CN101560576A - Specific probe for identifying HBV genotype and method and kit for detecting HBV genotype by using specific probe - Google Patents

Abstract

The invention relates to a specific probe for identifying HBV genotype, which has nucleotide sequence expressed as SEQ ID NO: 1-8 or at least one of complementary nucleotide sequences thereof. The invention further provides a method and kit for identifying HBV genotype, and the kit comprises the specific probe. The invention can identify eight kinds of genotypes (A-H) for HBV; and devices are designed according to the types. Technically, compared with the traditional method, the process is simpler, the operation is more simple and convenient, and the using time is shorter; meanwhile, the sensitivity is higher, and the pollution interference can be greatly reduced; the method in the invention overcomes the shortage of specificity in similar invention, thereby having obvious type variability and practical operability. The kit is economical and suitable for popularization.

Description

Identify the genotypic specific probe of HBV and use it to detect the genotypic method of HBV, test kit

Technical field

The present invention relates to a kind of specific probe, and, utilize the fluorescence PCR multicenter technology, identify the genotypic method of HBV, test kit by specificity combination probe.

Background technology

For many years, lot of domestic and foreign researchist has carried out genome sequencing to all parts of the world HBV, and by sequential analysis research, clear and definite HBV has 8 kinds of genotype (A-H).Show that according to WHO latest information in 2008 about 2,000,000,000 people in the whole world infect HBV, wherein nearly 400,000,000 is chronic hepatitis, annual death toll about 600,000.2/3 quantity is in the area, Asia, and wherein CHINESE REGION HBV also has small part A, D type based on B, C type or BC mixed type.

HBV not only has the characteristics of areal distribution, simultaneously to the generation of disease with develop influential.At present, by clinical lateral comparison, check analysis and prognosis research, confirm that the C genotype causes serious hepatitis than the B genotype is easier.And the seroconversion situation from HBeAg to anti-HBe is difference to some extent also.The B genotype will be significantly higher than the C genotype in precore terminator sudden change probability, and the seroconversion of anti-HBe more early occurs, and report is arranged recently, and the HBV of different genotype causes the probability of liver cancer that difference is also arranged.Therefore, HBV is carried out gene type not only help the virus evolution Study on Variation, epidemiology survey has positive effect, also to disease treatment and the assessment that lapses to, and the following treatment plan and tactful with practical value of formulating.

At present, the laboratory method of HBV gene type is mainly included: 1) PCR product restriction fragment length polymorphism is analyzed, and is simple relatively, but shortcoming one be possible enzyme cut imperfect, the 2nd, variation is disturbed big, the consistence of spectral pattern is bad, influence result's judgement.2) PCR micro flow chip technology for detection HBV gene type, polymorphic chip enzyme connection analyzing gene somatotype or the like, but aforesaid method, technical sophistication, experiment flow is long.3) though the Microarray chip can high-throughput, detect somatotype comparatively exactly, for the HBV somatotype, structural system is just too big, uneconomical, also need not.4) genome sequencing, though the fine somatotype of energy, the machine costliness, the cost height, the technical requirements height, practicality is not good, popularizes limited.

Compare, real-time fluorescence PCR is more suitable for the HBV gene type.Real-time fluorescence PCR in invention in 1996, by detecting the total accumulation of each cycle P CR product, by fluorized marking (mainly being hydrolysis probes), reaches good quantitative result by u.s.a. applied biosystem company (AppliedBiosystems).Because this technology has very strong specificity and sensitivity, effectively solves the characteristics such as pollution problem, level of automation height of conventional P CR, therefore, is widely used in the detection of Clinical microorganism.Along with technical development, comprise that many companies such as ABI, Bio-rad, Roche have all produced hyperchannel/multicolor fluorescence PCR detector in succession, can be in the reaction system, the fluorescence of different wave length is distinguished.So just can identify the genotype of To Template so that specific probe is in an individual system between different shaped.

Utilize the hyperchannel fluorescent PCR to identify the genotypic key of HBV, choose suitable specificity site exactly and make up probe.Because probe length limited (general 25-35bp is good), and the genomic variability of HBV is very big, if can not select specificity site between significant type well, or the specificity number of sites quantity not sufficient of selecting, or the present position in probe in specificity site is improper, all effective somatotype.There is similar invention just to have such defective, and can not reaches the purpose of evaluation well.

