CN101565757A - Reovirus-detecting fluorescence quantitative PCR kit and application thereof - Google Patents
Reovirus-detecting fluorescence quantitative PCR kit and application thereof Download PDFInfo
- Publication number
- CN101565757A CN101565757A CNA2009100623961A CN200910062396A CN101565757A CN 101565757 A CN101565757 A CN 101565757A CN A2009100623961 A CNA2009100623961 A CN A2009100623961A CN 200910062396 A CN200910062396 A CN 200910062396A CN 101565757 A CN101565757 A CN 101565757A
- Authority
- CN
- China
- Prior art keywords
- reovirus
- pcr
- fluorescence quantitative
- primer
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a reovirus-detecting fluorescence quantitative PCR kit and an application thereof. The kit comprises: a) an RNA extraction solution, b) a reverse transcriptase reaction solution, c) reverse transcriptase, d) an RNA enzyme inhibitor, e) a primer and a TaqMan probe, f) a standard positive DNA template and g) a PCR fluorescence quantitative reaction solution. The kit is characterized in that: primer sequence is a sense primer: 5'-TGCGCCTATCCTTGAGTTGA-3', and an antisense primer: 5'-TTGCCAGGAAATACGGGTCT-3', and the size of an amplicon is 138 bp; the sequence of a fluorescence probe is: 5'-FAM-TCAAAATGGTGGACTTCAGTTTCGATTT-TAMRA-3', the 5' end of the probe is marked with a fluorescence emission group FAM, the 3' end is marked with a fluorescence quenching group TAMRA, the standard positive DNA template transforms a colon bacillus DH5 alpha by a pGEM-T carrier inserted with reovirus S1 protein zone 361 bp segment, plasmid is extracted after proliferation, an A260 ration is measured in an ultraviolet spectrophotometer, and the plasmid is diluted by 10 times of gradient. The kit can efficiently and conveniently monitor the reovirus pollution in serum products in real time, can be applicable to epidemiology investigation of reovirus infection, and can provide technical support for relevant fundamental researches, thus having quite broad application prospect.
Description
Technical field:
The present invention relates to biological technical field, more specifically relate to a kind of PCR kit for fluorescence quantitative that detects reovirus, the purposes that also relates to PCR kit for fluorescence quantitative simultaneously, be applicable to that pollution is monitored in real time to the reovirus in the serum product, be widely used in the epidemiology survey of this virus infection simultaneously, can also provide technical support for related basic research.
Background technology
Reovirus belongs to Reoviridae (Reoviridae), the double-stranded RNA genome that tool is segmented, and no cyst membrane has double capsid, and its host range is wide, 5 genus of energy infected person, vertebrates, insect, plant.Mainly causing growing animal diarrhoea in cows, dewater and death, is milk cow and beef cattle group's regular incidence.Antibody recall rate in the cows is high, and during acute attack, mortality ratio is very high, brings serious problem for livestock industry, international trade outlet and food safety etc.Because the tissue culture host range of Reovirus is quite wide, often cause the Reovirus of culturing cell pollution, and usually be difficult for arousing attention from serum, bring certain problem for cell cultures and related basic research.The rapid detection of reovirus is control and eliminates this sick prerequisite, but its conventional sense method has the some shortcomings part, and in general detection technique has serodiagnosis technology, biological test, diagnosis of molecular biology technology three classes:
1. serodiagnosis technology comprises complement fixation test, neutralization experiment, aggegation experiment, immunodiffusion(ID), precipitation experiment, immuno-electrophoresis, immunofluorescence dyeing, double-antibody sandwich elisa and immunoelectronmicroscopy etc.In these methods, obtain having of common recognition and widespread use: complement fixation test, indirect hemagglutination test, agar diffusion experiment, neutralization experiment.But because the reaction of antiserum(antisera) and antigen immune is all used in all experiments, long reaction time, material is many, the preparatory period is long, detection has tangible hysteresis quality, can only be qualitative can not be quantitative, and poor repeatability.
2. biological test comprises experimentation on animals, egg inoculation and cell cultures.There is insensitive problem in this detection method, and has anticomplementary activity in some sample, and influence detects effect.Experimentation on animals cost height, the cycle is long, waste Biological resources and manpower and materials.
3. the diagnosis of molecular biology technology comprises nucleic acid hybridization experiment, polyacrylamide gel electrophoresis, polymerase chain reaction, the detection of negative staining Electronic Speculum etc.Detection method such as nucleic acid hybridization, polyacrylamide gel electrophoresis is more suitable in virus characteristic is carried out more deep research, because the total system complicated operation, process is various, and the cost height is not suitable for carrying out simultaneously mass detection, thereby is very limited.By contrast, common RT-PCR method specificity is good, and the detection sensitivity height not only can detect live virus nucleic acid, also can directly detect the nucleic acid fragment of deactivation.Sample can be the Reovirus in organ, tissue, the cell, and can distinguish mutually with different Reovirus strain and rotavirus, border disease virus, and this is that immunological method is irreplaceable.But what this traditional quantivative approach was measured all is the end product of PCR, rather than initiate dna or RNA copy number.Owing to do not have linear relationship between the end product amount of PCR and the starting template amount, so can not calculate initiate dna or RNA copy number according to final PCR product amount.Therefore, measuring reovirus how fast, accurately is one of main difficult problem that faces.
