CN101591671A

CN101591671A - A kind of in peanut seed the method for expressing human Osteogenic Protein-1

Info

Publication number: CN101591671A
Application number: CNA2009100169593A
Authority: CN
Inventors: 王兴军; 赵传志; 毕玉平; 夏晗; 李爱芹; 李长生
Original assignee: High Tech Research Center Of Shandong Academy Of Agricultural Sciences
Current assignee: High Tech Research Center Of Shandong Academy Of Agricultural Sciences
Priority date: 2009-06-30
Filing date: 2009-06-30
Publication date: 2009-12-02
Anticipated expiration: 2029-06-30
Also published as: CN101591671B

Abstract

The invention discloses a kind of in peanut seed the method for expressing human Osteogenic Protein-1, be to utilize genetic engineering means the bone morphogenic protein encoding gene to be connected to 3 ' end of oil body protein gene, structure is by " oil body protein-erepsin-human osteogenic protein " plant expression vector of oil body protein promoters driven, transform peanut, recombinant protein is accompanied by the high-caliber expression in the peanut seed that is accumulated in of oil body, by floating centrifugal, obtain this albumen by purifying behind the circumscribed protease digestion then with the recombinant protein separation and purification.The recombinant protein safety that the inventive method obtains, active high, the very easy recovery and purifying, and can increase additional value of farm products at storage, the convenient transportation of peanut seed midium or long term.

Description

A kind of in peanut seed the method for expressing human Osteogenic Protein-1

Technical field

The present invention relates to a kind of method of expressing human Osteogenic Protein-1, relate in particular to a kind of method of in peanut seed, utilizing oil body protein expression system expressing human Osteogenic Protein-1, belong to biological technical field.

Background technology

Human osteogenic protein-1 (Human Osteogenic Protein 1, hOP-1) be also referred to as bone forming generation albumen 7 (Bone Morphogenetic Protein 7, BMP-7) eye growth, renal function adjusting and back brain development etc. are had vital role, be widely used clinically.But because people's bone source is limited, and from osseous tissue, extract hOP-1 program complexity, be difficult to obtain pure product, often not high through the hOP-1 bone-inducing activity of complicated procedures separation and purification, seriously limited clinical application [1,2,3].Along with the development of genetic engineering technique, the heterogenous expression bone morphogenic protein becomes possibility.The recombinant expressed mode of hOP-1 mainly contains two kinds at present: (1) is in Mammals or expressed in insect cells; (2) prokaryotic expression.The expression level of hOP-1 is low in mammalian cell expression system, and culture condition requires high, is unfavorable for scale operation.Prokaryotic expression system then can not effectively be modified expressed target protein, and the albumen that obtains often activity is high or do not have an activity [4,5].

With respect to microorganism and animal bioreactor, plant-bioreactor has more remarkable advantages: with low cost, be easy to scale operation, and no cause of disease is polluted, and helps the translation post-treatment and bioactive the keeping of recombinant protein.But the plant expression system expressing quantity is low, downstream processing purification difficult [6].In recent years, utilizing plant particularly to utilize the seed of plant to express the external source recombinant protein as bio-reactor receives much concern, because in the seed maturity process, nearly 95% moisture can initiatively lose, therefore hydrolytic enzyme activities in the cell reduces greatly, recombinant protein can be in seed for a long time, stably store and can not be degraded [7].Studies show that oil body protein (oleosin) has hydrophilic and the lipophilic dual nature, covers the oil body surface with the film embedded mode in plant seed, oil body protein is high level expression in oil crop seeds by using.The oil body protein molecule is except that the hydrophobic region high conservative of middle part, and the sequence difference of N end and C end is all very big.Be inserted into the N end or C end of oil body protein when the external source small molecular weight protein after, can not have influence on the location of oil body protein on vegetable oils with and express, and the recombination fusion protein that forms is highly stable.Because oil body protein is positioned at the oil body surface, by floating centrifugal being easy to it and other cellular constituents is comprised that other storage proteins separate in the seed.In oil crop seeds by using, utilize oil body protein to do carrier and produce medicinal and other useful matter, have unique advantages.Xu etc. have cloned the gene and the promotor of the 24kDa oil body protein of soybean, made up " oil body protein-erepsin-r-hirudin " plant expression vector by the oil body protein promoters driven, in transgene tobacco successful expression recombinant protein, by the erepsin cutting, obtained r-hirudin [8] by the polyacrylamide gel electrophoresis separation.Nykiforuk etc. utilize this system of oil body-oil body protein to produce the insulin human in Arabidopis thaliana, and Regular Insulin is accumulated to quite high level (0.13% seed protein) in the seed.When expression in escherichia coli Nattokinase (serine protease), often form infusible precipitate, cause not having enzyme [9] alive.The C that Chiang etc. receive oil body protein by an intein (intein) segment with Nattokinase holds, and makes up recombinant protein, by temperature-induced intein, discharges the Nattokinase [10] of the biologically active that obtains solubility.Usefulness triglyceride, phosphatide and oil body proteins such as Chen have synthesized artificial oil body (AOB), have only 1/10 of natural oil body, have kept characteristic and highly stable [11] of natural oil body by a series of physiological test proof AOB.Peng etc. utilize artificial oil body to optimize oil body-oil body protein expression system, in intestinal bacteria, made up " oil body protein-Xa-GFP " expression vector, by centrifugal, oil body protein-GFP all is enriched to the surface of artificial oil body, by proteolytic enzyme Xa GFP is separated from the oil body protein that embeds oil body, centrifugal again, collect the GFP[12 that supernatant liquor obtains high density].