Gene overlap the longest is arranged on the HBV genome, it is exactly big S zone, the sudden change of any one position can influence the coding of two genes simultaneously, therefore, the probability that produces lethal mutation is very big, and these sudden changes just are difficult to be retained, also be to say, this zone is conservative relatively than other zone, so it is just more meaningful that this regional specificity site is used for somatotype.

Summary of the invention

The objective of the invention is to overcome the deficiency of existing above-mentioned technology, work out high specific combination probe between a kind of employing type, utilize hyperchannel fluorescent PCR technology, identify the genotypic method of HBV quickly and efficiently.

The genotypic specific probe of evaluation HBV of the present invention, it has at least a (the comprising: these sequences of indivedual base differences that the hot spot sudden change causes) in the nucleotide sequence shown in the SEQ ID NO:1-8 or its complementary nucleotide sequence.

In the preferred embodiments of the present invention, the above-mentioned genotypic specific probe of evaluation HBV has the nucleotide sequence shown in the SEQ IDNO:1-8.

In the preferred embodiments of the present invention, the genotypic specific probe of above-mentioned evaluation HBV comes from the big S overlapping genes regional sequence in the HBV genome, is positioned among the amplification region of primer shown in the SEQ ID NO:9-10.

The present invention also provides a kind of evaluation HBV genotypic method, and it mainly comprises step:

A. prepare primer shown in the SEQ ID NO:9-10 and the above-mentioned genotypic specific probe of evaluation HBV;

B. extract pcr template;

C. each sample to be tested is put into the fluorescent PCR instrument, and carry out the fluorescent PCR reaction after gained primer, specific probe and template are mixed among a and the b;

D. the HBV genotype of each sample to be tested is determined in interpretation as a result.

Wherein, when carrying out the fluorescent PCR reaction among the step c, a position of specific probe described in the step a is that fluorophor is modified, and the another location is the quenching group modification; The various combinations of perhaps different fluorescence or quenching group.

Wherein, the steps d wavelength of fluorescence that is included in the label probe correspondence carries out fluoroscopic examination.

The present invention also provides the genotypic test kit of a kind of HBV of evaluation, and it comprises above-mentioned genotypic specific probe of evaluation HBV and above-mentioned primer; Usage quantity is 10 μ M, and the two mark probes of specificity fluorescent packing separately between the HBV type, but arbitrary combination during use.

It can also comprise extracting solution and the reaction solution of HBV DNA further.

Wherein, the extracting solution of HBV DNA comprises: I liquid: the NaCl final concentration is 0.5mol/L, 10% (w/w) PEG6000; II liquid: 5% (w/v) Chelex-100 lysate; Reaction solution comprises: 0.1U/ μ l Taq polysaccharase, 500 μ M dNTP each, 20 μ M Tris-HCl, 100mM KCl, 3mM MgCl ₂, 0.004U/ μ lUNG enzyme, ddH ₂O.

The present invention can identify that the somatotype design is complete to eight kinds of genotype (A-H) of HBV.Technical, than traditional method, flow process is simple, and is easy and simple to handle, and the time spent is short; Simultaneously, susceptibility is higher, reduces greatly to pollute and disturbs; In theory, and the analysis of biological information result, the inventive method remedies the insufficient characteristics of specificity in the similar invention, thereby possesses significant type differences degree and actual operability.This test kit expense economy is convenient to promote, and helps relevant units at different levels and uses.

For above and other objects of the present invention, feature and advantage can be become apparent, preferred embodiment cited below particularly, and conjunction with figs. are described in detail below.