The quantitative fluorescent PCR that development in recent years is got up (Fluorogenetic Quantitative PCR, FQ-PCR) technology is highly sensitive with it, speed is fast, advantages such as high specificity are at gene expression dose analysis (Nellemann C, Vinggaard AM, Dalgaard M, et al.Quantification of Antiandrogen Effect Determinedby LightCycler Technology[J] .Toxicology, 2001,163:29-38), qualitative (the Bhudevi B of pathogenic agent, Weinstock D.Fluorogenic RT-PCR assay (TaqMan) for Detection andClassification of Bovine Viral Diarrhea Virus[J] .Vet.Microbiol., 2001,83:1-10.) and detection by quantitative (Kathy F.J.Tang, Jun Wang, Donald V.Lightner.Quantitation of Taurasyndrome virus by real-time RT-PCR with a TaqMan assay[J] .J.Virol.Methods, 115 (2004) 109-114.; Birgit Liss.Improved quantitative real-time RT-PCR forexpression profiling of individual cells[J] .Nucleic Acids Res., 2002, Vol.30 No.17e89.; Franck Housseau a, limberly R.Lindsey a, et al.Quantitative real-time RT-PCRas a method for monitoring T lymphocyte reactivity to full-length tyrosinase proteinin vaccinated melanoma patients[J] .J.Immunol.Methods 266 (2002) 87-103.; DesireN, Dehee A, Schneider V, et al.Quantification of Human Immunodeficiency VirusType 1 Proviral Load by a TaqMan Real-Time PCR Assay[J] .J.Clin.Microbiol, 2001,39:1303-1310; Martell M, Gomez J, Esteban JI, et al.High-ThroughputReal-Time Reverse Transcription-PCR Quantitation of Hepatitis C Virus RNA[J] .J.Clin.Microbiol, 1999,37:327-332; Gallagher EM, Margolin AB.Development of anintegrated cell culture-Real-time RT-PCR assay for detection of reovirus inbiosolids[J] .J.Virol.Methods, 2007,139 (2): 195-202; Florence KP, Glaucia PB, Mireille S, et al.Quantitation of HCV RNA using real-time PCR and fluorimetry[J] .J.Virol.Methods, 2001,95:111-119.) etc. the aspect be used widely, and become the quantitative main method of current viral nucleic acid, domestic also existing at present test kit listing about third liver, hepatitis B, mycoplasma, AIDS, tuberculosis detection by quantitative.
Summary of the invention
The objective of the invention is to be to provide a kind of PCR kit for fluorescence quantitative that detects reovirus, this test kit is applicable to all types fluorescence quantitative gene extender in the market, highly sensitive, quantitatively quick and precisely, wide, the good stability of sensing range.
Another object of the present invention is to be to provide the application of a kind of PCR kit for fluorescence quantitative in the epidemiology survey of milk cattle infected reovirus, can pollute the reovirus in the serum product efficiently and easily and monitor in real time, can be widely used in simultaneously the epidemiology survey of this virus infection, can also provide technical support for related basic research.
To achieve these goals, the present invention adopts following technical measures:
A kind of PCR kit for fluorescence quantitative that detects reovirus: it comprises a) RNA extract, b) reverse transcription reaction liquid, c) RNA enzyme inhibitors, d) reversed transcriptive enzyme, e) primer and fluorescent probe (TaqMan), f) standard positive dna profiling, g) fluorescence quantitative PCR reaction solution, it is characterized in that: adopt traditional two-step approach amplification (Two-Step RT-PCR), be that the first step is carried out reverse transcription reaction, RNA sample reverse transcription is become cDNA, second step was carried out the quantitative fluorescent PCR reaction, introduced standard positive DNA sample detection by quantitative unknown sample simultaneously.As standard substance, make that the quantitative reaction result is more reliable and more stable with DNA, and increased the repeatability of experiment greatly, reduce error.Reverse transcription reaction liquid contains reverse transcriptase reaction liquid, the RNA enzyme inhibitors, the fluorescent quantitation reaction solution contains primer and fluorescent probe, primer sequence is respectively sense primer: (FP) 5 '-TGCGCCTATCCTTGAGTTGA-3 ' (SEQ ID NO:1), antisense primer (RT): 5 '-TTGCCAGGAAATACGGGTCT-3 ' (SEQ ID NO:2), the amplicon size is 138bp.The fluorescent probe sequence is 5 '-FAM-TCAAAATGGTGGACTTCAGTTTCGATTT-TAMRA-3 ' (SEQID NO:3), 5 ' end mark fluorescent emission group FAM (6-Fluoresceincarboxylic acid) of probe, 3 ' end is marked with fluorescent quenching group TAMRA.The standard positive dna profiling is the segmental pGEM-T carrier of S1 protein region 361bp (available from Promega company) transformed into escherichia coli DH5 α (available from Invitrogen company) by inserting reovirus, and plasmid is extracted in the propagation back, and surveys A in ultraviolet spectrophotometer
260Quantitative also 10 times of gradient dilutions.Described reverse transcription reaction liquid is by 5 * buffer, the antisense primer of 10 μ mol/L, and reversed transcriptive enzyme, the RNA enzyme inhibitors, the sterilization distilled water of 10mM dNTPs and no RNA enzyme is formed; Fluorescence quantitative PCR reaction solution is by 2 * Premix, the sense primer of 10 μ mol/L and antisense primer, and 10 μ mol/L fluorescent probes and aseptic double-distilled water are formed.Described standard positive template dna nucleotide sequence is:
TGCGCCTATCCTTGAGTTGATAGAATCAAACACAGTCGTCTTGAGAGTCAAGTTATTATTAACTATCTGGAATTAATCAGTATTAAATCGAAACTGAAGTCCACCATTTTGAATATTCAGACCCGTATTTCCTGGCAA
In a preferred version of the present invention, adopt traditional two-step approach amplification (Two-Step RT-PCR), promptly the first step is carried out reverse transcription reaction, and RNA sample reverse transcription is become cDNA, second step was carried out the quantitative fluorescent PCR reaction, introduced standard positive DNA sample detection by quantitative unknown sample simultaneously.As standard substance, make that the quantitative reaction result is more reliable and more stable with DNA, and increased the repeatability of experiment greatly, reduce error.In a concrete scheme of the present invention, reverse transcription reaction liquid is by antisense primer (RT), reversed transcriptive enzyme, RNA enzyme inhibitors, 5 * buffer solution, the two compositions that steam of the sterilization of 10mM dNTPs and no RNA enzyme; Fluorescence quantitative PCR reaction solution is by sense primer (FP), antisense primer (RT), and fluorescent probe (TaqMan), 2 * buffer solution and sterilization distilled water are formed; In a concrete scheme of the present invention, reverse transcription reaction liquid is by 5 * buffer solution, 5 μ l, the antisense of 10 μ mol/L (RT) primer 2 .5 μ l, 10mM dNTPs1.5 μ l, each 1 μ l of reversed transcriptive enzyme and RNA enzyme inhibitors, the sterilization distilled water 9 μ l of no RNA enzyme form; The fluorescent quantitation reaction solution is by 2 * buffer solution, 12.5 μ l, and 10 μ mol/L justice (FP), antisense (RT) primer be 3 μ l respectively, 10 μ mol/L fluorescent probes, 0.75 μ l, and sterilization distilled water 0.75 μ l forms.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