Peanut is described as " plant meat " by people, major cause is the floorboard with high oil content (45-55%) of peanut seed and high protein content (25-30%), and in addition, the protein in the peanut is very easily absorbed by human consumption, and specific absorption is more than 90%.Peanut all has wide cultivated area in China, India, Nigeria, the U.S. etc., therefore it has the wide basis of sending out as plant-bioreactor, yet in searchable prior art, utilize the method for oil body protein expression system expressing human Osteogenic Protein-1 in peanut seed to yet there are no report.

Summary of the invention

At the deficiencies in the prior art, the problem to be solved in the present invention provides a kind of method of utilizing oil body protein expression system expressing human Osteogenic Protein-1 in peanut seed, realizes that human osteogenic protein is expressed with transgenosis peanut oil body protein in the mode that merges and high level accumulates.

Of the present invention in peanut seed the method for expressing human Osteogenic Protein-1, step comprises that (1) clone comprises the soybean total length oil body protein gene soy-oleosin of specific promoter; (2) acquisition of human osteogenic protein mature peptide cDNA gene bmp7; (3) make up plant expression vector pCAMBIA1302-bmp7; (4) plant transforms; (5) acquisition of transgenosis peanut seed; (6) Western Blot detects the expression of human osteogenic protein in the transgenosis peanut seed; (7) the extensive separation and the recovery human osteogenic protein from the transgenosis peanut seed; It is characterized in that:

The method that described clone comprises the soybean total length oil body protein gene soy-oleosin of specific promoter is: with soybean gene group DNA is template, with primer1:5 ' CATGCCATGGTGTTTATCTTTCTTGCTTTTCTG 3 '; Primer2:5 ' CCGGAATTCCCTTATCATCATCATCTGCGGTTGCGGTTGTTGCTGTCA 3 ' carries out the PCR reaction for primer, and the PCR response procedures is: 94 ℃ of 5min; 94 ℃ of 50s again, 54 ℃ of 45s, 72 ℃ of 2min, 30 circulations; 72 ℃ of 7min;

The method that described human osteogenic protein mature peptide cDNA gene bmp7 obtains is: the mRNA with human chondrocytes is a template, with primer3:5 ' CCGAATTCATATGACCGGCAGCAAACAG 3 '; Primer4:5 ' GAAAGCTTGATCCTTACATGTCGCAGCCACAGGC 3 ' carries out single stage method RT-PCR reaction for primer, and the PCR response procedures is: 45 ℃ of 1h; 45 ℃ of 5min again, 51 ℃ of 1min, 72 ℃ of 1min, 30 circulations; 72 ℃ of 7min;

The construction process of described plant expression vector pCAMBIA1302-bmp7 is: the 3 ' end that the bmp7 gene is connected to the soy-oleosin gene by an erepsin site, be built into together among the plant expression vector pCAMBIA1302 by NcoI and HindIII specific site again, obtain the pCAMBIA1302-bmp7 plant expression vector;

Described plant transforms: will have the method that the plant expression vector pCAMBIA1302-bmp7 of goal gene infects by Agrobacterium and transform peanut plant;

The method that described peanut seed obtains is: the homozygotic peanut seed of transgenosis peanut of the results s-generation;

The method that described Western Blot detects the expression of human osteogenic protein in the transgenosis peanut seed is: anti-as one with human osteogenic protein antibody, horseradish peroxidase detects as two anti-western blot hybridizations;

Described from the transgenosis peanut seed the extensive method of separating and reclaiming human osteogenic protein be meant: the peanut seed that obtains is pulverized, the liquid extracting, centrifugal treating reclaims upper oil phase, obtains fusion rotein; Fusion rotein is the centrifugal human osteogenic protein that promptly obtains after enzyme is cut.

The order of connection of the encoding gene of oil body protein gene of soybean and promotor, recombinant protein is " soybean oil body protein promotor+soybean oil body protein gene+erepsin gene+human osteogenic protein gene+terminator " in the above-mentioned plant expression vector.

Human osteogenic protein has broad clinical application prospect, directly extracts human osteogenic protein program complexity at present and be difficult to obtain pure product from osseous tissue, and people's bone source is also very limited still more; Utilize the microorganism biological reactor can not be to correct glycosylation modified of reorganization human osteogenic protein, recombinant protein does not often have activity or activity very low, utilize that zooblast is low as bio-reactor expressing human bone morphogenic protein expression amount, cost is high, this has just limited clinical application, provided by the invention in peanut seed the method for expressing human bone morphogenic protein solved this difficult problem, realized that human osteogenic protein expresses with transgenosis peanut oil body protein and the high level accumulation in the mode that merges.