Description of drawings

Fig. 1, the two mark probes (5 ' FAM---3 ' TAMRA) of B genotype and two mark probe (5 ' Cy3---3 ' TAMRA) the combine detection HBV genotype of C genotype, the result shows: B2, B3, C2, C3, C5 sample have amplification in the 490nm absorbing wavelength, confirm that these samples are the B genotype;

Fig. 2, the two mark probes (5 ' FAM---3 ' TAMR) of B genotype and two mark probe (5 ' Cy3---3 ' TAMRA) the combine detection HBV genotype of C genotype, the result shows: B2, B3, C2, C3, C5 sample confirm simultaneously that in the not amplification of 530nm absorbing wavelength these samples are not the C genotype;

Fig. 3, the two mark probes (5 ' FAM---3 ' TAMRA) of B genotype and two mark probe (5 ' Cy3---3 ' TAMRA) the combine detection HBV genotype of C genotype; The result shows: B4, B5, C1, C4 sample have amplification in the 530nm absorbing wavelength, confirm that these samples are the C genotype;

Fig. 4, the two mark probes (5 ' FAM---3 ' TAMRA) of B genotype and two mark probe (5 ' Cy3---3 ' TAMRA) the combine detection HBV genotype of C genotype; The result shows: B4, B5, C1, C4 sample confirm simultaneously that in the not amplification of 490nm absorbing wavelength these samples are not the B genotype.

Embodiment

Be example only below, further specify present method, and should not be considered as limitation of the present invention with CHINESE REGION HBV cdna sample.

Technical scheme

Specificity combination probe is identified the genotypic method of HBV

1. technological step:

The first step is obtained the HBV genomic dna

Get the HBV infected patient, add 10% (w/w) PEG6000 concussion mixing, the centrifugal supernatant of abandoning adds 5% (w/v) Chelex-100 again, boils 10 minutes, and is centrifugal, gets supernatant liquor as pcr template.

In second step, utilize between type specific probe to set up the PCR reaction system

The genotypic fluorescent PCR reaction system of above-mentioned evaluation HBV comprises: Taq polysaccharase, dNTP each, Tris-HCl, KCl, MgCl ₂, UNG enzyme, the non-specific primer of HBV, specificity hydrolysis probes, ddH ₂O, HBV genomic dna template.

The 3rd step, the quantitative fluorescent PCR reaction, amplification condition is:

95 ℃ 5 minutes

72 ℃ 30 seconds

The 4th step, the result judges: after the specific probe consistent with virogene type is hydrolyzed in the PCR process, send the fluorescence of respective wavelength, and accumulated by PCR circulation fluorescence volume, after the PCR reaction finishes, can determine genotype and amount (comprising single or mixed type) thereof by the wavelength of fluorescence and the CT value of corresponding probe.Because virus genomic variation can take place at any time, so, may have false-negative appearance, but this method is theoretically, may be reduced to minimum with this.

2. primer and probe

This law is identified the genotype of HBV, and its core technology has just provided probe between the type of one group of high specific.Its source is that we use bioinformatics technique, analysis is from area, the continent 120 routine hepatitis B virus sequence samples of 913 HBV whole genome sequences among the Genbank and the order-checking acquisition of this seminar, obtain about 1030 HBV genome sequences altogether (wherein, A type 131 examples, Type B 290 examples, C type 389 examples,, D type 93 examples, E type 66 examples,, F type 43 examples, G type 13 examples, H type 8 examples), emphatically gene overlap---the S zone is a target sequence with maximum in the HBV genome, designs a pair of HBV non-specific (general) primer (upstream primer: GGTCACCATATTCTTGGGAACA; Downstream primer: ACTGCATGGCCTGAGGATG) carry out the product amplification, and with specific probe between this zone design type.Selection combination by these specific probes utilizes real time fluorescence quantifying PCR method, just can arrive the genotypic purpose of Rapid identification HBV.

Various specific probe be listed as follows (between type average specific site number up to 7.3/26.5bp):

Because self variation characteristic of virus, above-mentioned probe also may have point mutation to take place, but should the zone remain best somatotype sequence, 80% homologous sequence and complementary strand thereof all do not change the substance of invention scheme with it, so be subjected to rights protection equally.

3. probe preparation

Above-mentioned probe participates in the fluorescent PCR reaction with the hydrolysis probes form, and promptly probe position is that fluorophor is modified, and the another location is the quenching group modification.Under the 5 prime excision enzyme activity effect of polysaccharase, will downcut with the base of template specificity bonded probe, fluorophor is separated and luminous with quenching group; And other irrelevant probe does not combine with template, and PCR reaction process middle probe is not hydrolyzed and is not luminous.