In a preferred version of the present invention, the standard positive dna profiling inserts the segmental pGEM-T of purpose (available from Promega company) carrier transformed into escherichia coli DH5 α by containing, and plasmid is extracted in the propagation back, and surveys A in ultraviolet spectrophotometer
260Quantitative also 10 times of gradient dilutions.Testing used standard substance preparation process is: downcut behind the PCR product electrophoresis and contain the segmental gel of purpose, gel-purified test kit purifying with Omega company, spend the night for 4 ℃ with pGEM-T carrier (available from Promega company) and to be connected, the transformed competence colibacillus cell, converted product is coated with dull and stereotyped the cultivation, picking hickie PCR identifies and to send the order-checking of rich inferior biotechnology company limited after the positive, according to sequencing result the positive colony bacterium of screening is inoculated into the LB substratum incubated overnight that contains the ammonia Bian, prepare plasmid DNA with the SDS alkaline lysis, behind the gel-purified test kit purifying of Omega company, survey A in ultraviolet spectrophotometer
260Quantitatively, and be diluted to gradient 10
9-10
2Copy/10 μ l ,-70 ℃ of preservations.
In the invention provides the PCR kit for fluorescence quantitative that detects reovirus, there is one one end to be marked with the specificity fluorescent probe that the fluorescence report group the other end is marked with the fluorescent quenching group, when probe is complete, two groups distance on space structure is close mutually, the fluorescence that 5 ' end reporter group produces is because FRET (fluorescence resonance energy transfer) (FRET) and by the group cancellation of going out of 3 ' end quenching, so there is not the variation of fluorescent signal in the system.In PCR annealing and extension process, probe combines with template specificity, extension along with primer, the Taq archaeal dna polymerase utilizes its 5 '-3 ' circumscribed activity that probe cutting is discharged reporter group, destroyed the FRET between two groups like this, the fluorescent probe that the fluorescence that reporter group discharged can be built in the detection by quantitative instrument detects, and template is whenever duplicated once, just there is a probe to be cut off, follows the release of a fluorescent signal.Because d/d fluorophor number and PCR product quantity are man-to-man relations, so the accumulation volume of the increase of fluorescence volume and PCR product is proportionlity.To reovirus quantitatively can comparing draws by the circulation thresholding (Ct, Threshold Cycle) with standard substance.The Ct value is in the PCR process, and the accumulation of fluorescence volume surpasses the cycle number of substrate fluorescence volume, and Ct value and initial modulus are the certain proportion relation, and the Ct value is more little, and the starting template number is many more, and on the contrary, the Ct value is big more, and the starting template number is few more.Utilize the Ct value of positive gradient standard form to make typical curve, can accurately measure the initial copy number of this sample again according to the Ct value of testing sample.
In the invention provides the PCR kit for fluorescence quantitative that detects reovirus, at the singularity of Nucleotide arrangement in the genomic target fragment of reovirus, with reaction system (primer and concentration and probe concentration, Mg
2+Concentration, amplification program etc.) optimization, and Q-PCR technology and detection by quantitative system (comprised the LigthCycler system, Roche, ABI Prism system, PE Applied Biosystems) combines, use it for the detection by quantitative of the reovirus sample in various sources.Pass through prioritization scheme, experiment repeatedly, and compare with traditional detection method, set up the method for detection by quantitative reovirus, and develop the detection by quantitative test kit of reovirus, the sensitivity of this test kit can detect the virogene copy number below 100 in each reaction system, sensing range can reach eight orders of magnitude.
In another aspect of the present invention, the method that the present invention also provides a kind of PCR kit for fluorescence quantitative that reovirus is detected, this method comprises the following steps:
A) use f) the standard positive dna profiling is by inserting the segmental pGEM-T of purpose (available from promega company) carrier transformed into escherichia coli DH5 α, and plasmid is extracted in the propagation back, and quantitative with ultraviolet spectrophotometer;
B) use a) that the RNA extract extracts RNA from sample to be measured, add b then) reverse transcription reaction liquid, c) RNA enzyme inhibitors, d) reversed transcriptive enzyme, e) antisense primer carries out reverse transcription;
C) quantitative fluorescent PCR is by e) primer and fluorescent probe (TaqMan), g) PCR fluorescent quantitation reaction solution, f) standard positive dna profiling or reverse transcription reaction product are formed, added machine on the fluorescent quantitation reaction solution PCR reaction system of standard substance and testing sample, carried out PCR with the fluorescent quantitation detector and detect;
D) calculate the initial copy number of testing sample according to typical curve by the circulation thresholding of testing sample and standard substance relatively.