The present invention is recipient plant with the peanut, peanut seed is as the carrier of expressing protein, adopt the clone of soybean oil body protein gene and promotor, the structure of expression vector, the genetic transformation of peanut, the human osteogenic protein expression of gene is confirmed, the separation and purification of recombinant protein and the method for recovery, successfully realized utilizing peanut seed as a kind of novel bio-reactor expressing human bone morphogenic protein efficiently and safely in the transgenosis peanut, and then purifying reclaim albumen.

The inventive method has the following advantages:

(1) peanut oleaginousness height, oil body protein account for the proportion of peanut seed total protein more than 10%, and human osteogenic protein is expressed with transgenosis peanut oil body protein and the high level accumulation in the mode that merges.

(2) very stable of the recombinant protein formed of human osteogenic protein and peanut oil body protein can be in peanut seed midium or long term, stable storage, and convenient transportation.

(3) the peanut cultivation area is wide, output is high, production is easy, and the method for separation, purifying human osteogenic protein is simple, easy to operate, cost is low.The component of peanut oil and character are constant after the separation of human bone morphogenic protein, have increased the added value of peanut products.

Description of drawings

Fig. 1 vector construction synoptic diagram.

Fig. 2 recombinant protein purification synoptic diagram.

Embodiment

The present invention will be further described below in conjunction with example, but be not limited thereto.

Embodiment 1 comprises the clone of the soybean oil body protein gene of promotor

Sequence and oil body protein gene sequence (gene accession number: GMU09118), design the forward primer sequence that contains NcoI restriction enzyme site (CCATGG): primer1:5 ' CATGCCATGGTGTTTATCTTTCTTGCTTTTCTG 3 ' according to the promotor of soybean oil body protein among the NCBI; Open reading frame sequence according to the soybean oil body protein gene, remove the termination codon, design has reverse primer primer2:5 ' the CCGGAATTCCCTTATCATCATCATCTGCGGTTGCGGTTG TTGCTGTCA T 3 ' of EcoRI restriction enzyme site (GAATTC) and erepsin recognition site (TTATCATCATCATC).

Extract the genomic dna of soybean (middle yellow 13), method is as follows:

(1) get the soybean young leaflet tablet of 100mg, become powder with liquid nitrogen grinding, or directly with or be stored in-80 ℃;

(2) in 65 ℃ of water-baths preheating CTAB extracting solution (0.2M Tris-HCl, pH 9.0; 0.4M LiCl; 25mM EDTA; 1% SDS).

(3) volume of estimation sample tissue adds the CTAB extracting solution of 1 times of volume preheating in each sample, bathes 10-30min 65 ℃ of temperature;

(4) add the phenol/chloroform/primary isoamyl alcohol (12: 12: 1) of 1 times of volume, mixing;

(5) the centrifugal 2min of 13000rpm;

(6) supernatant is transferred in the new centrifuge tube;

(7) repeat the 4-6 step with chloroform/primary isoamyl alcohol (24: 1);

(8) add the Virahol of 0.7 times of volume, put upside down mixing, room temperature is placed 10min;

(9) with the centrifugal 15min of maximum speed of revolution room temperature;

(10) outwell supernatant, wash precipitation 2-3 time with 75% cold ethanol of 0.2-0.5mL;

(11) after drying precipitated, with 50 μ L water or TE dissolving DNA, place-20 ℃ standby.

(12) draw 5 μ L dissolved DNA, add 45 μ L water, mixing.

The pcr amplification of soybean oil body protein promotor and gene:

So that (primer1 primer2) is primer, and soybean gene group DNA is a template, and pcr amplification obtains the promotor and the full-length gene of soybean oil body protein.Response procedures is as follows: template DNA 1 μ L, 2x pfu mix 10.0 μ L, primer1 (10um) 0.5 μ L, primer2 (10um) 0.5 μ L, ddH ₂O 8.0 μ L.On PCR instrument (TaKaRa TP650), 94 ℃ of 5min are set, 94 ℃ of 50s subsequently, 54 ℃ of 45s, 72 ℃ of 2min, totally 30 back 72 ℃ of 7min of circulation finish reaction.

Get 5 μ L PCR products through 1% agarose gel electrophoresis, observations under the ultraviolet lamp, picking positive colony order-checking (seeing sequence table 1).

The acquisition of embodiment 2 human osteogenic protein mature peptide cDNA gene bmp7

Sequence (gene accession number: NM_001719) design primer primer3:5 ' CCGAATTCATATGACCGGCAGCAAACAG 3 ' that contains the EcoRI site and primer4:5 ' the GAAAGCTTGATCC TTACATGTCGCAGCCACAGGC 3 ' that has the HindIII site according to human osteogenic protein-1 gene mature peptide among the NCBI.

Collect 1x10 ⁶Individual chondrocyte extracts mRNA with Trizol (Takara), according to the standard step of One-Step RT-PCR test kit (Clonetech), carry out following PCR reaction: 45 ℃ of incubation 1h, (45 ℃ of sex change 5min, 51 ℃ of annealing 1min, 72 ℃ of extension 1min) 30 circulations, 72 ℃ prolong 7 minutes.

