid. The facultative anaerobic hydrogen-producing bacteria E.aerogenes produces NADH and ATP through the glycolysis pathway and the tricarboxylic acid cycle (TCA) pathway. Hydrogenase converts protons into hydrogen through NADH. The theoretical conversion rate of hydrogen production is 1 mole of glucose to form 12 moles of hydrogen. , far greater than the hydrogen yield of obligate anaerobic bacteria. Therefore, E.aerogenes is an important strain for the development of efficient fermentation hydrogen production process.

With the rapid development of biotechnology, simple strain screening and optimization of culture process can no longer meet the needs of improving hydrogen production efficiency. The research of fermentative hydrogen production needs to enter the interior of the cell, and strengthen the hydrogen production process through the modification of hydrogenase and its metabolic network. At present, more than 100 hydrogenase gene sequences can be obtained on the gene bank [Paulette M.Vignais, Bernard Billoud, Jacques Meyer. FEMS Microbiology Reviews 25, 455-501 (2001)], but there are still a large number of known hydrogen-producing strains. Hydrogenase genes have not been cloned yet, and finding more hydrogenase genes is an important direction for biohydrogen production [Kalia, V.C., Lal, S., Ghai, R., Mandal, M. and Chauhan, A. Trends in Biotechnology 21 , 152-156 (2003)]. Different hydrogenases have different functions. Compared with other enzyme systems, people's understanding of hydrogenases is still very limited.

At present, the relatively clear studies are the genes of hydrogenase I, II, III and IV of Escherichia coli, which all belong to Ni-Fe hydrogenase, wherein hydrogenase III and IV are related to hydrogen production [Andrews, S.C., Berks, B.C. , Mcclay, J., Ambler, A., Quail, M.A., Golby, P.and Guest, J.R.Microbiology143, 3633-3647 (1997)], while I and II are related to the hydrogen absorption process. The hydrogenases of Clostridium belong to ferric hydrogenases, and the iron hydrogenases of Triclostridium have been sequenced, but the accessory genes and regulatory mechanisms are still unclear. The ferrohydrogenase gene of Clostridium has been cloned and expressed heterologously in photosynthetic bacteria, which strengthens the hydrogen production process of photosynthetic bacteria. The expression of the ferrohydrogenase gene of Clostridium in Escherichia coli was not successful, which may be caused by the different accessory gene systems of Clostridium and Escherichia coli [Yasuo Asada, Yoji Koike, JorgSchnackenberg, Masato Miyake, Ieaki Uemura, Jun Miyake. Biochimica et Biophysica Acta 1490, 269-278 (2000)]. Recently, Mishra J. et al. cloned a ferrohydrogenase of about 450 bp from E.cloacae IIT-BT08 through the method of ferrohydrogenase conservative sequence design, and expressed it heterologously in non-hydrogen-producing Escherichia coli to verify its function. The results show that this hydrogenase is located in the cytoplasm [Mishra, J., Kumar, N., Ghosh, A.K. and Das, D. International Journal of Hydrogen Energy27, 1475-1479 (2002)], [Mishra, J., Khurana, S ., Kumar, N., Ghosh, A.K. and Das, D. Biochemical and Biophysical Research Communications 324, 679-685 (2004)]. A previous study of Enterobacter aerogenes E. aerogenes showed that on its cell membrane, hydrogenase reacted with NADH produced in the cell to generate hydrogen [Nakashimada, Y., Rachman, M.A., Kakizono, T. and Nishio, N. International Journal of Hydrogen Energy 27, 1399-1405 (2002)]. Therefore, it is of great significance to study the hydrogenase characteristics, genes and functional analysis of this genus for the technological breakthrough of improving the hydrogen production rate of Enterobacter aerogenes.

The research on the hydrogen production process of Escherichia coli shows that Escherichia coli can directly use formic acid, and can also use the formic acid produced in the process of assimilating carbohydrates as _a substrate. ₂ . [Akihito Yoshida, Taku Nishimura, Hideo Kawaguchi, 1 Masayuki Inui, and Hideaki Yukawa*. Appl Environ Microbiol. 71: 6762-6768 (2005)]. Formic acid hydrogen production pathway is the fastest way to produce hydrogen.

Enterobacter aerogenes is a facultative anaerobic bacterium with a fast growth rate, can produce hydrogen under anaerobic conditions, and has the advantages of a wide range of substrates and strong growth adaptability. It is a strain with excellent industrial characteristics. There are many reports about the hydrogen production of Enterobacter aerogenes, but most of them are in terms of technology and cultivation [E.Palazzi, B.Fabiano, P.Perego.Bioprocess Eng.22:205-213 (2000).]. Hydrogen-related genes have not been reported yet. Studies have shown that Enterobacter aerogenes has the ability to produce hydrogen from formic acid similar to Escherichia coli [Tatsuo, K., Shigeharu, T.Mar Biotechnol.7: 112-118 (2005).], and it has a hydrogen absorption process, That is, the presence of hydrogen-absorbing enzyme [Y.L Ren., X.H.Xing., C. Zhang., and Z.X.Gou. Biotechnol Lett. 27(14): 1029-1033(2005).]. Therefore, the cloning of the hydrogen production gene and the hydrogen uptake enzyme gene of Enterobacter aerogenes using the formate pathway is of great significance for understanding the process of hydrogen production and hydrogen consumption in Enterobacter aerogenes, so as to use the formate pathway to produce hydrogen. The cloning of the formate hydrogenase gene and the hydrogen uptake enzyme gene is also a useful addition to the hydrogenase gene family.

Contents of the invention

The purpose of the present invention is to provide hydrogen-producing engineering bacteria and applications thereof.