4. probe operation instruction: one, the maximum absorption wavelength of each fluorescence probe group requires different just being convenient to screen in the reaction system, and the characteristic of the selection of fluorophor and fluorescent PCR instrument and require relevantly generally is not subjected to other special restriction.Two, in a reaction system, the classification of probe is less than the sense channel number of fluorescent PCR instrument.Three, fluorescent probe can be selected all or part ofly from above-mentioned tabulation, puts into an individual system and reacts.If limited to by the port number of some old-fashioned fluorescent PCR instrument, can in a plurality of reactions, implement, also can adopt maximum suspicious several probes in a reaction, to screen earlier according to HBV areal distribution characteristics.

The preparation (synthetic) of embodiment one primer, fluorescent probe

Upstream primer 5 ' GGTCACCATATTCTTGGGAACA 3 ' (2OD)

Downstream primer 5 ' ACTGCATGGCCTGAGGATG 3 ' (2OD)

The Type B probe adopts two mark 5 ' FAM---3 ' TAMRA (2OD)

CTCAACCCGCACAAGGACAACTGGCCGGAC

C type probe adopts two mark 5 ' Cy3---3 ' TAMRA (2OD)

TCACTGGCCAGAGGCAAATCAGGTAGGAGCG

Embodiment two template extraction and reaction system

(1) template extraction

I liquid: the NaCl final concentration is 0.5mol/L, 10% (w/w) PEG6000.

II liquid: 5% (w/v) Chelex-100.

Operation steps: get 100 μ l human serums, add 100 μ l " I liquid " concussion mixing, centrifugal 13000r/min, 10 minutes, supernatant is abandoned in suction, adds 25 μ l " II liquid " again, boils 10 minutes, centrifugal 13000r/min 10 minutes, gets 5 μ l supernatant liquors as pcr template.

(2) PCR reaction system

Reaction of embodiment three fluorescent PCRs and detection

By above-mentioned reaction system, each sample is put into fluorescent PCR instrument (Bio-rad IQ cycler) select two channels to detect, use 490nm (FAM) and 530nm (Cy3) wavelength to detect respectively, amplification condition is as follows:

95 ℃ 5 minutes

72 ℃ 30 seconds

B genotype positive control is the B genotype dna sample of order-checking conclusive evidence, and C genotype positive control is the C genotype dna sample of order-checking conclusive evidence.

The result judges:

The data that composite analyser detects, set rational baseline and threshold value, observe two kinds of amplified fluorescence curves in the sample to be tested, calculate the Ct value, by standard substance, extrapolate the copy number that two kinds of fluorescent probes reflect respectively, in the fluorescent PCR identification reaction of nine following routine positive sample, five examples are pure B genotype, and four examples are pure C genotype in addition.Shown in Fig. 1-4, wherein, Fig. 1, the two mark probes (5 ' FAM---3 ' TAMRA) of B genotype and two mark probe (5 ' Cy3---3 ' TAMRA) the combine detection HBV genotype of C genotype, the result shows: B2, B3, C2, C3, C5 sample have amplification in the 490nm absorbing wavelength, confirm that these samples are the B genotype; Fig. 2, the two mark probes (5 ' FAM---3 ' TAMRA) of B genotype and two mark probe (5 ' Cy3---3 ' TAMRA) the combine detection HBV genotype of C genotype, the result shows: B2, B3, C2, C3, C5 sample confirm simultaneously that in the not amplification of 530nm absorbing wavelength these samples are not the C genotype; Fig. 3, the two mark probes (5 ' FAM---3 ' TAMRA) of B genotype and two mark probe (5 ' Cy3---3 ' TAMRA) the combine detection HBV genotype of C genotype; The result shows: B4, B5, C1, C4 sample have amplification in the 5300nm absorbing wavelength, confirm that these samples are the C genotype; Fig. 4, the two mark probes (5 ' FAM---3 ' TAMRA) of B genotype and two mark probe (5 ' Cy3---3 ' TAMRA) the combine detection HBV genotype of C genotype; The result shows: B4, B5, C1, C4 sample confirm simultaneously that in the not amplification of 490nm absorbing wavelength these samples are not the B genotype.