Get 5 μ L PCR products through 1% agarose gel electrophoresis, observations under the ultraviolet lamp, picking positive colony order-checking (seeing sequence table 4).

The structure of embodiment 3 plant expression vectors

The building process of plant expression vector is as shown in Figure 1:

(1) oil body protein gene and human osteogenic protein gene (oleo-bmp7's) is connected

PCR product enzyme is cut, and system is as follows:

PCR?product?10.0μL，10x?Buffer?H?3.0μL，EcoRI?1.0μL，ddH ₂O16.0μL。37 ℃ of insulation 4h, agarose electrophoresis, refiltered oil body protein and bone morphogenic protein gene segment respectively.

With the T4DNA ligase enzyme oil body protein gene is connected with the human osteogenic protein gene: 10x T4 DNA ligasebuffer 1.0 μ L, Oleosin 4.0 μ L, Bmp7 4.0 μ L, T4 DNA ligase 1.0 μ L.16 ℃ of connections are spent the night, and get to connect product 1.0 μ L pcr amplifications, and system is as follows: 2x pfu mix 10.0 μ l, primer1 (10 μ m) 0.5 μ l, primer4 (10 μ m) 0.5 μ l, ddH ₂O 8.0 μ l.On PCR instrument (TaKaRa TP650), 94 ℃ of 5min are set, 94 ℃ of 1min subsequently, 58 ℃ of 1min, 72 ℃ of 3min, totally 30 back 72 ℃ of 7min of circulation finish reaction.

Get 5 μ l PCR products through 1% agarose gel electrophoresis, observations under the ultraviolet lamp is cut the purpose band about glue recovery 1.8kb.

(2) structure of plant expression vector

The PCR product of plasmid pCAMBIA1302 and above-mentioned recovery is used NcoI and HindIII double digestion simultaneously, reclaim carrier sequence and oleo-bmp7 sequence respectively, with the T4DNA ligase enzyme both are connected: 10x T4DNA ligasebuffer 1.0 μ l, oleo-bmp7 6.0 μ l, pCAMBIA1302 2.0 μ l, T4DNA ligase 1.0 μ l, 16 ℃ of connections are spent the night, and connect product transformed into escherichia coli DH5 α.

The preparation of competent cell:, behind 37 ℃ of cultivation 16-20h, in flat board, obtain single bacterium colony of DH5 α by the method for line dilution with the E.coli DH5 α that aseptic inoculation ring picking-70 ℃ glycerine is preserved; Choose a single bacterium colony in the LB of 5ml liquid nutrient medium, 180rpm shaking culture 12h; Get 1ml DH5 α LB bacterium liquid in the LB of 100ml liquid nutrient medium, the 180rpm shaking culture is to OD value 0.4; Placed on ice 15 minutes, and poured under the aseptic condition in the 50mlBeckman centrifuge tube, 4 ℃, the centrifugal 10min of 3500rpm abandons supernatant; Precipitation is iced the 0.1MCaCl of precooling with 30ml ₂Solution is resuspended; 4 ℃, the centrifugal 10min of 3500rpm carefully pours out supernatant liquor; Precipitation is resuspended in the 15% glycerine 0.1M CaCl2 solution that contains of 2ml ice precooling; These competent cells are pressed every part 100 μ l packing.

Colibacillary conversion: the connection liquid of above-mentioned 10 μ l is added mixing in the 100 μ l competent cells, 30min on ice, 42 ℃ of heat shock 90s, 2 minutes on ice, add 600 μ l liquid LB (NaCl 10g/L, Tryptone10g/L, Yeast powder 5g/L), 37 ℃ of 120rpm shaking culture 1.5h, the centrifugal 1min of 5000rpm evenly is applied to intestinal bacteria (NaCl 10g/L on the solid LB substratum of the kantlex that contains 50 μ g/ml, Tryptone 10g/L, Yeast powder 5g/L, Agar powder 15g/L), 37 ℃ of overnight incubation.Picking list bacterium colony is in 4mL liquid LB, and 37 ℃ are shaken bacterium 8-10h, extracts plasmid DNA (Omega), uses the checking of (NcoI, HindIII) and (NcoI, EcoRI) double digestion respectively, and positive plasmid is carried out sequence verification.

(3) Agrobacterium-mediated Transformation of expression vector

The competent cell of preparation Agrobacterium C58C1: the single bacterium colony of picking Agrobacterium EHA105 shakes bacterium to 5ml LB substratum (containing Rifampin 50 μ g/ml) and spends the night; Get 1ml then and be inoculated in the 50ml liquid LB substratum and (contain Rifampin 50 μ g/ml), 28 ℃ of enlarged culturing, the 220rpm concussion is cultured to OD ₆₀₀=0.5; Ice bath 10min, 4 ℃ of 4500rpm, centrifugal 10min; The thalline 0.1M CaCl of 10ml precooling ₂Resuspended, 4 ℃ of 4500rpm recentrifuge 10min; Precipitation adds 1ml 20mM CaCl ₂Suspension (60% glycerine, 0.1M CaCl ₂), add 10% glycerine again, 80 μ l packing, liquid nitrogen flash freezer is preserved.