The PCR kit for fluorescence quantitative of the detection reovirus that provides in the present invention can carry out accurate detection by quantitative to the reovirus sample in various sources, and can carry out detection by quantitative and quality monitoring to bovine blood goods and bovine serum, can be widely used in simultaneously the epidemiology survey of this virus infection, can also provide technical support for related basic research.
The present invention compared with prior art has the following advantages and effect:
1. compare with traditional quantivative approach, this real-time fluorescence quantitative PCR has high sensitivity, the characteristics of high specific and high accuracy, directly the every circulation primary of PCR is just collected data, set up real-time amplification curve, determine the Ct value exactly, thereby determine initial RNA copy number, accomplished truly nucleic acid quantification according to the Ct value.
2. compare with single stage method, the two-step approach amplification (Two-Step RT-PCR) that this experiment is adopted makes that with the DNA standard substance of concentration known the quantitative reaction result is more reliable and more stable, and has increased the repeatability of experiment greatly, the minimizing error.
3. sensing range is wide, 10
9-10
2Fabulous linear relationship (R=0.999) is arranged in the copies/reaction concentration range, and sensing range can reach eight orders of magnitude, reaches advanced world standards, and its sensitivity can detect below the 100copies, is that other any method is incomparable.
4. be applicable to the fluorescent quantitation amplification instrument of various models, once three corresponding variation coefficient of repeat samples (CV) illustrate repeatability that it is high and stable less than 2% in the experiment.
5. the outer typical curve of this real-time fluorescence quantitative PCR utilization is quantitatively the most accurate up to now, and the quantivative approach that circulation ratio is best has obtained globally generally acknowledging, is widely used in numerous areas such as gene expression research, curative effect of medication examination, pathogen detection.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Be to be understood that, these embodiment only are used to the present invention is described and are not used in restriction the scope of protection of present invention, unreceipted concrete experiment condition and method in the following example, usually according to normal condition as chief editors such as J. Sa nurse Brookers, Science Press, 2002, molecular cloning experiment guide (third edition); D.L. chief editor such as Spector, Science Press, 2001, cell experiment guide; F.M. chief editor such as Ao Sibai, Science Press, 2005, fine works molecular biology experiment guide, or according to the condition of manufacturer's suggestion.
The PCR kit for fluorescence quantitative of embodiment 1 reovirus is formed and reaction conditions
A). test kit is formed:
A) test kit is composed as follows: (10 secondary response)
RNA extracting solution A (4ml/ pipe) RNA extracting solution B (800 μ l/ pipe)
Reverse transcription reaction liquid (90 μ l/ pipe) reversed transcriptive enzyme (10 μ l/ pipe)
RNA enzyme inhibitors (400U/ pipe)
Strong positive standard substance (100 times of accurate product 20 μ l/ pipes of dilution definite value, totally four pipes)
PCR reaction tubes (aseptic, no RNA enzyme and DNA enzyme) DEPC H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
Fluorescence quantitative PCR reaction solution (125 μ l/ pipe)
(RNA extracting solution A is an Invitrogen company product.B) reverse transcription reaction liquid, d) reversed transcriptive enzyme is available from Promega company, and g) fluorescence quantitative PCR reaction solution and RNA enzyme inhibitors (40U/ μ l) are available from TAKARA company.)
B). reverse transcription reaction liquid (the reaction cumulative volume is 25 μ l): by 5 * buffer solution, 5 μ l, the antisense primer RT of 10 μ mol/L (SEQ ID NO:2), 2.5 μ l, 10mM dNTPs1.5 μ l, each 1 μ l of reversed transcriptive enzyme and RNA enzyme inhibitors, the sterilization distilled water 9 μ l of no RNA enzyme and testing sample 5 μ l form; The fluorescent quantitation reaction solution is by 2 * buffer solution, 12.5 μ l, each 3 μ l of 10 μ mol/L sense primer FP (SEQ ID NO:1), antisense primer RT, 10 μ mol/L fluorescent probes, 0.75 μ l, sterilization distilled water 0.75 μ l, the cDNA of testing sample or standard substance are formed.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
C). reaction conditions is as follows: (employing two-step approach)
cDNA synthesis:70℃ 10min
0℃ 2min
0℃ pause
42℃ 50min
70℃ 10min
PCR: 95℃, 2min
94℃, 15s
60℃, 60s
40cycles
When each round-robin second EOS, carry out fluoroscopic examination.To Reovirus quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
D). PCR kit for fluorescence quantitative detects sensitivity, sensing range and the stability of reovirus
Get the standard substance RNA10 that transcribes
9-10
2The c/r concentration range, three repetitions of each concentration, add the abundant mixing of RNA lysate 400 μ l, room temperature (20-25 ℃, below identical) left standstill 10 minutes, added 80 μ l chloroforms, room temperature left standstill 3 minutes, in centrifugal 10 minutes of 4 ℃ of 12000g/min, supernatant liquor was transferred to another centrifuge tube, adds 200 μ l Virahols, precipitation at room temperature 10 minutes, centrifugal 10 minutes of 4 ℃ of 12000g/min decant supernatant, add 1ml 75% (volume ratio) ethanol and fully dispel, in centrifugal 5 minutes of 4 ℃ of 7500g/min, abandon supernatant, RNA precipitates seasoning at room temperature, adds 60 ℃ of 10min dissolvings of no RNA enzyme water 25 μ l.