The hydrogen-producing engineering bacterium provided by the present invention is the engineering bacterium of the following a) or b):

a) engineering bacteria obtained by inactivating the ΔhybO protein in E.aerogenes IAM1183;

b) engineering bacteria obtained by inactivating the ΔhybO protein and ΔhycA protein in E.aerogenes IAM1183;

The amino acid sequence of the ΔhybO protein is sequence 1 in the sequence listing; the amino acid sequence of the ΔhycA protein is sequence 4 in the sequence listing.

The inactivation of the ΔhybO protein in E. aerogenes IAM1183 can be achieved by introducing DNA fragment Q into the E. aerogenes IAM1183; the DNA fragment Q is sequenced from upstream to downstream as homology arm T ₁ , DNA fragment N, homology The homologous arm T ₂ ; the homologous arm T ₁ and the homologous arm T ₂ can undergo homologous recombination with the coding gene of the ΔhybO protein to inactivate the ΔhybO protein; the DNA fragment N is an antibiotic resistance fragment.

The nucleotide sequence of the gene encoding the ΔhybO protein is sequence 2 in the sequence listing; the nucleotide sequence of the homology arm _T1 is sequence 7 in the sequence listing; the nucleotide sequence of the homology arm T ₂ is The acid sequence is sequence 8 in the sequence listing; the DNA fragment N is a tetracycline-resistant fragment.

The nucleotide sequence of the DNA fragment Q can specifically be sequence 3 in the sequence listing.

The inactivation of ΔhybO protein and ΔhycA protein in E.aerogenes IAM1183 can be achieved by introducing DNA fragment P and DNA fragment Q into the E.aerogenes IAM1183; in actual operation, the introduction of DNA fragment P and DNA fragment Q can take Arbitrary order, such as introducing DNA segment P first, screening recombinant bacteria and then introducing DNA segment Q into recombinant bacteria;

The DNA fragment P is sequentially homologous arm T ₃ , DNA fragment M, and homologous arm T ₄ from upstream to downstream; the homologous arm T ₃ and homologous arm T ₄ can interact with the gene encoding the ΔhycA protein Homologous recombination inactivates the ΔhycA protein; the DNA fragment M is an antibiotic-resistant fragment;

The DNA fragment Q is sequentially homologous arm T ₁ , DNA fragment N, and homologous arm T ₂ from upstream to downstream; the homologous arm T ₁ and homologous arm T ₂ can interact with the gene encoding the ΔhybO protein Homologous recombination inactivates the ΔhybO protein; the DNA fragment N is an antibiotic-resistant fragment.

The nucleotide sequence of the gene encoding the ΔhybO protein is sequence 2 in the sequence listing; the nucleotide sequence of the homology arm _T1 is sequence 7 in the sequence listing; the nucleotide sequence of the homology arm T ₂ is The acid sequence is sequence 8 in the sequence list; the DNA fragment N is a tetracycline resistance fragment; the nucleotide sequence of the gene encoding the ΔhycA protein is sequence 5 in the sequence list; the core of the homology arm _T3 The nucleotide sequence is sequence 9 in the sequence listing; the nucleotide sequence of the homology arm _T4 is sequence 10 in the sequence listing; the DNA fragment M is a kanamycin-resistant fragment.

The nucleotide sequence of the DNA fragment Q can specifically be sequence 3 in the sequence listing; the nucleotide sequence of the DNA fragment P can specifically be sequence 6 in the sequence listing.

The present invention also protects a DNA fragment Q, the DNA fragment Q is sequentially homologous arm T ₁ , DNA fragment N, and homologous arm T ₂ from upstream to downstream; the homologous arm T ₁ and homologous arm T ₂ can be combined with The gene encoding the ΔhybO protein of E. aerogenes IAM1183 undergoes homologous recombination to inactivate the ΔhybO protein; the amino acid sequence of the ΔhybO protein is sequence 1 in the sequence table; the DNA fragment N is an antibiotic resistance fragment.

The nucleotide sequence of the gene encoding the ΔhybO protein is sequence 2 in the sequence listing; the nucleotide sequence of the homology arm _T1 is sequence 7 in the sequence listing; the nucleotide sequence of the homology arm T ₂ is The acid sequence is sequence 8 in the sequence listing; the DNA fragment N is a tetracycline-resistant fragment.

The nucleotide sequence of the DNA fragment Q is most preferably sequence 3 in the sequence listing.

Expression cassettes or recombinant expression vectors or transgenic cell lines or recombinant bacteria containing the DNA fragment Q all belong to the protection scope of the present invention.

The present invention takes Enterobacter aerogenes E.aerogenes as the starting strain, and obtains two bacterial strains with improved hydrogen production ability in the formic acid pathway by inactivating the gene encoding the hydrogen production-related protein in the Enterobacter aerogenes E.aerogenes, which can be applied For biohydrogen production, it has great guiding significance for biohydrogen production.

The engineering bacterium that the present invention obtains has the following advantages:

1) The starting strain E.aerogenes IAM1183 is a facultative anaerobic bacterium, which can grow rapidly under both aerobic and anaerobic conditions, and has strong adaptability to the environment; using it for biological hydrogen production has a wide range of substrates and a wide range of substrates. With the advantages of strong ability and high hydrogen production, it is an excellent strain with potential application in industrial hydrogen production.

2) The engineering bacteria E.aerogenes IAM1183-O and the engineering bacteria E.aerogenesIAM1183-AO obtained in the present invention, in addition to the advantages of the original bacteria 1), also have the characteristics of stronger substrate utilization ability and further improved hydrogen production ability, Especially E. aerogenes IAM1183-AO.

The following examples facilitate a better understanding of the present invention, but do not limit the present invention.