Recombinant plasmid transformed Agrobacterium: get the correct plasmid of above-mentioned sequence verification 2 μ l and join in the 80 μ l Agrobacterium competent cells, mixing, be put into 45min on ice, 37 ℃ of water-bath 3min, 28 ℃ of 120rpm shaking culture 1.5h, the centrifugal 1min of 5000rpm evenly is applied to thalline on the solid LB substratum and (contains Rifampin 50 μ g/ml, kantlex 50 μ g/ml), cultivate 2d for 28 ℃.Picking list bacterium colony is in 4ml liquid LB, and 28 ℃ are shaken bacterium and spend the night.

Get 1 μ l bacterium liquid and do template and carry out PCR checking, respectively three pairs of primer primers: (primer1, primer2), (primer3, primer4), (primer1 primer4) carries out the PCR checking, and the PCR program is with embodiment 1 and embodiment 2.

The genetic transformation of embodiment 4 peanuts and the acquisition of transgenosis peanut seed

(1) genetic transformation of peanut plumular axis

The preparation of ectoplast: ripe peanut seed decapsidate, with 70% ethanol seed soaking 1min, aseptic water washing 3 times, use 0.1% mercuric chloride (w/v) to handle 15-25min again, use then aseptic water washing 4-6 time, constantly shake seed during the sterilization, to guarantee the seed-coat sterilization thoroughly.Peel off kind of a skin, embryo is inoculated on the germination medium (sucrose 30g/l, agar 0.7%, MS macroelement, MS trace element), plumular axis gos deep in the substratum, cultivates about 4d and gets plumular axis as explant.25 ± 1 ℃ of culture temperature, intensity of illumination 3500lux.

The infection of peanut plumular axis explant: the Agrobacterium LBA4404 or the EHA105 of fresh culture, the centrifugal collection thalline of 5000g/min is resuspended in the liquid inducing culture, and the optimum concn of agroinfection is OD ₆₀₀=0.5-0.8.Scalpel cuts the peanut plumular axis of the 4d of sprouting, the Agrobacterium (OD that is cultivating ₆₀₀=0.5-0.8) the middle immersion infected 25-30 minute, and the taking-up explant is inhaled on filter paper and is removed unnecessary bacterium liquid, is inoculated into then on the inductive differentiation medium (MS+ sucrose 30g/l, agar 0.7%, 6-BA 10mg/l, NAA 0.8mg/l), and the dark place is cultivated 2d altogether.

Select the regeneration of substratum and transformed plant: after cultivating altogether, explant is received recovery cultivation 7d on the inductive differentiation medium that contains the 500mg/l Pyocianil, receive the enterprising row filter of inductive differentiation medium that contains 10mg/l Totomycin and 500mg/l Pyocianil again, be transferred to further screening on the inductive differentiation medium that contains the 25mg/l Totomycin after cultivating 7d, the about 3-4 bud point that occurs after week growing thickly, later per 2 weeks are changed a fresh culture.When the bud of waiting to grow thickly is grown to 1-2cm it is downcut, move to differentiation elongation medium (MS+ sucrose 30g/L, agar 0.7%, GA ₃4mg/l, 6-BA 2mg/l) on, the concentration of Totomycin concentration is reduced to 10mg/l,, when seedling grows to 3-5cm, it is moved in the root media (1/2MS+ sucrose 30g/L, agar 0.7%, NAA 2.0mg/l) transplanting of hardening, transfer-gen plant.

(2) genetic transformation of peanut cotyledon

The preparation of ectoplast: ripe peanut seed decapsidate, carry out surface sterilization with 70% alcohol flushing 1min earlier, use 0.1% mercuric chloride (w/v) to handle 15-25min again, use then aseptic water washing 4-6 time, in sterilized water, soak 2h at last.Stripping kind of skin obtains cotyledon explant.

The infection of peanut cotyledon explant: the Agrobacterium of fresh culture, centrifugal 10min under the 5000rpm, absorption 5ml suspension are resuspended in the 1/2MS substratum (containing 3% sucrose, dilution in 1: 6) of 30ml, are used for common cultivation.Bacterial suspension is layered on the sterilization culture dish thick about 2-3mm.Get the fresh of peanut and cut cotyledon explant, side cut is immersed in 10-20min in the bacterial suspension, the taking-up explant is inhaled on filter paper and is removed unnecessary bacterium liquid, heeling-in immediately is to bud inducing culture (MS+ sucrose 30g/L, agar 0.7%, 6-BA 20 μ M, 2,4-D 10 μ M) in, wherein otch gos deep in the substratum.Cotyledon and Agrobacterium move on the bud inducing culture that contains cephalo amino doxycycline (250mg/L) after cultivating 72h altogether again, otch will be embedded in the substratum equally.Planting density is 5 explants of each culture dish, and Parafilm seals, under cold luminescent lamp, and 100Es ^-1m ^-2Light intensity, 25 ± 1 ℃, the dark cycle of 16h/8h illumination cultivates.

The selection of plant regeneration and stable conversion plant: the cotyledon explant that infects through Agrobacterium is implanted on the bud inducing culture that contains 250mg/L cephalo amino doxycycline, behind the fortnight, and the part explant bud point that occurs growing thickly, and also bud point continues formation.The explant that bud point occurs is transferred in the bud inducing culture that contains 250mg/L cephalo amino doxycycline and 10mg/L Totomycin, be transferred to after one week and continue in the bud inducing culture that contains the 25mg/L Totomycin to cultivate, there is the explant of the bud part of growing thickly to downcut with long after two weeks, be transferred to contain 250mg/L cephalo amino doxycycline and 10mg/L Totomycin bud elongation medium (MS+ sucrose 30g/L, agar 0.7%, 6-BA 2 μ M) on, carry out succeeding transfer culture 2-3 time, each time incubation time was about for 4 weeks.Bud (3-4cm) cutting-out of elongation is not being contained upward root induction of any antibiotic root media (1/2MS+ sucrose 30g/L, agar 0.7%, NAA 5 μ M), and two weeks can induce adventive root.After hardening, with being transplanted in the soil of transfer-gen plant.

(3) acquisition of transgenosis peanut seed

The results peanut seed, plantation and results s-generation seed extract DNA and carry out PCR detection and Southern hybridization, and the checking transfer-gen plant obtains the transgenosis peanut seed.

Embodiment 5Western Blot detects the expression of human osteogenic protein in the transgenosis peanut seed and extract recombinant protein from the transgenosis peanut seed:

(1) gets the 0.5g dry seeds and extract damping fluid (sucrose 0.6M, KCl 10mM, MgCl in 8ml ₂1mM, Tris-Cl0.15M pH 7.5) in, homogenate.

(2) the centrifugal 20min of 12000rpm gets oil phase.

(3) add the resuspended mixing of extraction damping fluid, the centrifugal 20min of 12000rpm collects oil phase.

(4) add the floating damping fluid of 5ml (sucrose 0.4M, KCl 10mM, MgCl ₂1mM, Tris-Cl 0.15M pH7.5) resuspended, the centrifugal 20min of 12000rpm collects oil phase.

(5) add NaHCO ₃Ice bath 30min, the centrifugal 20min of 12000rpm collects oil phase.

(6) use excessive propanone 0 ℃ of extracting 3 times, remove triacylglycerol and dry up sedimentary albumen, be dissolved in then in an amount of sterilized water.

Western Blot hybridization:

(1) the recombinant protein 50 μ g with extraction pass through 12% SDS-PAGE gel electrophoresis separation.

(2) electrophoresis cuts into suitable size with glue after finishing, with changeing film liquid balance 3 times, each 5 minutes.

(3) nitrocellulose filter is used the distilled water rinse, the electricity consumption shifting method with the protein transduction on the glue to film.

(4) after the commentaries on classics film is put into staining fluid 50s, it is clear to background to decolour in 50% methyl alcohol, cleans with distilled water then.

(5) with 0.01M PBS (NaCl 8.0g, KCl 0.2g, Na ₂HPO ₄1.44g, KH ₂PO ₄0.24g add H ₂O is settled to 1000ml) wash film 3 times, each 15min washes 3h with the immersion of 3% gelatin then, seals non-specific site.

(6) film is taken out, wash 2 times, each 10min with 0.01M PBS.

(7) add one anti-(Monoclonal anti-human BMP7 antibody) with 1000 times of PBS dilutions, room temperature is in conjunction with 2h, and negative control is with 1% BSA.

(8) abandon an anti-and BSA, wash film 4 times with the PBS of 0.01M, at every turn 5min.

(9) add two of horseradish peroxidase and resist (with 2000 times of PBS dilutions), room temperature jog 2h.

(10) abandon two and resist, wash film 4 times, each 5min with PBS.

(11) add colour developing liquid, the distilled water termination reaction is put in the lucifuge colour developing when band occurring.

Embodiment 6 is extensive the separation and the recovery human osteogenic protein from the transgenosis peanut seed

Human osteogenic protein separates and reclaims as shown in Figure 2, with the homogenate of transgenosis peanut seed, squeezing; Remove precipitation (seed hair etc.) after centrifugal, reclaim the oil phase on upper strata, clean the oil phase on back, centrifugal upper strata once more; Add erepsin and carry out the enzymic digestion reaction, the centrifugal oil phase that removes last time reclaims water; Purifying obtains human osteogenic protein.

Reference:

[1]Desmyter?S，Goubau?Y，Benahmed?N，de?Wever?A，Verdonk?R.The?role?of?bonemorphogenetic?protein-7(Osteogenic?Protein-1)in?the?treatment?of?tibialfracture?non-unions.An?overview?of?the?use?in?Belgium. Acta?Orthop?Belg.2008?Aug；74(4)：534-7.

[2]Reddi?AH.Role?of?morphogenetic?proteins?in?skeletal?tissue?engineering?andregeneration. Nat?Biotechnol.1998?Mar；16(3)：247-52.

[3]

K，Fornalczyk?K，

D.Osteopontin(OPN)，PDGF-BB(platelet-derived?growth?factor)and?BMP-7(bone?morphogenetic?protein)asmarkers?of?atherogenesis?in?children?with?chronic?kidney?disease(CKD)treated?conservatively--preliminary?results. Pol?Merkur?Lekarski.2008；24Suppl?4：25-7.

[4] Xiong Shaohu, Jin Lei, Tan Haiyan, Huang Tao, Wang Zhaoyang, Liu Dayong, Zhong Shizhen, expression and the purifying of recombinant human bone morphogenesis protein-2 in intestinal bacteria.＜＜ No.1 Military Medical Univ.'s journalThe 22nd volume the 05th phase (page) in 2002

[5] Car Jing, Han Jinxiang, Wang Shili, Liang Hao, recombinant human Osteogenic Protein-1 efficiently expressing and renaturation in intestinal bacteria.＜＜ Chinese Pharmaceutical JournalThe 40th the 13rd phase of volume in 2005

[6] bent Qing, Lee school Kun, Yu Yaqin utilizes oil body expression system production external source recombinant protein, Chinese biological engineering magazine China Biotechnology, 2007,27 (8): 111～115.

[7] Xu Miaoyun, Liu Dehu, Li Gang is strong. and letter opinion vegetable oils albumen is as carrier production external source. the research of recombinant protein. hi-tech communication, 2004,14 (3): 106-110.

[8]Xu?M?Y，Liu?D?H，Li?G?Q.Cloning?of?soybean?24kDa?oleosin?gene?and?its?transientexpression?as?a?carrier?for?foreign?protein.Agricultural?Sciences?in?China，2004，3(5)：321-329.

[9]Nykiforuk?CL，Boothe?JG，Murray?EW，et?al.Transgenic?expression?and?recoveryof?biologically?active?recombinant?human?insul?in?from?Arabidopsis?thaliana?seeds.Plant?Biotechnol?J.2006?Jan；4(1)：77-85.

[10]Chiang?CJ，Chen?HC，Chao?YP?et?al.Efficient?system?of?artificial?oil?bodiesfor?functional?expression?and?purification?of?recombinant?nattokinase?inEscherichia?coli.J?Agric?Food?Chem.2005?Jun?15；53(12)：4799-80.

[11]Chen?MC，Chyan?CL，Lee?TT，et?al.Constitution?of?stable?artificial?oilbodies?with?triacylglycerol，phospholipid，and?caleosin.J?Agric?Food?Chem.2004Jun?16；52(12)：3982-3987.

[12]Peng?CC，Chen?JC，Shyu?DJ，et?al，A?system?for?purification?of?recombinantproteins?in?Escherichia?coli?via?artificial?oil?bodies?constituted?with?theiroleosin-fused?polypeptides.J?Biotechnol.2004?Jul?1；111(1)：51-7.

Sequence table

＜110〉High and New Technology Research Center, Shandong Prov. Academy of Agriculture S

＜120〉a kind of in peanut seed the method for expressing human Osteogenic Protein-1

<141>2009-6-6

<160>4

<210>1

<211>1234

<212>DNA

＜213〉soybean oil body protein gene and promotor nucleotide sequence thereof

<400>1

tgtttatctt?tcttgctttt?ctgaacaatt?tatctactat?gtaaatatat?tatcaatgtt 60

taatctattt?taatttgcac?ataaattttc?attttatttt?tactttacaa?aacaaataaa 120

tatatatgca?aaaaaattta?caaacgatgc?acggattaca?aactaatttc?attaaatgct 180

aatgcagatt?ttgtgaagta?aaactccaat?tatgatgaaa?aataccacca?acaccacctg 240

cgaaactgta?tcccaactgt?ccttaataaa?aatgttaaaa?agtatattat?tctcatttgt 300

ctgtcataat?ttatgtaccc?cactttaatt?tttctgatgt?actaaaccga?gggcaaactg 360

aaacctgttc?ctcatgcaaa?gcccctactc?accatgtatc?atgtacgtgt?catcacccaa 420

caactccact?tttgctatat?aacaacaccc?ccgtcacact?ctccctctct?aacacacacc 480

ccactaacaa?ttccttcact?tgcagcactg?ttgcatcatc?atcttcattg?caaaacccta 540

aacttcacct?tcaaccatga?ccacacaagt?accaccacac?agtgtccaag?tccacacaac 600

aacacaccgc?tacgaagctg?gcgtcgtccc?acccggagcc?cgtttcgaac?cgccgcgtta 660

tgaagccggc?gtcaaagcgc?cctccattta?ccattccgag?agaggtccaa?cgacttccca 720

ggtcctcgcc?gtcctcgccg?gcctcccggt?cggtggcatc?ctgctcctcc?tggcgggatt 780

gaccctgggc?aggaaccctc?accggactgg?cagttgccac?gccgctcttc?gtcctcttca 840

gcccggtgct?ggttccagcc?acggtcgcat?cggcctggcc?gtggccgggt?tcctgacgtc 900

gggggccttc?gggctcacgg?cgctgtcttc?cttctcctgg?atcctgaact?acatccggga 960

gacccagcca?gcctcggaga?acctcgccgc?cgccgcgaag?catcacctcg?ccgaggcggc 1020

ggagtacgtg?gggcagaaga?cgaaggaagt?ggggcagaag?accaaggagg?ttgggcagga 1080

tattcagagc?aaggcacagg?atacaaggga?ggcagctgca?agggatgcaa?gggaggcagc 1140

tgcaagggat?gcaagggaag?ctgctgcaag?ggatgcaaag?gtggaggcaa?gggatgtaaa 1200

gagaacaaca?gtgacagcaa?caaccgcaac?cgca 1234

<210>2

<211>678

<212>DNA

＜213〉remove the soybean oil body protein gene of terminator

<400>2

atgaccacac?aagtaccacc?acacagtgtc?caagtccaca?caacaacaca?ccgctacgaa 60

gctggcgtcg?tcccacccgg?agcccgtttc?gaaccgccgc?gttatgaagc?cggcgtcaaa 120

gcgccctcca?tttaccattc?cgagagaggt?ccaacgactt?cccaggtcct?cgccgtcctc 180

gccggcctcc?cggtcggtgg?catcctgctc?ctcctggcgg?gattgaccct?gggcaggaac 240

cctcaccgga?ctggcagttg?ccacgccgct?cttcgtcctc?ttcagcccgg?tgctggttcc 300

agccacggtc?gcatcggcct?ggccgtggcc?gggttcctga?cgtcgggggc?cttcgggctc 360

acggcgctgt?cttccttctc?ctggatcctg?aactacatcc?gggagaccca?gccagcctcg 420

gagaacctcg?ccgccgccgc?gaagcatcac?ctcgccgagg?cggcggagta?cgtggggcag 480

aagacgaagg?aagtggggca?gaagaccaag?gaggttgggc?aggatattca?gagcaaggca 540

caggatacaa?gggaggcagc?tgcaagggat?gcaagggagg?cagctgcaag?ggatgcaagg 600

gaagctgctg?caagggatgc?aaaggtggag?gcaagggatg?taaagagaac?aacagtgaca 660

gcaacaaccg?caaccgca 678

<210>3

<211>556

<212>DNA

＜213〉promotor

<400>3

tgtttatctt?tcttgctttt?ctgaacaatt?tatctactat?gtaaatatat?tatcaatgtt 60

taatctattt?taatttgcac?ataaattttc?attttatttt?tactttacaa?aacaaataaa 120

tatatatgca?aaaaaattta?caaacgatgc?acggattaca?aactaatttc?attaaatgct 180

aatgcagatt?ttgtgaagta?aaactccaat?tatgatgaaa?aataccacca?acaccacctg 240

cgaaactgta?tcccaactgt?ccttaataaa?aatgttaaaa?agtatattat?tctcatttgt 300

ctgtcataat?ttatgtaccc?cactttaatt?tttctgatgt?actaaaccga?gggcaaactg 360

aaacctgttc?ctcatgcaaa?gcccctactc?accatgtatc?atgtacgtgt?catcacccaa 420

caactccact?tttgctatat?aacaacaccc?ccgtcacact?ctccctctct?aacacacacc 480

ccactaacaa?ttccttcact?tgcagcactg?ttgcatcatc?atcttcattg?caaaacccta 540

aacttcacct?tcaacc 556

<210>4

<211>420

<212>DNA

＜213〉human osteogenic protein-1 gene nucleotide series

<400>4

atgaccggca?gcaaacagcg?cagccagaac?cgctccaaga?cgcccaagaa?ccaggaagcc 60

ctgcggatgg?ccaacgtggc?agagaacagc?agcagcgacc?agaggcaggc?ctgtaagaag 120

cacgagctgt?atgtcagctt?ccgagacctg?ggctggcagg?actggatcat?cgcgcctgaa 180

ggctacgccg?cctactactg?tgagggggag?tgtgccttcc?ctctgaactc?ctacatgaac 240

gccaccaacc?acgccatcgt?gcagacgctg?gtccacttca?tcaacccgga?aacggtgccc 300

aagccctgct?gtgcgcccac?gcagctcaat?gccatctccg?tcctctactt?cgatgacagc 360

tccaacgtca?tcctgaagaa?atacagagac?atggtggtcc?gggcctgtgg?ctgccactag 420

Claims

1. the method for an expressing human Osteogenic Protein-1 in peanut seed, step comprise that (1) clone comprises the soybean total length oil body protein gene soy-oleosin of specific promoter; (2) acquisition of human osteogenic protein mature peptide cDNA gene bmp7; (3) make up plant expression vector pCAMBIA1302-bmp7; (4) plant transforms; (5) acquisition of transgenosis peanut seed; (6) Western Blot detects the expression of human osteogenic protein in the transgenosis peanut seed; (7) the extensive separation and the recovery human osteogenic protein from the transgenosis peanut seed; It is characterized in that:

According to claim 1 described in peanut seed the method for expressing human Osteogenic Protein-1, it is characterized in that: the order of connection of the encoding gene of oil body protein gene of soybean and promotor, recombinant protein is " soybean oil body protein promotor+soybean oil body protein gene+erepsin gene+human osteogenic protein gene+terminator " in the described plant expression vector.