E). get D) the step RNA that carries 5 μ l, add reverse transcription reaction liquid 5 * buffer 5 μ l then, antisense primer RT (SEQ ID NO:2) 2.5 μ l (10 μ mol/L), 10mM dNTPs 1.5 μ l, RNA enzyme inhibitors (40U/ μ l), reversed transcriptive enzyme 1ul adds the PCR reaction tubes of reference numeral respectively, carries out the reverse transcription experiment on the PCR instrument.Reaction conditions is: 70 ℃ of 10min, 0 ℃ of 2min, 42 ℃ of 50min, 70 ℃ of 10min.Fluorescence quantitative PCR reaction solution 12.5 μ l, each 3 μ l of 10 μ mol/L sense primer FP (SEQ ID NO:1), antisense primer RT (SEQ IDNO:2), fluorescent probe 0.75 μ l (10 μ mol/L), testing sample cDNA or standard substance DNA 5 μ l, the PCR reaction tubes that adds reference numeral respectively, the parallel PCR that is detects on the fluorescent quantitation detector.Cycling condition is: 95 ℃ of pre-sex change 2min; 94 ℃ of 15s, 60 ℃ of 60s, 40 circulations of increasing.Carry out when the program of fluoroscopic examination is arranged on each round-robin second EOS, the detection wavelength is 518nm.
After the loop ends, the utilization instrument carries analysis software (Eppendorf quantitative real time PCR Instrument, model: Mastercyler ep realplex, software: realplex), read sample copy number to be checked.The result is:
Sequence number | Title | Type | Threshold value (Ct) | Set concentration | Variation coefficient % |
1 | A1 | Standard | 12.13 | 1000000000 | 0.06 |
2 | A2 | Standard | 12.14 | 1000000000 | 0 |
3 | A3 | Standard | 12.15 | 1000000000 | 0.06 |
4 | B1 | Standard | 15.54 | 100000000 | 0.32 |
5 | B2 | Standard | 15.48 | 100000000 | 0 |
6 | B3 | Standard | 15.42 | 100000000 | 0.32 |
7 | C1 | Standard | 18.23 | 10000000 | 0 |
8 | C2 | Standard | 18.11 | 10000000 | 0.54 |
9 | C3 | Standard | 18.35 | 10000000 | 0.54 |
10 | D1 | Standard | 22.65 | 1000000 | 0.04 |
11 | D2 | Standard | 22.75 | 1000000 | 0.43 |
12 | D3 | Standard | 22.53 | 1000000 | 0.43 |
13 | E1 | Standard | 25.79 | 100000 | 0.10 |
14 | E2 | Standard | 25.64 | 100000 | 0.40 |
15 | E3 | Standard | 25.85 | 100000 | 0.30 |
16 | F1 | Standard | 28.73 | 10000 | 0.03 |
17 | F2 | Standard | 28.64 | 10000 | 0.31 |
18 | F3 | Standard | 28.85 | 10000 | 0.34 |
19 | G1 | Standard | 32.01 | 1000 | 0 |
20 | G2 | Standard | 32.95 | 1000 | 0.17 |
21 | G3 | Standard | 32.07 | 1000 | 0.17 |
22 | H1 | Standard | 35.65 | 100 | 0.05 |
23 | H2 | Standard | 35.49 | 100 | 0.36 |
24 | H3 | Standard | 35.74 | 100 | 0.28 |
25 | CK- | NTC | - |
Above result shows: this test kit sensing range is wide, 10
9-10
2Fabulous linear relationship is arranged in the c/r concentration range, its sensing range of coefficient R=0.999 can reach nine orders of magnitude, its sensitivity can detect below the 100copies, and good stability, three corresponding variation coefficient of repeat samples (CV) are less than 1% in once testing, the repeatability that it is high being described, being applicable to the fluorescent quantitation amplification instrument of various models, is that other any method is incomparable.
Embodiment 2: the application of reovirus PCR kit for fluorescence quantitative in the epidemiology survey of milk cattle infected reovirus.
A) test kit is composed as follows: (10 secondary response)
RNA extracting solution A (4ml/ pipe) RNA extracting solution B (800 μ l/ pipe)
Reverse transcription reaction liquid (90 μ l/ pipe) reversed transcriptive enzyme (10 μ l/ pipe)
RNA enzyme inhibitors (400U/ pipe)
Strong positive standard substance (100 times of accurate product 20 μ l/ pipes of dilution definite value, totally four pipes)
PCR reaction tubes (aseptic, no RNA enzyme and DNA enzyme) DEPC H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
Fluorescence quantitative PCR reaction solution (125 μ l/ pipe)
(RNA extracting solution A is an Invitrogen company product.B) reverse transcription reaction liquid, d) reversed transcriptive enzyme is available from Promega company, and g) fluorescence quantitative PCR reaction solution and RNA enzyme inhibitors (40U/ μ l) are available from TAKARA company.)
B). reverse transcription reaction liquid (the reaction cumulative volume is 25 μ l): by 5 * buffer solution, 5 μ l, the antisense primer RT of 10 μ mol/L (SEQ ID NO:2), 2.5 μ l, 10mM dNTPs1.5 μ l, each 1 μ l of reversed transcriptive enzyme and RNA enzyme inhibitors, the sterilization distilled water 9 μ l of no RNA enzyme and testing sample 5 μ l form; The fluorescent quantitation reaction solution is by 2 * buffer solution, 12.5 μ l, each 3 μ l of 10 μ mol/L sense primer FP (SEQ ID NO:1), antisense primer RT, 10 μ mol/L fluorescent probes, 0.75 μ l, sterilization distilled water 0.75 μ l, the cDNA of testing sample or standard substance are formed.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
C). reaction conditions is as follows: (employing two-step approach)
cDNA synthesis:70℃ 10min
0℃ 2min
0℃ pause
42℃ 50min
70℃ 10min
PCR: 95℃, 2min
94℃, 15s
60℃, 60s
40cycles
When each round-robin second EOS, carry out fluoroscopic examination.To Reovirus quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
D) experimental technique
1. cell cultures
1) African green monkey kidney cell line of Pei Yanging (Vero) shop system 12 orifice plates, 1ml/ hole, 50% degree of converging;
2) serum to be checked is formulated as 5% (volume ratio) concentration with MEM;
3) behind the cell attachment, be replaced by the substratum of serum preparation to be checked, the 1ml/ hole;
4) establish feminine gender and positive control simultaneously, positive control adds 5% (volume ratio) FBS MEM that contains Reovirus;
5) 37 ℃, 5% (volume ratio) CO
2Cultivate in the incubator, and observe the generation whether CPE is arranged.