Description of drawings

Figure 1 is the monoclonal antibody and double antibody screening diagram of engineering bacteria E.aerogenes IAM1183-O

Figure 2 is the PCR identification diagram of engineering bacteria E.aerogenes IAM1183-O

Figure 3 is the monoclonal antibody and double antibody screening diagram of engineering bacteria E.aerogenes IAM1183-A

Figure 4 is a PCR identification diagram of engineering bacteria E.aerogenes IAM1183-A

Figure 5 is a PCR identification diagram of engineering bacteria E.aerogenes IAM1183-AO

Figure 6 The growth curve OD ₆₀₀ of engineered bacteria

Figure 7 pH changes during the growth of engineered bacteria

Figure 8 _H2 production analysis of engineered bacteria

Figure 9 _CO2 production analysis of engineered bacteria

Detailed ways

The experimental methods in the following examples are conventional methods unless otherwise specified.

The primers used in the following examples are as follows:

hycA-Km-fw: CTGCA ATTCGCTGGT TCAGGGCATC ACCCTGTCAA AAGCG ATAGGCTCCGCCCCCCTGA;

hycA-Km-rv: GGCTTAAATCCACCGGCTGGTCGTGTTCCATGGCGTCATA CAGGTGGCAC TTTTCGGGG;

HybO-tet-fw: AATCTCTGCTTCGTGCAACGCATCCAACGGTAGAAAACCT TTTGGTGACTGCGCTCCTC;

HybO-tet-rv: GATACCTTCT TCGTTACAGC CATAGCAAGG GTGACCAATC TGTTGTTGCTCAGGTCGCA;

hycA-fw: CTGCAATTCGCTGGT TCAGGGCATC;

hycA-rv: GGCTTAAATCCACCG GCTGGTCGTG;

hybO-fw: AATCTCTGCT TCGTGCAACGCATC;

hybO-rv: GATACCTTCT TCGTTACAGCCATA.

The culture medium formulation and purposes involved in the following examples are as follows:

(1) LB medium (L ^-1 ): 10g of peptone, 5g of yeast extract powder, 10g of NaCl, 15g of agar powder (added to solid medium); used for short-term preservation and activation of strains.

(2) Glucose medium (L ^-1 ): glucose 15g, peptone 5g, K ₂ HPO ₄ 3H ₂ O 14g, KH ₂ PO ₄ 6g, (NH ₄ ) ₂ SO ₄ 2g, MgSO ₄ 7H ₂ O 0.2 g; for hydrogen production by fermentation.

Embodiment 1, the acquisition of Enterobacter aerogenes E.aerogenes IAM1183-O

The starting strain Enterobacter aerogenes (E. aerogenes IAM1183) was purchased from the strain bank of the Institute of Applied Microbiology (IAM), University of Tokyo, Japan.

Sequence analysis was performed on the Enterobacter aerogenes gene sequence (Genbank NO: EF601126) in NCBI, and a pair of primers HybO-tet-fw and HybO-tet-rv were designed with the following sequences:

HybO-tet-fw:

5'- AATCTCTGCTTCGTGCAACGCATCCAACGGTAGAAAACCT TTTGGTGACTGCGCTCCTC-3';

HybO-tet-rv:

5'- GATACCTTCTTCGTTACAGCCATAGCAAGGGTGACCAATC TGTTGTTGCTCAGGTCGCA-3'.

The underlined sequence in the primer is the homologous sequence of the ΔhybO gene in Enterobacter aerogenes (E. aerogenes IAM1183).

Transformation of pYM-red plasmid (Yu Mei, Zhou Jianguang, Chen Wei, Li Shanhu, Huang Cuifen, establishment of a transferable recombinant engineering system pYM-Red. Advances in Biochemistry and Biophysics. 2005, 32(4) .) electric shock into Enterobacter aerogenes (E.aerogenes IAM1183), carry out chloramphenicol (24mg/mL) resistance screening, extract pYM-red plasmid from positive strain and carry out identification, obtained the product containing pYM-red recombinant plasmid Enterobacter aerogenes (E. aerogenes IAM1183).

With pACYC184 plasmid (Chang, A.C., and S.N.Cohen.1978.Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.J.Bacteriol.134:1141-1156.) DNA as template, primer et-t-HybO Perform PCR amplification with HybO-tet-rv to obtain a linear DNA labeled with tetracycline, and use the linear DNA as a targeting vector. By electroporation, the targeting vector was introduced into Enterobacter aerogenes (E. aerogenes IAM1183) containing the pYM-red plasmid.

Spread the transformed bacteria on the monoclonal antibody LB plate containing tetracycline (4ug/ml) and culture at 30°C for 1 day; (24ug/ml) double antibody LB plate, cultured at 30°C for 1 day. The results of monoclonal antibody and double antibody screening are shown in Figure 1. The left picture in Figure 1 is the picture of monoclonal antibody screening, and the right picture is the picture of double antibody screening.

Randomly pick several clones grown on double-antibody medium, extract genomic DNA, and identify whether the targeting vector has undergone homologous recombination with the target site on the chromosome by PCR. The pair of primers used in the PCR reaction is hybO-fw and the sequences of hybO-rv, hybO-fw and hybO-rv are as follows:

hybO-fw 5'-AATCTCTGCT TCGTGCAACG CATC-3';

hybO-rv 5'-GATACCTTCT TCGTTACAGC CATA-3'.

The results of PCR identification are shown in Figure 2. In Figure 2, 1: DNA 2000marker; 2: E.aerogenes IAM1183-O. It can be seen from the figure that the amplified product of E.aerogenes IAM1183-O obtained the 1800bp target band, which was consistent with the expected result. The results showed that in the obtained clones, homologous recombination occurred between the targeting vector and the target site on the chromosome. The mutant strain with homologous recombination was named E.aerogenes IAM1183-O.

Embodiment 2, the acquisition of Enterobacter aerogenes E.aerogenes IAM1183-A

The starting strain Enterobacter aerogenes (E. aerogenes IAM1183) was purchased from the strain bank of the Institute of Applied Microbiology (IAM), University of Tokyo, Japan.

Sequence analysis was performed on the Enterobacter aerogenes gene sequence (Genbank NO: EF601125) in NCBI, and a pair of primers hycA-Km-fw and hycA-Km-rv were designed. The sequences of hycA-Km-fw and hycA-Km-rv are as follows :

hycA-Km-fw:

5'- CTGCAATTCGCTGGTTCAGGGCATCACCCTGTCAAAAGCG ATAGGCTCCGCCCCCCTGA-3';

hycA-Km-rv:

5'- GGCTTAAATCCACCGGCTGGTCGTGTTCCATGGCGTCATA CAGGTGGCACTTTTCGGGG-3'.

The underlined sequence in the primer is the homology arm of Enterobacter aerogenes (E. aerogenes IAM1183) ΔhycA.

Transformation of pYM-red plasmid (Yu Mei, Zhou Jianguang, Chen Wei, Li Shanhu, Huang Cuifen, establishment of a transferable recombinant engineering system pYM-Red. Advances in Biochemistry and Biophysics. 2005, 32(4) .) electric shock into Enterobacter aerogenes (E.aerogenes IAM1183), carry out chloramphenicol (24mg/mL) resistance screening, extract pYM-red plasmid from positive strain and carry out identification, obtained the product containing pYM-red recombinant plasmid Enterobacter aerogenes (E. aerogenes IAM1183).

The pET28a plasmid DNA was used as a template, and the primers hycA-Km-fw and hycA-Km-rv were used for PCR amplification to obtain a linear DNA containing a kanamycin marker, which was used as a targeting vector. By electroporation, the targeting vector was introduced into Enterobacter aerogenes (E. aerogenes IAM1183) containing the pYM-red recombinant plasmid. Spread the transformed bacteria on monoclonal antibody LB plates containing kanamycin (50 mg/mL), and culture them at 30 ° C for 1 day; then transfer the grown bacteria into cells containing kanamycin (50 mg/mL ) and chloramphenicol (30 mg/mL) double antibody LB plate, cultured at 30 ° C for 1 day. The results of monoclonal antibody and double antibody screening are shown in Figure 3, the left picture in Figure 3 is the picture of monoclonal antibody screening, and the right picture is the picture of double antibody screening.

Randomly pick several clones grown on double-antibody medium, extract genomic DNA, and identify whether the targeting vector has undergone homologous recombination with the target site on the chromosome by PCR. The pair of primers used in the PCR reaction is hycA-fw and hycA-rv, the sequences of hycA-fw and hycA-rv are as follows:

hycA-fw: 5'-CTGCAATTCGCTGGTTCAGGGCATC-3';

hycA-rv: 5'-GGCTTAAATCCACCGGCTGGTCGTG-3'.

The results of PCR identification are shown in Figure 4. In Figure 4, 1: E.aerogenes IAM1183-A; 2: E.aerogenes IAM1183 (control); 3: DNA 2000marker. It can be seen from the figure that the amplified product of E.aerogenes IAM1183-A obtained a 1700bp target band; the amplified product of E.aerogenes IAM1183 obtained a 550bp band, which was consistent with the expected results. The results showed that in the obtained clones, homologous recombination occurred between the targeting vector and the target site on the chromosome. The mutant strain with homologous recombination was named E.aerogenes IAM1183-A.

Embodiment 3, the acquisition of Enterobacter aerogenes E.aerogenes IAM1183-AO

Use E.aerogenes IAM1183-O as the starting strain to inactivate the ΔhycA protein (the method is the same as in Example 2); or use E.aerogenes IAM1183-A as the starting strain to inactivate the ΔhycO protein (the method is the same as in Example 1), all of which can be obtained Mutant strain E. aerogenes IAM1183-AO. The following uses E.aerogenes IAM1183-A as the starting strain to construct E.aerogenes IAM1183-AO.

Using pACYC184 plasmid DNA as a template, primers HybO-tet-fw and HybO-tet-rv were used for PCR amplification to obtain a linear DNA labeled with tetracycline, which was used as a targeting vector. By electroporation, the targeting vector was introduced into Enterobacter aerogenes E. aerogenes IAM1183-A containing the pYM-red plasmid. Spread the transformed bacteria on a double-antibody LB plate containing kanamycin (50 mg/mL) and tetracycline (4 mg/mL), and incubate at 30° C. for 1 day.

Randomly pick several clones grown on double-antibody medium, extract genomic DNA, and identify whether the targeting vector has undergone homologous recombination with the target site on the chromosome by PCR. The pair of primers used in the PCR reaction is hybO-fw and the sequences of hybO-rv, hybO-fw and hybO-rv are as follows:

hybO-fw 5'-AATCTCTGCT TCGTGCAACG CATC-3';

hybO-rv 5'-GATACCTTCT TCGTTACAGC CATA-3'.

The results of PCR identification are shown in Figure 5. In Figure 5, 1: DNA 2000 marker; 2: E.aerogenes IAM1183-AO. It can be seen from the figure that the amplified product of E.aerogenes IAM1183-AO obtained a target band of 1800bp, which was consistent with the expected result. The results showed that in the obtained clones, homologous recombination occurred between the targeting vector and the target site on the chromosome. The mutant strain with homologous recombination was named E.aerogenes IAM1183-AO.

Embodiment 4, the hydrogen production performance of engineering bacteria and the determination of physiological characteristics

In different 70mL serum bottles, 20mL of glucose medium were respectively installed, and the activated engineering bacteria E. Shake flask culture under the same conditions was used as a control. The specific operation steps are as follows:

(1) Seed culture: use a 15ml centrifuge tube with 5ml of LB medium, inoculate from a solid plate, cultivate overnight at a temperature of 37°C and an air bath shaker at a speed of 170rpm.