Sequence table

＜110〉The First Affiliated Hospital of Third Military Medical University of PLA

＜120〉identify the genotypic specific probe of HBV and use it to detect the genotypic method of HBV, test kit

<130>

<160>10

<170>PatentIn?version?3.3

<210>1

<211>24

<212>DNA

＜213〉specific probe

<400>1

catcaaaacc?tcgcaaaggc?atgg 24

<210>2

<211>30

<212>DNA

＜213〉specific probe

<400>2

ctcaacccgc?acaaggacaa?ctggccggac 30

<210>3

<211>31

<212>DNA

＜213〉specific probe

<400>3

tcactggcca?gaggcaaatc?aggtaggagc?g 31

<210>4

<211>20

<212>DNA

＜213〉specific probe

<400>4

tgggattcac?cccaccgcac 20

<210>5

<211>30

<212>DNA

＜213〉specific probe

<400>5

cacaatccca?acaaagacca?ctggacagaa 30

<210>6

<211>21

<212>DNA

＜213〉specific probe

<400>6

cggtccggga?gaaagccaac?c 21

<210>7

<211>26

<212>DNA

＜213〉specific probe

<400>7

cctatggacc?cgggttcacc?cctcca 26

<210>8

<211>30

<212>DNA

＜213〉specific probe

<400>8

aattggccaa?tggcaaacaa?ggtaggagtg 30

<210>9

<211>22

<212>DNA

＜213〉upstream primer

<400>9

ggtcaccata?ttcttgggaa?ca 22

<210>10

<211>19

<212>DNA

＜213〉downstream primer

<400>10

actgcatggc?ctgaggatg 19

Claims (10)

1. identify the genotypic specific probe of HBV for one kind, it is characterized in that having at least a in the nucleotide sequence shown in the SEQ ID NO:1-8 or its complementary nucleotide sequence.

2. the genotypic specific probe of evaluation HBV according to claim 1 is characterized in that having the nucleotide sequence shown in the SEQ ID NO:1-8.

3. the genotypic specific probe of evaluation HBV according to claim 1 is characterized in that probe comes from the big S overlapping genes regional sequence in the HBV genome, is positioned among the amplification region of primer shown in the SEQ ID NO:9-10.

4. identify the genotypic method of HBV for one kind, it is characterized in that comprising step:

A. prepare primer shown in the SEQ ID NO:9-10 and the described specific probe of claim 1;

B. extract pcr template;

C. each sample to be tested is put into the fluorescent PCR instrument, and carry out the fluorescent PCR reaction after gained primer, specific probe and template are mixed among a and the b;

D. the HBV genotype of each sample to be tested is determined in interpretation as a result.

5. method according to claim 4, when it is characterized in that carrying out among the step c fluorescent PCR reaction, a position of specific probe described in the step a is that fluorophor is modified, and the another location is the quenching group modification; The various combinations of perhaps different fluorescence or quenching group.

6. method according to claim 4 is characterized in that steps d comprises that the wavelength at probe mark fluorescence correspondence carries out the real-time fluorescence detection.

7. a genotypic test kit of identifying HBV is characterized in that comprising the described specific probe of claim 1.

8. test kit according to claim 7 is characterized in that also comprising the described primer of claim 3.

9. according to claim 7 or 8 described test kits, it is characterized in that also comprising extracting solution and the reaction solution of HBV DNA.

10. test kit according to claim 9, it is characterized in that the extracting solution of described HBV DNA comprises: I liquid: the NaCl final concentration is 0.5mol/L, 10% (w/w) PEG6000; II liquid: 5% (w/v) Chelex-100 lysate; Reaction solution comprises: 0.1U/ μ l Taq polysaccharase, 500 μ M dNTP each, 20 μ M Tris-HCl, 100mM KCl, 3mM MgCl ₂, 0.004U/ μ l UNG enzyme, ddH ₂O.

Images