6) behind the 72h, collecting cell, 2000rpm is centrifugal 5min is temporary in-80 ℃.All the other samples are handled with quadrat method.Extract total RNA of cell, as the template of RT.
2. the extraction of total RNA in the cell
Each sample adds RNA extracting solution A 400 μ l, and room temperature (20-25 ℃) is placed 10min, adds RNA extracting solution B 80 μ l, concuss 15s, and room temperature (20-25 ℃) is placed 2~3min; 4 ℃, the centrifugal 15min of 12000rpm gets supernatant 200 μ l, moves into a new EP pipe, adds Virahol 200 μ l again, leaves standstill 10min under the room temperature; 4 ℃, the centrifugal 15min of 12000rpm; Abandon supernatant, precipitation adds the cold ethanol 400 μ l of 75% (volume ratio), vortex, and 4 ℃, the centrifugal 5min of 7500rpm abandons supernatant and stays precipitation, leaves standstill 5~10min in room temperature and dries ethanol, adds 25 μ l DEPC water dissolution precipitation.
3. B is pressed in the reaction of reverse transcription reaction and quantitative fluorescent PCR), carry out shown in C).
E). the detection of reovirus in the cow serum
25 parts of cow serums of different sources are pressed D) shown in treatment process obtain viral RNA, carry out reverse transcription and quantitative fluorescent PCR reaction (press B) respectively, C) carry out (carry out once successively, carry out quantitative fluorescent PCR behind the reverse transcription and react) shown in the step.Each sample repeats twice, and after the loop ends, the utilization instrument carries analysis software (Eppendorf quantitative real time PCR Instrument, model: Mastercyler ep realplex, software: realplex), read sample copy number to be checked.The result is:
The milk cow numbering | The serum sample numbering | Reovirus-copies/ml | Variation coefficient % |
5-189 | A1 | - | |
6-237 | A2 | - | |
2-067 | A3 | - | |
6-248 | A4 | - | |
5-188 | A5 | - | |
106 | A6 | - |
2-149 | A7 | - | |
5-177 | A8 | - | |
6-312 | A9 | - | |
5-148 | A10 | - | |
7-134 | A11 | - | |
601 | A12 | - | |
2-257 | A13 | - | |
6-256 | A14 | - | |
03-6116 | A15 | - | |
2-082 | A16 | - | |
4-042 | A17 | - | |
6-905 | A18 | - | |
114 | A19 | - | |
2-147 | A20 | - | |
6-730 | A21 | - | |
7-021 | A22 | (6.12±0.04)×10 4 | 0.03 |
2-034 | A23 | - | |
6-065 | A24 | - | |
2-009 | A25 | - |
Above result shows, milk cow is numbered in the bovine serum of 7-021 and contains reovirus, showing in the milk cows exists a spot of milk cow to carry Reovirus, confirmed that simultaneously the reovirus PCR kit for fluorescence quantitative can be successfully applied to the Reovirus epidemiology survey, the monitoring of bovine serum and bovine blood goods, good reproducibility, the CV value is all less than 1%.
Embodiment 3: the application of reovirus PCR kit for fluorescence quantitative in commercially available ox serum detection
A). test kit is formed:
A) test kit is composed as follows: (10 secondary response)
RNA extracting solution A (4ml/ pipe) RNA extracting solution B (800 μ l/ pipe)
Reverse transcription reaction liquid (90 μ l/ pipe) reversed transcriptive enzyme (10 μ l/ pipe)
RNA enzyme inhibitors (400U/ pipe)
Strong positive standard substance (100 times of accurate product 20 μ l/ pipes of dilution definite value, totally four pipes)
PCR reaction tubes (aseptic, no RNA enzyme and DNA enzyme) DEPC H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
Fluorescence quantitative PCR reaction solution (125 μ l/ pipe)
(RNA extracting solution A is an Invitrogen company product.B) reverse transcription reaction liquid, d) reversed transcriptive enzyme is available from Promega company, and g) fluorescence quantitative PCR reaction solution and RNA enzyme inhibitors (40U/ μ l) are available from TAKARA company.)