(2) Anaerobic shake flask culture: adopt 70ml serum bottle anaerobic culture bottle, glucose medium filling capacity 20ml (use the air in the top of culture bottle and culture medium in advance with nitrogen replacement); The inoculation amount of seed bacteria 2.5% (v /v), culture temperature 37°C, air bath, shaker speed 170rpm. Incubate for 24 hours.

The experiment was repeated three times, and all the results were the average of three repetitions, expressed as mean ± standard deviation.

Collect the gas produced by engineering bacteria and wild bacteria respectively, and use a syringe to measure the amount of gas generated; utilize a spectrophotometer (UV-1206, SHIMADZU company (Japan)) to measure the growth of the bacteria; utilize a pH meter (CHNO60 (828), ORION company (USA)) measured the change of pH. The change of OD ₆₀₀ of engineering bacteria and wild bacteria is shown in Figure 6, the pH change of the culture solution of engineered bacteria and wild bacteria is shown in Figure 7, the hydrogen production of engineered bacteria and wild bacteria is shown in Figure 8, and the CO ₂ of engineered bacteria and wild bacteria Generate situation figure 9.

The maximum specific growth rate and maximum hydrogen production rate of engineered bacteria and wild bacteria are compared in Table 1.

Table 1 Maximum growth rate and hydrogen production rate (n=3)

The above results showed that after 12 hours of batch culture, the cell density of the wild strains reached the highest (OD ₆₀₀ was 2.26), and in the logarithmic growth phase of the fastest hydrogen production, the cell densities of the two engineered strains were higher than those of the wild strains. high. Hydrogen is a primary metabolite coupled with cell growth. In the logarithmic growth phase, the two engineered strains also showed a higher hydrogen production rate, and the final hydrogen production was also higher, reaching 76.8mM and 83.0mM respectively. The change trend of pH of the three strains was consistent, all of them produced acid during the fermentation process to make the fermentation broth acidic, and the pH dropped from the initial value of 6.9 to 4.7-4.9. The pH drop rate of engineering bacteria E.aerogenes IAM1183-O and E.aerogenes IAM1183-AO in the logarithmic growth phase is slightly faster than that of the wild bacteria, which is related to their high value-added rate in the logarithmic growth phase. The carbon dioxide production of the engineered strain E.aerogenes IAM1183-AO was significantly lower than that of the other two strains. Comparing the maximum specific growth rate and maximum hydrogen production rate of the two engineered strains with the wild strain, the maximum specific growth rate of the wild strain was higher than that of the two engineered strains, reaching 0.523h ^-1 , while the engineered strain E.aerogenes IAM1183- The maximum specific growth rate of AO is the lowest, which is 0.523h ^-1 . The maximum hydrogen production rate reflects the maximum hydrogen production per unit cell per unit time. Compared with the wild strains, the maximum hydrogen production rates of the two strains of engineered bacteria have been increased to a certain extent, which are 1.18 and 1.45 of the wild type respectively. times.

Embodiment 5, the metabolic flow analysis of engineering bacteria

The distribution of metabolic fluxes in the cells of wild bacteria and engineered bacteria were detected respectively, and the specific steps were as follows:

(1) Seed cultivation: use a 15ml centrifuge tube with 5ml of LB medium, inoculate bacteria from a solid plate, cultivate overnight at a temperature of 37°C and an air bath shaker at a speed of 170rpm.

(2) Anaerobic shake flask culture: adopt 70ml serum bottle anaerobic culture bottle, glucose medium filling capacity 20ml (use the air in the top of culture bottle and culture medium in advance with nitrogen replacement); The inoculation amount of seed bacteria 2.5% (v /v), the culture temperature is 37° C., and the rotation speed of the air bath shaker is 170 rpm. Incubate for 16 hours.

(3) Metabolites were detected after anaerobic shake flask culture for 16 hours. After the fermented product was centrifuged to obtain the supernatant, it was filtered. The yield and composition of metabolites were determined by high pressure liquid chromatography. The high-pressure liquid gas spectrometer is (HPLC-10A, SHIMADZU company (Japan). The specific detection method is as follows: 10ml samples are centrifuged at 12000rpm at 4°C for 5 minutes, and the supernatant is frozen and stored in a refrigerator at -80°C until measurement. High performance liquid phase Chromatographic (HPLC) determination of concentrations of glucose, lactic acid, succinic acid, formic acid, acetic acid, 2,3-butanediol and ethanol.

Analysis method and conditions: Shimadzu Shim-pack SCR-102H is used as the chromatographic column, the matrix is PS/DVB, and the functional group is -SO ₃ H. The size of the column is: 300 mm (length)×8 mm (inner diameter), and the particle size is 7 μm. The chromatographic analysis conditions are as follows: column temperature 40°C, mobile phase 5mM perchloric acid, flow rate 1.0ml·min ^-1 ; differential detector (RID); sample injection volume 20μl. The HPLC computer control software CLASS-VP workstation provided by Shimadzu Corporation was used for data analysis and processing.

The experiment was repeated three times, and the experimental results are shown in Table 2. Data in Table 2 are mean ± standard deviation.

Table 2 Metabolic flux analysis (n=3)

The results showed that the hydrogen-to-glucose yields of the two engineered strains reached 1.27 and 1.36 mol-hydrogen·mol-glucose ^-1 , respectively, both of which were higher than the corresponding values of wild bacteria (1.16 mol-hydrogen·mol-glucose ^-1 ). This shows that both the inactivation of ΔhycA and the inactivation of ΔhybO can effectively increase the flux of hydrogen-producing metabolic pathways, thereby increasing the yield of hydrogen production in cells. At the same time, the above-mentioned genetic modifications also have certain effects on the distribution of other metabolites. 2,3-Butanediol, lactic acid, succinic acid and ethanol are metabolites produced by relying on intracellular NADH. Compared with wild bacteria, the yields of these substances were increased in the two strains of engineered bacteria, showing Intracellular available reducing power increases, which is an important condition favorable for hydrogen production. The sum of acetic acid and ethanol production of the two engineered strains was higher than that of the wild-type strain, indicating that the formic acid hydrogen production pathway was strengthened during the hydrogen production process, which also reached the expected inactivation of formate dehydrogenase negative regulatory genes. Effect.

Experiments have shown that the inactivation of the target gene will cause changes in the activity of the corresponding enzymes in the cell, thereby changing the metabolic flux and increasing the yield of the target product. The genetically engineered bacterial strain obtained by the invention has high hydrogen production capacity and can be applied to hydrogen production by fermentation.

sequence listing

<110> Tsinghua University

<120>Engineering bacteria producing hydrogen and its application

<130>CGGNARY81442

<160>10

<210>1

<211>263

<212>PRT

<213> Enterobacter aerogenes (E.aerogenes)

<400>1

Val Ile Trp Ile Gly Ala Gln Glu Cys Thr Gly Cys Thr Glu Ser Leu

1 5 10 15

Leu Arg Ala Thr His Pro Thr Val Glu Asn Leu Val Leu Glu Thr Ile

20 25 30

Ser Leu Glu Tyr His Glu Val Leu Ser Ala Ala Phe Gly His Gln Val

35 40 45

Glu Glu Asn Lys His Asn Ala Leu Glu Lys Tyr Lys Gly Gln Tyr Val

50 55 60

Leu Val Val Asp Gly Ser Ile Pro Leu Lys Asp Asn Gly Ile Tyr Cys

65 70 75 80

Met Val Ala Gly Glu Pro Ile Val Asp His Ile Arg Lys Ala Ala Glu

85 90 95

Gly Ala Ala Ala Ile Ile Ala Ile Gly Ser Cys Ser Ala Trp Gly Gly

100 105 110

Val Ala Ala Ala Gly Val Asn Pro Thr Gly Ala Val Ser Leu Gln Glu

115 120 125

Val Leu Pro Gly Lys Thr Val Ile Asn Ile Pro Gly Cys Pro Pro Asn

130 135 140

Pro His Asn Phe Leu Ala Thr Val Ala His Ile Ile Thr Tyr Gly Lys

145 150 155 160

Pro Pro Lys Leu Asp Asp Lys Asn Arg Pro Thr Phe Ala Tyr Gly Arg

165 170 175

Leu Ile His Glu His Cys Glu Arg Arg Pro His Phe Asp Ala Gly Arg

180 185 190

Phe Ala Lys Glu Phe Gly Asp Glu Gly His Arg Glu Gly Trp Cys Leu

195 200 205

Tyr His Leu Gly Cys Lys Gly Pro Glu Thr Tyr Gly Asn Cys Ser Thr

210 215 220

Leu Gln Phe Cys Asp Val Gly Gly Val Trp Pro Val Ala Ile Gly His

225 230 235 240

Pro Cys Tyr Gly Cys Asn Glu Glu Gly Ile Gly Phe His Lys Gly Ile

245 250 255

His Gln Leu Ala Asn Val Glu

260

<210>2

<211>789

<212>DNA

<213> Enterobacter aerogenes (E.aerogenes)

<400>2

gttatctgga ttggcgcgca ggagtgcacc ggttgtacgg aatctctgct tcgtgcaacg 60

catccaacgg tagaaaacct cgtactggag actatctctc tggagtatca cgaagtgctt 120

tccgccgcct tcggtcatca ggtcgaagag aacaaacata acgctcttga gaagtacaaa 180

gggcagtatg tgttagtggt ggatggttcc atcccattaa aagataacgg tatttattgc 240

atggttgccg gtgagccgat tgtggatcac atccgcaaag cggcggaagg cgcagcagcc 300

attatcgcta tcggttcctg ctctgcgtgg ggcggtgttg ccgcagctgg agttaaccca 360

actggcgcag tcagcctgca agaagttctg ccaggcaaaa ccgttatcaa tattccgggc 420

tgcccgccga acccgcacaa cttcctcgcg accgttgcgc acatcatcac ttacggcaaa 480

ccgccgaaac tggatgacaa aaaccgtccg accttcgcct atggccgtct gattcacgaa 540

cactgcgaac gtcgcccgca cttcgatgct ggtcgttttg ccaaagagtt cggtgatgaa 600

ggccaccgcg aaggctggtg cctgtaccac ctcggctgta aagggccaga aacttacggc 660

aactgctcaa cgctgcaatt ctgcgatgtt ggcggtgtgt ggccggtggc gattggtcac 720

ccttgctatg gctgtaacga agaaggtatc ggcttccata aaggcatcca tcaactggcc 780

aacgtcgaa 789

<210>3

<211>1910

<212>DNA

<213> Artificial sequence

<400>3

aatctctgct tcgtgcaacg catccaacgg tagaaaacct tttggtgact gcgctcctcc 60

aagccagtta cctcggttca aagagttggt agctcagaga accttcgaaa aaccgccctg 120

caaggcggtt ttttcgtttt cagagcaaga gattacgcgc agaccaaaac gatctcaaga 180

agatcatctt attaatcaga taaaatattt ctagatttca gtgcaattta tctcttcaaa 240

tgtagcacct gaagtcagcc ccatacgata taagttgtaa ttctcatgtt tgacagctta 300

tcatcgataa gctttaatgc ggtagtttat cacagttaaa ttgctaacgc agtcaggcac 360

cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg caccgtcacc ctggatgctg 420

taggcatagg cttggttatg ccggtactgc cgggcctctt gcgggatc gtccattccg 480

acagcatcgc cagtcactat ggcgtgctgc tagcgctata tgcgttgatg caatttctat 540

gcgcacccgt tctcggagca ctgtccgacc gctttggccg ccgcccagtc ctgctcgctt 600

cgctacttgg agccactatc gactacgcga tcatggcgac cacacccgtc ctgtggatcc 660

tctacgccgg acgcatcgtg gccggcatca ccggcgccac aggtgcggtt gctggcgcct 720

atatcgccga catcaccgat gggaagatc gggctcgcca cttcgggctc atgagcgctt 780

gtttcggcgt gggtatggtg gcaggccccg tggccggggg actgttgggc gccatctcct 840

tgcatgcacc attccttgcg gcggcggtgc tcaacggcct caacctacta ctgggctgct 900

tcctaatgca ggagtcgcat aagggagagc gtcgaccgat gcccttgaga gccttcaacc 960

cagtcagctc cttccggtgg gcgcggggca tgactatcgt cgccgcactt atgactgtct 1020

tctttatcat gcaactcgta ggacaggtgc cggcagcgct ctgggtcatt ttcggcgagg 1080

accgctttcg ctggagcgcg acgatgatcg gcctgtcgct tgcggtattc ggaatcttgc 1140

acgccctcgc tcaagccttc gtcactggtc ccgccaccaa acgtttcggc gagaagcagg 1200

ccattatcgc cggcatggcg gccgacgcgc tgggctacgt cttgctggcg ttcgcgacgc 1260

gaggctggat ggccttcccc attatgattc ttctcgcttc cggcggcatc gggatgcccg 1320

cgttgcaggc catgctgtcc aggcaggtag atgacgacca tcagggacag cttcaaggat 1380

cgctcgcggc tcttaccagc ctaacttcga tcactggacc gctgatcgtc acggcgattt 1440

atgccgcctc ggcgagcaca tggaacgggt tggcatggat tgtaggcgcc gccctatacc 1500

ttgtctgcct ccccgcgttg cgtcgcggtg catggagccg ggccacctcg acctgaatgg 1560

aagccggcgg cacctcgcta acggattcac cactccaaga attggagcca atcaattctt 1620

gcggagaact gtgaatgcgc aaaccaaccc ttggcagaac atatccatcg cgtccgccat 1680

ctccagcagc cgcacgcggc gcatctcggg cagcgttggg tcctggccac gggtgcgcat 1740

gatcgtgctc ctgtcgttga ggacccggct aggctggcgg ggttgcctta ctggttagca 1800

gaatgaatca ccgatacgcg agcgaacgtg aagcgactgc tgctgcaaaa cgtctgcgac 1860

ctgagcaaca gattggtcac ccttgctatg gctgtaacga agaaggtatc 1910

<210>4

<211>134

<212>PRT

<213> Enterobacter aerogenes (E.aerogenes)

<400>4

Arg His Arg Arg Tyr Gln Asp Gln Trp Arg Gln Tyr Cys Asn Ser Leu

1 5 10 15

Val Gln Gly Ile Thr Leu Ser Lys Ala Arg Leu His His Ala Met Ser

20 25 30

Cys Ala Pro Asp Lys Glu Leu Cys Phe Val Leu Phe Glu His Phe Gln

35 40 45

Val Tyr Val Ala Leu Ala Glu Gly Phe Asn Asn His Thr Ile Glu Tyr

50 55 60

Tyr Val Glu Thr Arg Asn Gly Asp Asp Lys Arg Leu Ile Ala Gln Ala

65 70 75 80

Thr Leu Ala Ser Asp Gly Thr Val Asp Gly Arg Ile Ser Asn Arg Ser

85 90 95

Arg Glu Gln Val Leu Glu His Tyr Leu Ala Ile Ile Ala Ser Val Tyr

100 105 110

Asp Arg Leu Tyr Asp Ala Met Glu His Asp Gln Pro Val Asp Leu Ser

115 120 125

His Leu Ala Leu Ala His

130

<210>5

<211>405

<212>DNA

<213> Enterobacter aerogenes (E.aerogenes)

<400>5

cgtcaccgcc gctatcagga tcagtggcgc cagtactgca attcgctggt tcagggcatc 60

accctgtcaa aagcgcgttt gcatcatgcg atgagctgcg cgccggacaa agagctgtgc 120

ttcgtcctgt ttgaacattt tcaggtgtat gtcgcgctgg cggaagggtt caacaaccac 180

accatcgagt actacgtcga aacgcgcaat ggtgatgata agcgattgat tgctcaggca 240

acgctggcat ccgacggtac cgttgacggc cggatcagca accgttcgcg cgaacaggtg 300

ctggaacatt acctggccat tattgccagc gtctatgacc gtctgtatga cgccatggaa 360

cacgaccagc cggtggattt aagccatctg gcgctggccc attaa 405

<210>6

<211>1693

<212>DNA

<213>6

<400> artificial sequence

ctgcaattcg ctggttcagg gcatcaccct gtcaaaagcg ataggctccg cccccctgac 60

gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 120

taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 180

accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 240

tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 300

cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 360

agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 420

gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca 480

gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct 540

tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 600

acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct 660

cagtggaacg aaaactcacg ttaagggatt ttggtcatga acaataaaac tgtctgctta 720

cataaacagt aatacaaggg gtgttatgag ccatattcaa cgggaaacgt cttgctctag 780

gccgcgatta aattccaaca tggatgctga tttatatggg tataaatggg ctcgcgataa 840

tgtcgggcaa tcaggtgcga caatctatcg attgtatggg aagcccgatg cgccagagtt 900

gtttctgaaa catggcaaag gtagcgttgc caatgatgtt acagatgaga tggtcagact 960

aaactggctg acggaattta tgcctcttcc gaccatcaag cattttatcc gtactcctga 1020

tgatgcatgg ttactcacca ctgcgatccc cgggaaaaca gcattccagg tattagaaga 1080

atatcctgat tcaggtgaaa atattgttga tgcgctggca gtgttcctgc gccggttgca 1140

ttcgattcct gtttgtaatt gtccttttaa cagcgatcgc gtatttcgtc tcgctcaggc 1200

gcaatcacga atgaataacg gtttggttga tgcgagtgat tttgatgacg agcgtaatgg 1260

ctggcctgtt gaacaagtct ggaaagaaat gcataaactt ttgccattct caccggattc 1320

agtcgtcact catggtgatt tctcacttga taaccttatt tttgacgagg ggaaattaat 1380

aggttgtatt gatgttggac gagtcggaat cgcagaccga taccaggatc ttgccatcct 1440

atggaactgc ctcggtgagt tttctccttc attacagaaa cggctttttc aaaaatgg 1500

tattgataat cctgatatga ataaattgca gtttcatttg atgctcgatg agtttttcta 1560

agaattaatt catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 1620

ttccgcgcac atttccccga aaagtgccac ctgtatgacg ccatggaaca cgaccagccg 1680

gtggatttaa gcc 1693

<210>7

<211>40

<212> DNA

<213> Artificial sequence

<400>7

aatctctgct tcgtgcaacg catccaacgg tagaaaacct 40

<210>8

<211>40

<212>DNA

<213> Artificial sequence

<400>8

gataccttct tcgttacagc catagcaagg gtgaccaatc 40

<210>9

<211>40

<212>DNA

<213> Artificial sequence

<400>9

ctgcaattcg ctggttcagg gcatcaccct gtcaaaagcg 40

<210>10

<211>40

<212>DNA

<213> Artificial sequence

<400>10

ggcttaaatc caccggctgg tcgtgttcca tggcgtcata 40

Claims (8)

1. Hydrogen-producing engineering bacteria are engineering bacteria as follows a) or b): a) engineering bacteria obtained by inactivating the ΔhybO protein in E.aerogenes IAM1183; The amino acid sequence of the ΔhybO protein is sequence 1 in the sequence listing; the nucleotide sequence of the gene encoding the ΔhybO protein is sequence 2 in the sequence listing; The inactivation of the ΔhybO protein in E.aerogenes IAM1183 is achieved by introducing DNA fragment Q into the E.aerogenes IAM1183; The DNA fragment Q is sequentially homologous arm T ₁ , DNA fragment N, and homologous arm T ₂ from upstream to downstream; the homologous arm T ₁ and homologous arm T ₂ can interact with the gene encoding the ΔhybO protein Homologous recombination inactivates the ΔhybO protein; the DNA fragment N is an antibiotic-resistant fragment; The nucleotide sequence of the homology arm _T1 is sequence 7 in the sequence listing; the nucleotide sequence of the homology arm _T2 is sequence 8 in the sequence listing; the DNA fragment N is a tetracycline-resistant fragment ; b) engineering bacteria obtained by inactivating the ΔhybO protein and ΔhycA protein in E.aerogenes IAM1183; The amino acid sequence of the ΔhycA protein is sequence 4 in the sequence listing; the nucleotide sequence of the gene encoding the ΔhycA protein is sequence 5 in the sequence listing; The inactivation of ΔhybO protein and ΔhycA protein in E.aerogenes IAM1183 is achieved by introducing DNA fragment Q and DNA fragment P into the E.aerogenes IAM1183; The DNA fragment P is sequentially homologous arm T ₃ , DNA fragment M, and homologous arm T ₄ from upstream to downstream; the homologous arm T ₃ and homologous arm T ₄ can interact with the gene encoding the ΔhycA protein Homologous recombination inactivates the ΔhycA protein; the DNA fragment M is an antibiotic-resistant fragment; The nucleotide sequence of the homology arm _T3 is sequence 9 in the sequence listing; the nucleotide sequence of the homology arm _T4 is sequence 10 in the sequence listing; the DNA fragment M is kanamycin resistant fragments. 2. The engineering bacterium according to claim 1, characterized in that: the nucleotide sequence of the DNA fragment Q is sequence 3 in the sequence table. 3. DNA fragment Q, from upstream to downstream is homology arm T ₁ , DNA fragment N, homology arm T ₂ ; the homology arm T ₁ and homology arm T ₂ can be combined with the ΔhybO protein of E.aerogenes IAM1183 Homologous recombination occurs in the gene encoding the ΔhybO protein, and the ΔhybO protein is inactivated; the amino acid sequence of the ΔhybO protein is sequence 1 in the sequence listing; the nucleotide sequence of the gene encoding the ΔhybO protein is sequence 2 in the sequence listing; The nucleotide sequence of the homology arm _T1 is sequence 7 in the sequence listing; the nucleotide sequence of the homology arm _T2 is sequence 8 in the sequence listing; the DNA fragment N is a tetracycline-resistant fragment . 4. The DNA fragment Q as claimed in claim 3, characterized in that: the nucleotide sequence of the DNA fragment N is sequence 3 in the sequence listing. 5. An expression cassette comprising the DNA fragment Q according to claim 3 or 4. 6. A recombinant expression vector containing the DNA fragment Q according to claim 3 or 4. 7. A transgenic cell line containing the DNA fragment Q according to claim 3 or 4. 8. A recombinant bacterium containing the DNA fragment Q according to claim 3 or 4.

Images