B). reverse transcription reaction liquid (the reaction cumulative volume is 25 μ l): by 5 * buffer solution, 5 μ l, the antisense primer RT of 10 μ mol/L (SEQ ID NO:2), 2.5 μ l, 10mM dNTPs1.5 μ l, each 1 μ l of reversed transcriptive enzyme and RNA enzyme inhibitors, the sterilization distilled water 9 μ l of no RNA enzyme and testing sample 5 μ l form; The fluorescent quantitation reaction solution is by 2 * buffer solution, 12.5 μ l, each 3 μ l of 10 μ mol/L sense primer FP (SEQ ID NO:1), antisense primer RT, 10 μ mol/L fluorescent probes, 0.75 μ l, sterilization distilled water 0.75 μ l, the cDNA of testing sample or standard substance are formed.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ IDNO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
C). reaction conditions is as follows: (employing two-step approach)
cDNA synthesis:70℃ 10min
0℃ 2min
0℃ pause
42℃ 50min
70℃ 10min
PCR: 95℃, 2min
94℃, 15s
60℃, 60s
40cycles
When each round-robin second EOS, carry out fluoroscopic examination.To Reovirus quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
D) experimental technique
1. cell cultures
1) African green monkey kidney cell line of Pei Yanging (Vero) shop system 12 orifice plates, 1ml/ hole, 50% degree of converging;
2) serum to be checked is formulated as 5% (volume ratio) concentration with MEM;
3) behind the cell attachment, be replaced by the substratum of serum preparation to be checked, the 1ml/ hole;
4) establish feminine gender and positive control simultaneously, positive control adds 5% (volume ratio) FBSMEM that contains REOVIRUS;
5) 37 ℃, 5% (volume ratio) CO
2Cultivate in the incubator, and observe the generation whether CPE is arranged.
6) behind the 72h, collecting cell, 2000rpm is centrifugal 5min is temporary in-80 ℃.All the other samples are handled with quadrat method.Extract total RNA of cell, as the template of RT.
2. the extraction of total RNA in the cell
Each sample adds RNA extracting solution A 400 μ l, and room temperature is placed 10min, adds RNA extracting solution B80 μ l, concuss 15s, and room temperature (20-25 ℃) is placed 2~3min; 4 ℃, the centrifugal 15min of 12000rpm gets supernatant 200 μ l, moves into a new EP pipe, adds Virahol 200 μ l again, leaves standstill 10min under the room temperature; 4 ℃, the centrifugal 15min of 12000rpm; Abandon supernatant, precipitation adds the cold ethanol 400 μ l of 75% (volume ratio), vortex, and 4 ℃, the centrifugal 5min of 7500rpm abandons supernatant and stays precipitation, leaves standstill 5~10min in room temperature and dries ethanol, adds 25 μ l DEPC water dissolution precipitation.
3. B is pressed in the reaction of reverse transcription reaction and quantitative fluorescent PCR), C) carry out shown in the step.(carry out once successively, carry out the quantitative fluorescent PCR reaction behind the reverse transcription).
E). experimental result
Above result shows that the serum of above lot number to be checked all shows as the reovirus feminine gender, shows that simultaneously this test kit can be used for detecting the virus of cell sample.
SEQUENCE LISTING
<110〉Wuhan Sanli Bio-Technology Co., Ltd.
<120〉a kind of PCR kit for fluorescence quantitative and application that detects reovirus
<130〉a kind of PCR kit for fluorescence quantitative and application that detects reovirus
<160>3
<170>PatentIn version 3.3
<210>1
<211>25
<212>DNA
<213〉synthetic
<400>1
TGCGCCTATCCTTGAGTTGA 20
<210>2
<211>21
<212>DNA
<213〉synthetic
<400>2
TTGCCAGGAAATACGGGTCT 20
<210>3
<211>23
<212>DNA
<213〉synthetic
<400>3
TCAAAATGGTGGACTTCAGTTTCGATTT 28
Claims (5)
1, a kind of PCR kit for fluorescence quantitative that detects reovirus, this test kit contains: a) RNA extract, b) reverse transcriptase reaction liquid, c) reversed transcriptive enzyme, d) RNA enzyme inhibitors, e) primer and TaqMan probe, f) standard positive dna profiling, g) fluorescence quantitative PCR reaction solution, it is characterized in that: primer sequence is respectively sense primer: 5 '-TGCGCCTATCCTTGAGTTGA-3 ', antisense primer: 5 '-TTGCCAGGAAATACGGGTCT-3 ', the amplicon size is 138bp, the fluorescent probe sequence is: 5 '-FAM-TCAAAATGGTGGACTTCAGTTTCGATTT-TAMRA-3 ', 5 ' end mark fluorescent emission group FAM of probe, 3 ' end mark fluorescent quenching group TAMRA, the standard positive dna profiling is by inserting the segmental pGEM-T carrier of reovirus S1 protein region 361bp transformed into escherichia coli DH5 α, plasmid is extracted in the propagation back, and surveys A in ultraviolet spectrophotometer
260Quantitative also 10 times of gradient dilutions.
2, a kind of PCR kit for fluorescence quantitative that detects reovirus according to claim 1 is characterized in that: described reverse transcription reaction liquid is made up of antisense primer, reversed transcriptive enzyme, RNA enzyme inhibitors, the 10mM dNTPs of 5 * buffer, 10 μ mol/L and the sterilization distilled water that do not have a RNA enzyme.
3, a kind of PCR kit for fluorescence quantitative that detects reovirus according to claim 1 is characterized in that: described fluorescence quantitative PCR reaction solution is made up of sense primer and antisense primer, 10 μ mol/L fluorescent probes and the aseptic double-distilled water of 2 * Premix, 10 μ mol/L.
4, a kind of PCR kit for fluorescence quantitative that detects reovirus according to claim 1, it is characterized in that: described standard positive template dna nucleotide sequence is:
TGCGCCTATCCTTGAGTTGATAGAATCAAACACAGTCGTCTTGAGAGTCA
AGTTATTATTAACTATCTGGAATTAATCAGTATTAAATCGAAACTGAAGTC
CACCATTTTGAATATTCAGACCCGTATTTCCTGGCAA。
5, the described a kind of application of PCR kit for fluorescence quantitative in the epidemiology survey of milk cattle infected reovirus that detects reovirus of claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100623961A CN101565757B (en) | 2009-06-02 | 2009-06-02 | Reovirus-detecting fluorescence quantitative PCR kit and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100623961A CN101565757B (en) | 2009-06-02 | 2009-06-02 | Reovirus-detecting fluorescence quantitative PCR kit and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101565757A true CN101565757A (en) | 2009-10-28 |
CN101565757B CN101565757B (en) | 2011-08-17 |
Family
ID=41282118
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100623961A Active CN101565757B (en) | 2009-06-02 | 2009-06-02 | Reovirus-detecting fluorescence quantitative PCR kit and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101565757B (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102337357A (en) * | 2011-11-02 | 2012-02-01 | 舒泰神(北京)生物制药股份有限公司 | Primers and probe for detecting mouse reovirus type III and method thereof |
CN103468828A (en) * | 2013-09-16 | 2013-12-25 | 上海卓润生物科技有限公司 | PCR (Polymerase Chain Reaction) method for simultaneously detecting four bovine infectious disease RNA (Ribose Nucleic Acid) viruses by single tube |
CN105219888A (en) * | 2015-11-12 | 2016-01-06 | 东北农业大学 | A kind of Xijiang River virus SYBR Green I fluorescent quantitative PCR detection method |
CN108411041A (en) * | 2018-05-22 | 2018-08-17 | 山东农业大学 | A kind of fluorescence quantitative RT-PCR kit of the novel avian reovirus of detection and application |
CN115927761A (en) * | 2022-12-22 | 2023-04-07 | 苏州药明检测检验有限责任公司 | Primer and probe for detecting reovirus type 3 and application thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1308461C (en) * | 2004-12-24 | 2007-04-04 | 武汉大学 | Fluorescence quantitative PCR kit for detecting virus of aftosa and application |
-
2009
- 2009-06-02 CN CN2009100623961A patent/CN101565757B/en active Active
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102337357A (en) * | 2011-11-02 | 2012-02-01 | 舒泰神(北京)生物制药股份有限公司 | Primers and probe for detecting mouse reovirus type III and method thereof |
CN102337357B (en) * | 2011-11-02 | 2014-02-19 | 舒泰神(北京)生物制药股份有限公司 | Primers and probe for detecting mouse reovirus type III and method thereof |
CN103468828A (en) * | 2013-09-16 | 2013-12-25 | 上海卓润生物科技有限公司 | PCR (Polymerase Chain Reaction) method for simultaneously detecting four bovine infectious disease RNA (Ribose Nucleic Acid) viruses by single tube |
CN105219888A (en) * | 2015-11-12 | 2016-01-06 | 东北农业大学 | A kind of Xijiang River virus SYBR Green I fluorescent quantitative PCR detection method |
CN108411041A (en) * | 2018-05-22 | 2018-08-17 | 山东农业大学 | A kind of fluorescence quantitative RT-PCR kit of the novel avian reovirus of detection and application |
CN108411041B (en) * | 2018-05-22 | 2021-11-30 | 山东农业大学 | Fluorescent quantitative RT-PCR kit for detecting novel chicken reovirus and application thereof |
CN115927761A (en) * | 2022-12-22 | 2023-04-07 | 苏州药明检测检验有限责任公司 | Primer and probe for detecting reovirus type 3 and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN101565757B (en) | 2011-08-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Vanittanakom et al. | Rapid identification of Penicillium marneffei by PCR-based detection of specific sequences on the rRNA gene | |
Wernike et al. | Development and validation of a triplex real-time PCR assay for the rapid detection and differentiation of wild-type and glycoprotein E-deleted vaccine strains of Bovine herpesvirus type 1 | |
CN105420412B (en) | Pig Delta coronavirus and Porcine epidemic diarrhea virus multiple RT-PCR detection primer and detection method | |
CN101565757B (en) | Reovirus-detecting fluorescence quantitative PCR kit and application thereof | |
CN1710101B (en) | Fluorescent quantitative DCR kit for detecting swine pseudo rabies virus and its use | |
CN102260749A (en) | H5, H7 and H9 subtype avian influenza virus detection kit | |
CN101565758B (en) | Rabies virus detecting fluorescence quantitative PCR kit and application thereof | |
Shen et al. | Development of a loop-mediated isothermal amplification method for the rapid detection of Pythium ultimum | |
CN108504778A (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
CN101560572B (en) | Fluorescence quantitative PCR kit for detecting calf diarrhea virus and application | |
CN102312017A (en) | Real-time reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for Coxsackie virus | |
CN1308461C (en) | Fluorescence quantitative PCR kit for detecting virus of aftosa and application | |
Gjøen et al. | Specific detection of Coxsackie viruses A by the polymerase chain reaction | |
Zhang et al. | A novel, rapid, and simple PMA-qPCR method for detection and counting of viable Brucella organisms | |
Sidoti et al. | Development of real time RT-PCR assays for detection of type A influenza virus and for subtyping of avian H5 and H7 hemagglutinin subtypes | |
CN101565760B (en) | Bovine parainfluenza type-3 virus detecting fluorescence quantitative PCR kit and application thereof | |
Qi et al. | Development and application of a TaqMan-based real-time PCR method for the detection of the ASFV MGF505-7R gene | |
CN108048600A (en) | A kind of fluorescent quantitative PCR detection method of infectious bovine rhinotrachetis virus | |
CN101560573B (en) | Fluorescence quantitative PCR kit for detecting type-3 cow adenovirus | |
CN102634605A (en) | Method for detecting egg drop syndrome viruses and kit for method | |
CN104611420A (en) | Tubercle bacillus detection kit | |
CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
CN105925729A (en) | Primer, probe, kit and method for fluorogenic quantitative PCR detection on pig delta coronavirus | |
CN104975077B (en) | Pig source eperythrozoon fluorescent quantificationally PCR detecting kit and its application | |
NL2031088B1 (en) | Locked Nucleic Acid-modified One-step Nested PCR Primers Set and Kit for African Swine Fever Virus |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |