CN101545004B - Waxy maize inbred line Shen-W22 specific molecular marker and application thereof in offspring variety identification - Google Patents
Waxy maize inbred line Shen-W22 specific molecular marker and application thereof in offspring variety identification Download PDFInfo
- Publication number
- CN101545004B CN101545004B CN2008100353027A CN200810035302A CN101545004B CN 101545004 B CN101545004 B CN 101545004B CN 2008100353027 A CN2008100353027 A CN 2008100353027A CN 200810035302 A CN200810035302 A CN 200810035302A CN 101545004 B CN101545004 B CN 101545004B
- Authority
- CN
- China
- Prior art keywords
- seq
- shen
- primer
- glutinous
- self
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for performing waxy maize variety identification and seed purity inspection by using a parent strain specific SSR marker with high combining ability. The method uses 60 portions of maize genome DNA including waxy maize inbred line Shen-W22 and close relative sister lines, offspring, non-near-source waxy maize, grain maize, sweet maize, and the like as templates, establishes a Shen-W22 specific fingerprint map by performing PCR amplification combined PAGE gel electrophoresis analysis on a covering full genome 250 and SSR primers, and successfully obtains 14 pairs of SSR primers with high specificity and strong dominance in filial generations. By applying the 14 pairs of the SSR primers and according to the Shen-W22 specific fingerprint map, the variety identification and the seed purity inspection of the Shen-W22 offspring can be performed. Through random group identifications of Huyunuo No.2 and Huyunuo No.3 which are raised by using the Shen-W22 as a male parent, the identification result accords with that of field identification.
Description
Technical field
The invention belongs to biological technical field, be specifically related to Glutinous Semen Maydis self-mating system Shen W22 (national kind power number: CNA20010096.3) 14 of the high special inheritance stability pairs of SSR labeled primers and whether be offspring's kind of Glutinous Semen Maydis Shen W22 and judge the application in its seed purity at the identified unknown sample.
Background technology
The evaluation of germ plasm resource and purity test are all extremely important for agriculture prodn and scientific research breeding, and it is all very difficult as a rule to distinguish germ plasm resource according to economical character.Therefore dna molecular marker provides species basic hereditary feature, is the direct reflection of different plant species heritable variation, becomes germ plasm resource and identifies effective way.At present, there are 5 kinds of common molecular marking techniques to be applied to cultivar identification, comprise RAPD, RFLP, AFLP, SSR, SCAR mark.
The shortcoming of RFLP (restriction enzyme digestion length polymorphism) marking method is that experimental implementation is more loaded down with trivial details, and sense cycle is long.The polymorphum that RAPD (randomly amplified polymorphic DNA) technology produces is medium, and repeatability is relatively poor.AFLP (AFLP) is though polymorphum is high, and stability is good inadequately.SCAR (sequence specific amplification region) mark is on the basis of RAPD technology, to grow up, and is though good reproducibility can only be identified the minority site, therefore better with the application in the mapping in the assignment of genes gene mapping.
SSR (simple sequence repeat) is called simple sequence to be repeated; Claim microsatellite DNA again; Be a kind of be the tandem repetitive sequence that reaches tens Nucleotide that repeating unit forms by 2-6 Nucleotide; It is distributed widely in the eukaryotic gene group, does not exist only in genome Tumor-necrosis factor glycoproteins zone, also is present in the regulatory region of encoding sox.Because the repeating unit number is incomplete same, thereby form polymorphum; And mostly it other adjacent is the sequence guarded if being, can carry out pcr amplification through design specific primers.The SSR mark has that quantity is abundant, polymorphum is high, be codominance in the heredity, amplified fragments is stablized accurate characteristics, in conjunction with SSR polymorphum and clip size thereof, just can set up the standard diagram of each kind, with differential variety.Mutually recently, the advantage that the existing RAPD of SSR is simple, quick, economic has the high advantage of AFLP polymorphum again, has overcome the shortcoming of RAPD and AFLP poor repeatability simultaneously.
The corn gene group comprises 24-27 hundred million bases, and close with the human genome size, as to be about rice genome 6-7 doubly.The full genome of corn about 80% is made up of Tumor-necrosis factor glycoproteins, accounts for 7.5% complete genomic encoding sox shape such as island and is dispersed in the marine greatly of long end repetition (LTR, long terminal repeat)-retrotransposon class Tumor-necrosis factor glycoproteins.The characteristics of corn gene group make that utilizing the SSR technology to become carries out the effective means that maize genotype is identified.
The Glutinous Semen Maydis self-mating system Shen W22 that the academy of agricultural sciences, Shanghai breeds had characteristics such as high-quality, glutinous property quality better, precocious proterties inheritance stability, combining ability height, obtained national kind power in 2003, and kind power code name is CNA20010096.3.With Shen W22 is beautiful glutinous No. of Shanghai of breeding of male parent, be China behind Suyunuo No.1 second national authorization eat crossbreeded glutiuous maize raw.Subsequently, be that male parent is bred two more fine glutinous corn varieties with Shen W22 again: beautiful glutinous No. two of precocious white Glutinous Semen Maydis Shanghai, beautiful glutinous No. three kinds in big fringe high yield and high quality white Glutinous Semen Maydis Shanghai.These two kinds are all authorized through the Shanghai City kind council, and suitable the south of the lower reaches of the Yangtze River spring and autumn is cultivated as eating Glutinous Semen Maydis raw, or suitable regional as high yield waxy starch Maize Production, are the current kinds of promoting mainly.Statistics in 2007; With Shen W22 is beautiful glutinous No. one, No. two, No. three of the Glutinous Semen Maydis new variety Shanghai of male parent assembly; Popularizing planting has spread all over more than 20 province of China mainland (city, autonomous region); Accumulative total is promoted and is reached 500,000 mu, and the newly-increased income of peasant reaches more than 300,000,000 yuan, has produced significant social, economy and ecological benefits.Therefore, based on Molecular Identification and the purity test of the specific DNA fingerprint of Shen W22, has significant application value for real work and the interest protection of producing grower and breeding scientist to Shen W22 and offspring's kind thereof.
The present invention obtain on to the basis that covers 250 pairs of SSR primer screenings of the full genome of corn SW22 can produce special stable polymorphum, banding pattern combination be easy to discern, thereafter for 14 pairs of good SSR primers of dominance, use these 14 pairs of primers and can successfully identify Shen W22 and filial generation glutinous corn variety thereof.
Summary of the invention
Therefore; One aspect of the present invention provides a kind of glutinous corn variety to identify or the test kit of seed purity check that it is right to the primer that is described below that said test kit contains 4-14: SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ IDNO:5 and 6, SEQ ID NO:7 and 8, SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ IDNO:13 and 14, SEQ ID NO:15 and 16, SEQ ID NO:17 and 18, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22, SEQ ID NO:23 and 24, SEQ ID NO:25 and 26 and SEQ ID NO:27 and 28.
In a preferred embodiment, said test kit comprises that following primer is right: SEQ ID NO:3 and 4, SEQ IDNO:19 and 20, SEQ ID NO:21 and 22 and SEQ ID NO:27 and 28.In another preferred embodiment, said test kit comprises that also following primer is right: SEQ ID NO:11 and 12, SEQ ID NO:13 and 14 and SEQ ID NO:17 and 18.In preferred embodiment, said test kit also comprises SEQ ID NO:7 and 8, SEQ ID NO:9 and 10 and SEQ ID NO:23 and 24.In most preferred embodiment, said test kit comprises that said all 14 pairs of primers are right.
Also can comprise the required all ingredients of extracting sample DNA in the test kit, be used to carry out all ingredients of pcr amplification and carry out the required all ingredients of PAGE electrophoresis.These reagent are that those skilled in the art are known.Test kit also can comprise the specification sheets that instructs this test kit of use to detect.
On the other hand, whether the present invention also provides a kind of glutinous corn variety of identifying is the Glutinous Semen Maydis self-mating system Shen W22 or the method in generation thereafter, and this method comprises:
(1) DNA of extracting Glutinous Semen Maydis sample;
(2) with 4-14 to be selected from down the group primer to extractive DNA is carried out pcr amplification; Obtain amplified production, said primer is to being selected from: SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ ID NO:5 and 6, SEQ IDNO:7 and 8, SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ ID NO:13 and 14, SEQ IDNO:15 and 16, SEQ ID NO:17 and 18, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22, SEQ ID NO:23 and 24, SEQ ID NO:25 and 26 and SEQ ID NO:27 and 28;
(3) amplified production in the step (3) is carried out the PAGE electrophoresis; With
(4) gained electrophoresis result and the electrophoresis result of using said primer to amplification self-mating system Shen W22 gained are compared; Confirm whether said sample contains the consistent fingerprint with self-mating system Shen W22, thereby identify that whether glutinous corn variety is Glutinous Semen Maydis self-mating system Shen W22 or generation thereafter.
In a preferred embodiment, use following primer to carrying out pcr amplification: SEQ ID NO:3 and 4, SEQID NO:19 and 20, SEQ ID NO:21 and 22 and SEQ ID NO:27 and 28.In another preferred embodiment, also further use following primer: SEQ ID NO:11 and 12, SEQ ID NO:13 and 14 and SEQ ID NO:17 and 18 to increasing.In preferred embodiment, further use following primer right: SEQ ID NO:7 and 8, SEQ ID NO:9 and 10 and SEQ ID NO:23 and 24 increase.
In a concrete embodiment, use SEQ ID NO:3 and 4, SEQ ID NO:19 and 20, SEQ IDNO:21 and 22 and SEQ ID NO:27 and 28 increase, if qualification result is negative, can decision making; If positive, further with SEQ ID NO:11 and 12, SEQ ID NO:13 and 14 and SEQ ID NO:17 and 18 increase, negative as if qualification result, can decision making; If positive, further with SEQ ID NO:7 and 8, SEQID NO:9 and 10 and SEQ ID NO:23 and 24 increase, negative as if qualification result, can decision making; If positive, then use other remaining primer to increasing, and make judgement.
In addition, preferred embodiment of the present invention comprises that also in abovementioned steps (4) afterwards, implementation step (5): combination to the cooperation parent Shen W13 of the Shen W22 of acquisition and the finger printing of W48, is differentiated the Hybrid title with said primer.
Again on the one hand, the present invention also provides a kind of and checks Glutinous Semen Maydis self-mating system Shen W22 or thereafter for the method for seed purity, this method comprises:
(1) DNA of extracting Glutinous Semen Maydis seed;
(2) with 4-14 to be selected from down the group primer to extractive DNA is carried out pcr amplification; Obtain amplified production, said primer is to being selected from: SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ ID NO:5 and 6, SEQ IDNO:7 and 8, SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ ID NO:13 and 14, SEQ IDNO:15 and 16, SEQ ID NO:17 and 18, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22, SEQ ID NO:23 and 24, SEQ ID NO:25 and 26 and SEQ ID NO:27 and 28;
(3) amplified production in the step (3) is carried out the PAGE electrophoresis; With
(4) gained electrophoresis result and the electrophoresis result of using said primer to amplification self-mating system Shen W22 gained are compared; Confirm whether said sample contains the consistent fingerprint with self-mating system Shen W22, thereby identify that whether the Glutinous Semen Maydis seed is the Glutinous Semen Maydis self-mating system Shen W22 or the seed in generation thereafter; With
(5) be accredited as Glutinous Semen Maydis self-mating system Shen W22 or thereafter the seed amount in generation calculate seed purity divided by total test seed amount.
In a preferred embodiment, use following primer to carrying out pcr amplification: SEQ ID NO:3 and 4, SEQID NO:19 and 20, SEQ ID NO:21 and 22 and SEQ ID NO:27 and 28.In another preferred embodiment, also further use following primer right: SEQ ID NO:11 and 12, SEQ ID NO:13 and 14 and SEQ ID NO:17 and 18.In preferred embodiment, further use following primer right: SEQ ID NO:7 and 8, SEQ ID NO:9 and 10 and SEQ ID NO:23 and 24.
In a concrete embodiment, use SEQ ID NO:3 and 4, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22 and SEQ ID NO:27 and 28 increase, if qualification result is negative, can decision making; If positive, further with SEQ ID NO:11 and 12, SEQ ID NO:13 and 14 and SEQ ID NO:17 and 18 increase, negative as if qualification result, can decision making; If positive, further with SEQ ID NO:7 and 8, SEQID NO:9 and 10 and SEQ ID NO:23 and 24 increase, negative as if qualification result, can decision making; If positive, then use other remaining primer to increasing, and make judgement.
Another aspect of the invention also provides following primer to differentiating that whether glutinous corn variety is Glutinous Semen Maydis self-mating system Shen W22, it cooperates parent or generation thereafter, or check Glutinous Semen Maydis self-mating system Shen W22, it cooperates parent or thereafter for the purposes in the seed purity: SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ ID NO:5 and 6, SEQ IDNO:7 and 8, SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ ID NO:13 and 14, SEQ IDNO:15 and 16, SEQ ID NO:17 and 18, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22, SEQ ID NO:23 and 24, SEQ ID NO:25 and 26 and SEQ ID NO:27 and 28;
The present invention also provides following primer right: SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ ID NO:5 and 6, SEQ ID NO:7 and 8, SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ ID NO:13 and 14, SEQ ID NO:15 and 16, SEQ ID NO:17 and 18, SEQ ID NO:19 and 20, SEQ IDNO:21 and 22, SEQ ID NO:23 and 24, SEQ ID NO:25 and 26 and SEQ ID NO:27 and 28.
Description of drawings
The special SSR labeled primer of accompanying drawing 1 demonstration Shen W22 SW22-1 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 2 demonstration Shen W22 SW22-2 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 3 demonstration Shen W22 SW22-3 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 4 demonstration Shen W22 SW22-4 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 5 demonstration Shen W22 SW22-5 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 6 demonstration Shen W22 SW22-6 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 7 demonstration Shen W22 SW22-7 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is first W22; M is DL2000marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 8 demonstration Shen W22 SW22-8 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000 marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 9 demonstration Shen W22 SW22-9 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000 marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 10 demonstration Shen W22 SW22-10 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000 marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 11 demonstration Shen W22 SW22-11 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000 marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 12 demonstration Shen W22 SW22-12 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000 marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 13 demonstration Shen W22 SW22-13 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000 marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The special SSR labeled primer of accompanying drawing 14 demonstration Shen W22 SW22-14 amplified production PAGE electrophoretogram, wherein, sample number into spectrum is seen table 1, sample 1 is Shen W22; M is DL2000 marker (being followed successively by 2000-1000-750-500-250-100bp from the top down); 0 is negative contrast.
The positive kind of accompanying drawing 15 demonstration Shen W22 offsprings is with SW22-1-14 primer qualification result figure, and wherein, 1 representative Shen W22,16 representative Shen W13,26 representative Shen W48, H2 and H3 refer to beautiful glutinous No. two, No. three positive kinds in Shanghai.
Accompanying drawing 16 shows the flow process of using the special SSR fingerprint identification Shen W22 of Shen W22 and offspring's kind thereof.
Embodiment
In order to carry out the quick identity authentication of Shen W22 and offspring's kind thereof, the applicant is devoted to full genome range and screens special SSR mark fingerprint, has successfully obtained to differentiate Shen W22 and offspring's thereof high special, the SSR finger printing of genetic stability.According to these collection of illustrative plates, only need use and intersperse among complete genomic 14 pairs of special SSR primers, carry out pcr amplification to sample DNA, after PAGE electrophoresis (polyacrylamide gel electrophoresis) analyzes, whether can differentiate Shen W22 strain Glutinous Semen Maydis fast.In conjunction with sampling Detection, go back decidable Shen W22 Glutinous Semen Maydis seed purity.
The invention process can be summed up and be the schema shown in the accompanying drawing 16.
Specifically; At first; From corn gene group database website (www.maizegdb.org) in full genome range, follow and be evenly distributed principle and select the SSR labeled primer, select 25 on every karyomit(e), select to have synthesized 250 pairs of SSR labeled primers on 10 karyomit(e)s altogether.Simultaneously; Confirm screening sample colony and extracted the genomic dna of these self-breds corns; Comprise 26 parts of Shen W22, Shen W22 homology Glutinous Semen Maydis (contain whole sister's self-mating systems 4 parts with 9 parts of filial generation self-mating systems), non-homogeneous Glutinous Semen Maydis self-mating systems, and 10 parts of inbred line of sweet corn and 10 parts of grain corn inbred lines.Corn germplasm DNA sample number into spectrum is seen table 1.
Table 1: corn germ plasm resource numbered list
| Numbering | Title | Numbering | Title | Numbering | | Numbering | Title | |
| 1 | Shen |
16 | Glutinous No. 1 of Shandong | 31 | (SW48/5003)/SW48 | 46 | |
|
| 2 | Shen W23 | 17 | SW13/ logical 5 | 32 | (SW48/5003)/purple black glutinous No. 1 | 47 | Xia Zhen | |
| 3 | Cultivate glutinous No. 1/Xiao Huang Glutinous Semen Maydis | 18 | Quartzy No. 1/ |
33 | Purple black glutinous No. 1 of SW48/ | 48 | |
|
| 4 | Shen W76 | 19 | 18 |
34 | 33 sisters system | 49 | |
|
| 5 | Shen W77 | 20 | Shen W78 | 35 | In glutinous No. 1/ |
50 | Sweet No. 3 of Guangdong | |
| 6 | Cultivate glutinous/(white 525/ is red glutinous) | 21 | SW13/ wishes that the west is red | 36 | Shen W71 | 51 | U.S. AP-78913 | |
| 7 | Cultivate glutinous/Shandong glutinous No. 1 | 22 | SW13/ (SW22/ Xiao Huang is glutinous) | 37 | Shen W72 | 52 | 150/AP7JK034 | |
| 8 | Shen W54 | 23 | ZW-1/SW13 | 38 | Shen W73 | 53 | France CPJ008 | |
| 9 | Shen W65 | 24 | SW13/ZW-1 | 39 | Shen W74 | 54 | France 359 | |
| 10 | (white 525/ is red glutinous)/SW22 | 25 | SW01/SW13 | 40 | Shen W75 | 55 | (330/Mo17)/Mo17 | |
| 11 | 10/SW22 | 26 | Shen W48 | 41 | H31 | 56 | 5003 | |
| 12 | The Sapporo purple is glutinous/SW22 | 27 | SW48/ Shandong is black glutinous | 42 | |
57 | 8112/5003 | |
| 13 | SW13/SW22 | 28 | Shen W82 | 43 | The sweet Yellow of the U.S. | 58 | 8112-3 | |
| 14 | SW22/5003 | 29 | SW48/ logical 5 | 44 | |
59 | |
|
| 15 | 14/ |
30 | SW13/SW48 | 45 | |
60 | It is yellow that early 4/ Xiao Huang is glutinous |
The screening experiment the first step; Choose Shen W22 and non-homogeneous Glutinous Semen Maydis, grain corn, each a DNA of sweet corn as pcr template; Confirmed each optimum PCR condition to the amplification of SSR labeled primer, and the needed time when confirming the PAGE electrophoresis according to the amplified production magnitude range.Other condition, PCR system, dna profiling concentration, electrophoresis dying coloration method unanimity.
Screening experiment second step, choose 2 parts of Shen W22,8 parts of homology Glutinous Semen Maydiss, 8 parts of non-homogeneous Glutinous Semen Maydiss, 2 parts of sweet corns, grain corn totally 21 parts of DNA samples, whole 250 pairs of SSR primers are carried out the pcr amplification electrophoretic analysis respectively.The every pair of primer analyzes triplicate to the amplification of these 21 samples, rejected 70% labeled primer a little less than Shen W22 does not have specificity, separating capacity at last, and remaining 30% i.e. 75 pairs of SSR labeled primers all can make a distinction Shen W22 and sample more than half.
The 3rd step of screening experiment, screening comprehensively.To Shen W22, whole totally 60 parts of genome DNA samples of 14 parts of homology corns, 25 parts of non-homogeneous corns, 10 parts of sweet corns, 10 parts of grain corns, carried out combining the PAGE electrophoretic analysis after 75 couples of Shen W22 that above second step screening obtains have the pcr amplification of certain specific SSR labeled primer.Every pair of SSR primer is analyzed triplicate to the amplification of 60 samples; Obtain the SSR labeled primer of 28 pairs of Shen W22 high specials at last, wherein 4-8 can be that whole non-homogeneous Glutinous Semen Maydis, grain corn and the sweet corn that Glutinous Semen Maydis, this institute analyze makes a distinction with Shen W22 and the non-filial generation sister of homology to the finger printing that combination of primers increases arbitrarily.
The 4th step of screening experiment; To Shen W22 and whole Glutinous Semen Maydiss totally 40 duplicate samples DNA; 28 pairs of SSR labeled primers that above comprehensive screening is obtained carry out the pcr amplification electrophoretic analysis; Rejected filial generation can not genetic stability, the banding pattern combination too complicated be difficult for identification or separating capacity redundant to account for 50% SSR labeled primer right, it is right to have obtained 14 pairs of SSR labeled primers at last.The electrophoretic finger printing of these primer extension products is to Shen W22 and filial generation thereof high special all, therefore belongs to special and genetic stability, makes up the SSR mark of the Shen W22 that is easy in the collection of illustrative plates to discern the parents of filial generation.Use 4 couple (SW22-2, SW22-10, SW22-11, SW22-14) in these 14 pairs of SSR labeled primers can be well Shen W22 and offspring thereof to be differentiated from the corn germplasm of 60 parts of different sourcess being analyzed.Unknown sample is being differentiated when judging that the analysis of increasing of the primer of these 14 pairs of SSR marks of integrated use can make the Molecular Identification result more accurately and reliably.More than the 14 pairs of primers comprehensively the amplification collection of illustrative plates of screening see accompanying drawing 1-14.Primer title and sequence are seen table 2.
Table 2: Shen W22 Glutinous Semen Maydis and offspring's cultivar identification SSR labeled primer title and sequence
| The primer numbering | The SSR title | Chromosomal foci | Forward primer (5 '-3 ') | Reverse primer (5 '-3 ') | ?Z℃ |
| SW22-1 | umc1041 | 1.00-1 .01 | CATTTCTTAGCACAACGC (SEQ?ID?NO：1) | ?GCCACTGTGATTTCCCTT?(SEQ?ID?NO：2) | ?54 |
| SW22-2 | phi056 | 1.01 | ACTTGCTTGCCTGCCGTTAC (SEQ?ID?NO：3) | ?CGCACACCACTTCCCAGA?(SEQ?ID?NO：4) | ?60 |
| SW22-3 | mmc0041 | 1.08 | AGGACTTAGAGAGGAAACGAA (SEQ?ID?NO：5) | ?TTTATCCTTACTTGCAGTTGC?(SEQ?ID?NO：6) | ?54 |
| SW22-4 | bnlg1175 | 2.04 | ACTTGCACGGTCTCGCTTAT (SEQ?ID?NO：7) | ?GCACTCCATCGCTATCTTCC?(SEQ?ID?NO：8) | ?58 |
| SW22-5 | umc2011 | 4.10 | GTGCTGCAGTCATTAGGA (SEQ?ID?NO：9) | ?ATCACATGGTTTTTCAGGT?(SEQ?ID?NO：10) | ?55 |
| SW22-6 | nc004 | 4.03 | TGCGAAGAAGCAGTAGCAAA (SEQ?ID?NO：11) | ?TGGAGGTAGAAGACGCACG?(SEQ?ID?NO：12) | ?58 |
| SW22-7 | umc1019 | 5.06 | CCAGCCATGTCTTCTCGTTCTT (SEQ?ID?NO：13) | ?AAACAAAGCACCATCAATTCGG?(SEQ?ID?NO：14) | ?62 |
| SW22-8 | umc2162 | 6.06 | GACGATGACGAACACCGAGC (SEQ?ID?NO：15) | ?GATGCTGATGACGCTCTACAAGG?(SEQ?ID?NO：16) | ?58 |
| SW22-9 | umc1068 | 7.02 | AGTCGTTTTCAAAGGCTGC (SEQ?ID?NO：17) | ?AGTCACCTCATTTCTTCTGG?(SEQ?ID?NO：18) | ?62 |
| SW22-10 | umc1936 | 7.03 | GAGCTCATGTGTATGTGGACGTTG (SEQ?ID?NO：19) | ?AATAAACAGAGGTAGGTCAGGTCGC?(SEQ?ID?NO：20) | ?62 |
| SW22-11 | umc1340 | 8.05 | GATGTCTCTATGGAACCCAGCAAC | ?AGACGCCTACGAGTACCACAAC | ?58 |
| ? | ? | ? | (SEQ?ID?NO：21) | ?(SEQ?ID?NO：22) | ? |
| SW22-12 | mmc0181 | 8.06-8 .07 | CTAATCACCAACCACCAACAC (SEQ?ID?NO：23) | ?AGTCCGTCCTCTGTCCTCGTC?(SEQ?ID?NO：24) | 56 |
| SW22-13 | umc1137 | 9.08 | ATCAGTCACTCTTCTGCCTC (SEQ?ID?NO：25) | ?TGGATAATGTTGTAGCTGGTC?(SEQ?ID?NO：26) | 58 |
| SW22-14 | bnlg153 | 10.06- 10.07 | TCCACTGCTCCTCCACTGC (SEQ?ID?NO：27) | ?CACTTCAAACTGTCAAATCTCCA?(SEQ?ID?NO：28) | 58 |
Z ℃: PCR reacts the righttest annealing temperature
" offspring " described herein comprises the filial generation of Shen W22, for example beautiful glutinous No. two (H2), No. three (H3) of Shanghai.Term used herein " comprises ", " comprising ", " containing " etc. also comprise " by ... form ", " by ... constitute " implication.In addition, term used herein, except as otherwise noted, otherwise all be under the present invention in the technical field general term.
It is right that test kit of the present invention can contain more than 4 pairs primer, comprise 5,6,7,8,9,10,11,12,13 and whole 14 pairs of primers right.These primers are to can arbitrary combination being contained in the test kit of the present invention.These primers are to also can arbitrary combination being used for the method that glutinous corn variety of the present invention is identified and seed purity is checked.
But the DNA extracting of corn sample is from blade, seed, stem, root etc.
Should be understood that in this application, the condition that relates in the DNA extraction that is adopted, the round pcr, for example temperature, reagent, step etc. all are that art technology is known.Following specific embodiment does not limit the scope of the present invention, and they only are illustrative.Those skilled in the art under the situation of spirit that does not depart from the application and scope, can make suitable modification and change according to state of the art to the application's technical scheme.
Embodiment 1:DNA extracts
Identify the individual plant corn, cut 2 cm long blades during sampling.With TPS extracting solution (pH8.0 100mM Tris.Cl; PH8.010mM EDTA; 1M KCL) rapid extraction DNA, concrete operations are following:
1) sample places 1.5ml eppendorf pipe, adds 200ul TPS extracting solution, and frotton or rifle head make it to grind;
2) 75 ℃ of water-baths are after 20 minutes centrifugal 5 minutes: 12000rpm, normal temperature;
3) supernatant moves to new pipe, with equal-volume Virahol-20 ℃ deposition after 20 minutes centrifugal 10 minutes: 12000rpm, normal temperature;
4) with DNA deposition centrifugal 5 minutes: 12000rpm, normal temperature with 500ul 70% washing with alcohol;
5) the 50ul water dissolution is used in the dry back of deposition.
Identify seed, the embryo that completely random is taken to few 20 seeds extracts DNA, and concrete operation method is following: the embryo of each dry seeds is taken off; Put into 96 hole depth orifice plates respectively, every hole adds 100 μ L extracting solutions (0.1M NaOH, 0.1 ‰ tetrabromophenol sulfonphthaleins); Cover and seal film; Boiling water heating 5min, every then hole adds 100 μ L TE damping fluids (pH2.0) respectively, is placed on 4 ℃ of refrigerators and preserves subsequent use.
Utilize 1.0% agarose gel electrophoresis, ethidium bromide staining, uv lamp are observed down and are taken a picture, and detect the DNA quality.
Above DNA extraction liquid is got 2ul respectively and directly is used for the PCR reaction.
Embodiment 2:PCR amplification
14 pairs of primers carry out pcr amplification in the application table 2, and pcr template is Shen W22 and the main genomic dna that cooperates parent Shen W13, Shen W48 and unknown corn germplasm to be identified.
1) prepares the reaction mixture of big volume, but except DNA or the primer comprising all the components in the table 3.
2) the reaction mixture branch is installed in 96 orifice plates, add the primer or the DNA sample of corresponding amount then.
3) bind with Witco 70.
4) place the PCR appearance.
Table 3:PCR reaction system is formed
" RXN ": refer to reaction system
5) amplification program such as table 4:
Table 4:Touchdown PCR program (is annotated: Z value ginseng table 2)
6) should finish after, it is subsequent use that every pipe adds 3-4 μ l 5 * SGB (ginseng table 5) mixing, can be positioned over 4 ℃ of preservations earlier if can not use immediately.
Table 5:5 * SGB sample-loading buffer prescription
The PAGE gel electrophoresis of embodiment 3:PCR amplified production is analyzed
1) assembling vertical slab electrophoresis groove: it is inner that the plastic channel bar of earlier back cover being used is put the electrophoresis chamber bottom into; [there is obscure glass (inside and outside branch is up and down arranged) on the one of which both sides to get two clean air dried sheet glass; Recess is arranged at another top]; Merge back (jagged sheet glass should be close to electrophoresis chamber up with recess, and hairiness glass edge one side is close to recess glass and is got final product) and be placed on back cover with in the plastic channel; With four pieces of iron clamps sheet glass is fixed on the electrophoresis apparatus, clamp neat lower edge, and level inwardly can not surpass the obscure glass bar, and vertical two pieces of clips come together, following tight top Lve Song.After assembling, one side assembles opposite side again.
2) back cover before the encapsulating: with 1% agar (available 1 * TBE preparation, also available tap water preparation) back cover.I.e. dissolving is boiled cool after 50 ~ 60 ℃, and the inclination electrophoresis chamber is also irritated into the back cover groove along the sheet glass lower end, to half of its height, gets final product.Just can prepare to record polyacrylamide gel after treating to solidify fully.
3) glue (two): with the non-sex change glue of 30%Acr/Bis preparation 8%, concrete compound method is seen table 6, table 7.
Table 6:30%Acr/Bis stock solution (29: 1) prescription
The preparation of table 7:8%Acr gelating soln (being used for non-sex change glue)
(10%APS: take by weighing the Ammonium Persulfate 98.5 of 1g, be dissolved in the 10ml ultrapure water and get final product, be stored in 4 ℃; TEMED: tetramethyl-diethylamine, normal temperature storage.)
4) go up appearance: add 1 * TBE electrophoretic buffer (ginseng table 8) of same batch at the two poles of the earth of electrophoresis chamber, extract comb then; Clear up well with syringe, then with appearance on the microsyringe, every hole adds 4 ~ 5 μ l samples and gets final product.Add DNA Marker (the Marker dilution that reagent company is provided 20 times then add 5 μ l get final product) reserving 1-2 well on the gel limit at least.Last appearance operation should be rapid as much as possible.
Table 8:5 * TBE power supply damping fluid compound method
5) electrophoresis: the voltage stabilizing electrophoresis (100V ~ 150V).The swimming of tetrabromophenol sulfonphthalein indication band can stop electrophoresis to apart from about 1 centimetre of base the time.
6) silver dyes: the shelf that takes off the electrophoresis chamber both sides takes off the gel glass plate from electrophoresis chamber, then plastics back cover groove is unloaded; The gel glass plate level is placed (having on the side direction of recess sheet glass), with the plastic tab of flexible perk recess sheet glass carefully, with blade agar back cover glue with cutting the base; The sheet glass upset (making under the side direction of polyacrylamide gel) with the tool burr then places the vinyl disc that fills an amount of ultrapure water, rocks sheet glass carefully polyacrylamide gel is separated with sheet glass; After slightly floating with ultrapure water, water outwelled begin dyeing.In vinyl disc, adding an amount of 0.1%AgNO3 staining fluid (is dissolved in 1g AgNO3 in the 1L ultrapure water; Brown bottle is deposited) make it not have colloid; On horizontal decolorization swinging table, slowly shake dyeing 5min (staining fluid can use repeatedly, but need suitably prolong dyeing time).
7) colour developing: after silver dyes, the careful and rinsing polyacrylamide gel rapidly with ultrapure water again.Adding an amount of colour developing liquid then (is dissolved in 150g NaOH and 1.9g ten hydrated sodium borates in the 10L pure water.With an amount of formaldehyde of preceding interpolation (every 200ml adds 37% formaldehyde 1ml)), slowly shake until the nucleic acid band and manifest, outwell colour developing liquid add tap water a little rinsing with color development stopping.
8) take pictures: (note discharging the bubble between polyacrylamide gel and the blank) on the blank of transferring to X-ray film observation lamp house that the polyacrylamide gel after will developing the color is careful, turn on the background fluorescence lamp then and take pictures.
The result judges:
According to the electrophoresis result of 14 pairs of primer amplifications, whether contain in the comparative analysis specific sample with over against according to Shen W22 consistent fingerprint, then be Shen W22 or generation thereafter in this way; Otherwise, be not Shen W22 or generation thereafter.Combine the cooperation parent Shen W13 of Shen W22 and the finger printing of W48 again, can differentiate the cross-fertilize seed variety name.Positive seed grain number or positive individual plant number can calculate colony's purity divided by analyzing total grain or strain number.
Shanghai beautiful glutinous No. 2 and the beautiful glutinous No. 3 positive detection in Shanghai collection of illustrative plates are seen accompanying drawing 15.Show among the figure that major-minor two bands of SW22-1 amplification are in offspring's codominance; Major-minor two bands that SW22-2 increases in the W22 of Shen are in offspring's dominance; Two master tapes that SW22-3 increases in the W22 of Shen are in offspring's dominance; The master tape of SW22-4 amplification is in offspring's codominance; The major-minor band of SW22-5 amplification is in offspring's codominance; Major-minor three bands of SW22-6 amplification are in offspring's dominance; The major-minor band of SW22-7 amplification is in offspring's codominance; The major-minor band of SW22-8 amplification is in offspring's codominance; The master tape of SW22-9 amplification is in offspring's codominance; The master tape that SW22-10 increases in the W22 of Shen is in offspring's dominance; The auxilliary band that SW22-11 increases in the W22 of Shen is in offspring's dominance; The 6 combination banding patterns that SW22-12 increases in the W22 of Shen are in offspring's dominance; The 5 combination banding patterns that SW22-13 increases in the W22 of Shen are in offspring's dominance; The 7 combination banding patterns that SW22-14 increases in the W22 of Shen are in offspring's dominance.Use SW22-2, SW22-10, SW22-11, SW22-14 can identify Shanghai beautiful glutinous No. 2 and beautiful glutinous No. 3 positive in Shanghai.
Sequence table
< 110>Academy of Agricultural Sciences, Shanghai City
< 120>Glutinous Semen Maydis self-mating system Shen W22 specific molecular marker and thereafter for the application in the cultivar identification
<130>081773
<160>28
<170>PatentIn?version?3.3
<210>1
<211>18
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>1
catttcttag?cacaacgc 18
<210>2
<211>18
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>2
gccactgtga?tttccctt 18
<210>3
<211>20
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>3
acttgcttgc?ctgccgttac 20
<210>4
<211>18
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>4
cgcacaccac?ttcccaga 18
<210>5
<211>21
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>5
aggacttaga?gaggaaacga?a 21
<210>6
<211>21
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>6
tttatcctta?cttgcagttg?c 21
<210>7
<211>20
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>7
acttgcacgg?tctcgcttat 20
<210>8
<211>20
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>8
gcactccatc?gctatcttcc 20
<210>9
<211>18
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>9
gtgctgcagt?cattagga 18
<210>10
<211>19
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>10
atcacatggt?ttttcaggt 19
<210>11
<211>20
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>11
tgcgaagaag?cagtagcaaa 20
<210>12
<211>19
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>12
tggaggtaga?agacgcacg 19
<210>13
<211>22
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>13
ccagccatgt?cttctcgttc?tt?22
<210>14
<211>22
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>14
aaacaaagca?ccatcaattc?gg 22
<210>15
<211>20
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>15
gacgatgacg?aacaccgagc 20
<210>16
<211>23
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>16
gatgctgatg?acgctctaca?agg 23
<210>17
<211>19
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>17
agtcgttttc?aaaggctgc 19
<210>18
<211>20
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>18
agtcacctca?tttcttctgg 20
<210>19
<211>24
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>19
gagctcatgt?gtatgtggac?gttg 24
<210>20
<211>25
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>20
aataaacaga?ggtaggtcag?gtcgc 25
<210>21
<211>24
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>21
gatgtctcta?tggaacccag?caac 24
<210>22
<211>22
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>22
agacgcctac?gagtaccaca?ac 22
<210>23
<211>21
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>23
ctaatcacca?accaccaaca?c 21
<210>24
<211>21
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>24
agtccgtcct?ctgtcctcgt?c 21
<210>25
<211>20
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>25
atcagtcact?cttctgcctc 20
<210>26
<211>21
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>26
tggataatgt?tgtagctggt?c 21
<210>27
<211>19
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>27
tccactgctc?ctccactgc 19
<210>28
<211>23
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
< 223>primer
<400>28
cacttcaaac?tgtcaaatct?cca 23
Claims (6)
1. identify that whether glutinous corn variety is the Glutinous Semen Maydis self-mating system Shen W22 or the method in generation thereafter, is characterized in that said method comprises for one kind:
(1) DNA of extracting Glutinous Semen Maydis sample;
(2) with 4-14 to be selected from down the group primer to extractive DNA is carried out pcr amplification; Obtain amplified production, said primer is to being selected from: SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ ID NO:5 and 6, SEQID NO:7 and 8, SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ IDNO:13 and 14, SEQ ID NO:15 and 16, SEQ ID NO:17 and 18, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22, SEQ ID NO:23 and 24, SEQ ID NO:25 and 26 and SEQID NO:27 and 28;
(3) amplified production in the step (2) is carried out the PAGE electrophoresis; With
(4) gained electrophoresis result and the electrophoresis result of using said primer to amplification self-mating system Shen W22 gained are compared; Confirm whether said sample contains the consistent fingerprint with self-mating system Shen W22, thereby identify that whether glutinous corn variety is Glutinous Semen Maydis self-mating system Shen W22 or generation thereafter.
2. the method for claim 1 is characterized in that, said primer is to being: SEQ ID NO:3 and 4, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22 and SEQ ID NO:27 and 28.
3. the method for claim 1 is characterized in that, said method also comprises:
(5) combination to the cooperation parent Shen W13 of the Shen W22 of acquisition and the finger printing of W48, is differentiated the Hybrid title with said primer.
4. check Glutinous Semen Maydis self-mating system Shen W22 or, it is characterized in that said method comprises for one kind thereafter for the method for seed purity:
(1) DNA of extracting Glutinous Semen Maydis seed;
(2) with 4-14 to be selected from down the group primer to extractive DNA is carried out pcr amplification; Obtain amplified production, said primer is to being selected from: SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ ID NO:5 and 6, SEQ ID NO:7 and 8, SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ IDNO:13 and 14, SEQ ID NO:15 and 16, SEQ ID NO:17 and 18, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22, SEQ ID NO:23 and 24, SEQ ID NO:25 and 26 and SEQID NO:27 and 28;
(3) amplified production in the step (2) is carried out the PAGE electrophoresis; With
(4) gained electrophoresis result and the electrophoresis result of using said primer to amplification self-mating system Shen W22 gained are compared; Confirm whether said sample contains the consistent fingerprint with self-mating system Shen W22, thereby identify that whether the Glutinous Semen Maydis seed is the Glutinous Semen Maydis self-mating system Shen W22 or the seed in generation thereafter; With
(5) be accredited as Glutinous Semen Maydis self-mating system Shen W22 or thereafter the seed amount in generation obtain seed purity divided by total test seed amount.
5. method as claimed in claim 4 is characterized in that, said primer is to being: SEQ ID NO:3 and 4, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22 and SEQ ID NO:27 and 28.
6. following primer is being to differentiating that whether glutinous corn variety is Glutinous Semen Maydis self-mating system Shen W22, it cooperates parent or generation thereafter, or check Glutinous Semen Maydis self-mating system Shen W22, it cooperates parent or thereafter for the purposes in the seed purity: SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ ID NO:5 and 6, SEQ ID NO:7 and 8, SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ ID NO:13 and 14, SEQID NO:15 and 16, SEQ ID NO:17 and 18, SEQ ID NO:19 and 20, SEQ ID NO:21 and 22, SEQ ID NO:23 and 24, SEQ ID NO:25 and 26 and SEQ ID NO:27 and 28.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100353027A CN101545004B (en) | 2008-03-28 | 2008-03-28 | Waxy maize inbred line Shen-W22 specific molecular marker and application thereof in offspring variety identification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100353027A CN101545004B (en) | 2008-03-28 | 2008-03-28 | Waxy maize inbred line Shen-W22 specific molecular marker and application thereof in offspring variety identification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101545004A CN101545004A (en) | 2009-09-30 |
| CN101545004B true CN101545004B (en) | 2012-05-30 |
Family
ID=41192382
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008100353027A Expired - Fee Related CN101545004B (en) | 2008-03-28 | 2008-03-28 | Waxy maize inbred line Shen-W22 specific molecular marker and application thereof in offspring variety identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101545004B (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102505044B (en) * | 2011-11-10 | 2013-08-07 | 南京农业大学 | Method for quickly identifying genetic purity of glutinous corn hybrid |
| CN104007161A (en) * | 2014-05-12 | 2014-08-27 | 塔里木大学 | Polyacrylamide gel solution for microsatellite marker polymorphism detection and silver staining method |
| CN104372101B (en) * | 2014-11-28 | 2017-01-04 | 中国科学院成都生物研究所 | The PCR-CTPP labeled primer of a kind of Fructus Hordei Vulgaris Waxy gene SNP sudden change and method |
| CN105132420B (en) * | 2015-09-23 | 2018-02-13 | 北京市农林科学院 | A kind of primer set for identifying corn variety purity and application |
| CN106472091A (en) * | 2016-10-18 | 2017-03-08 | 石家庄市种子管理站 | Corn seed purity field plot field plot test method |
| CN106929590B (en) * | 2017-04-21 | 2020-10-16 | 上海大学 | Specific primer group for amplifying and detecting molecular marker of corn 5512J gene and application thereof |
| CN108427866B (en) * | 2018-02-08 | 2022-03-01 | 北京市农林科学院 | Crop inbred line group identification method based on molecular marker technology |
| CN108277295B (en) * | 2018-04-04 | 2021-02-09 | 黑龙江省农业科学院农产品质量安全研究所 | Corn SSR molecular markers suitable for capillary electrophoresis detection technology and application thereof |
| CN108660244B (en) * | 2018-05-21 | 2021-02-02 | 黑龙江省农业科学院农产品质量安全研究所 | Corn SSR molecular markers suitable for capillary electrophoresis detection technology and application thereof |
| CN108384884B (en) * | 2018-05-21 | 2021-02-09 | 黑龙江省农业科学院农产品质量安全研究所 | Corn SSR molecular markers and application thereof |
| CN108531642B (en) * | 2018-06-28 | 2021-04-06 | 黑龙江省农业科学院农产品质量安全研究所 | SSR molecular markers for identifying corn varieties and application thereof |
| CN109652582B (en) * | 2019-01-08 | 2022-07-22 | 上海市农业科学院 | SNP molecular marker for identifying Huyunuo No.3 waxy corn and application thereof |
| CN113528620A (en) * | 2021-08-09 | 2021-10-22 | 上海市农业科学院 | Molecular marker primer group and kit for corn inbred line SHL03 variety protection and application thereof |
-
2008
- 2008-03-28 CN CN2008100353027A patent/CN101545004B/en not_active Expired - Fee Related
Non-Patent Citations (5)
| Title |
|---|
| H.Enoki·H et al.SSR analysis of genetic diversity among maize inbred lines adapted to cold regions of Japan.《Theor Appl Genet》.2002,第104卷1270－1277. * |
| Natalya Sharopova et al.Development and mapping of SSR markers for maize.《Plant Molecular Biology》.2002,第48卷463-481. * |
| 李丽华等.西南玉米自交系SSR遗传多样性研究.《四川农业大学学报》.2007,第25卷(第1期),44－50. * |
| 王义发等.优质多抗高配合力糯玉米自交系"申W22"的选育.《上海农业学报》.2004,第20卷(第3期),24－27. |
| 王义发等.优质多抗高配合力糯玉米自交系"申W22"的选育.《上海农业学报》.2004,第20卷(第3期),24-27. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101545004A (en) | 2009-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101545004B (en) | Waxy maize inbred line Shen-W22 specific molecular marker and application thereof in offspring variety identification | |
| CN103740711B (en) | Indel marker linked with yellow flesh gene yf of cucmis sativus L. and application of Indel marker | |
| CN101824484B (en) | DNA fingerprint detection method for authenticity identification of cotton variety | |
| CN107619873A (en) | Based on molecular labeling in association analysis and KASP exploitation waxy1 genes | |
| CN103667427B (en) | Primer sequence for authenticating resistance of strawberry genetic resource anthracnose and authentication method thereof | |
| CN104711361B (en) | The method of the red peaceful hybrid seed purity of Rapid identification new water melon breed and the primer and kit of use | |
| CN104099414B (en) | Utilize the method for SSR molecular marker identification apricot cultivars | |
| CN107475381B (en) | SNP marker with tender flower stalk anthocyanidin gene linkage and its application | |
| CN101560556B (en) | Method for detecting DNA fingerprint purity in cotton crossbreeds | |
| CN106701926A (en) | Mapping of eggplant fruit color epistatic gene D, and InDel molecular marker development and application thereof | |
| CN105838785B (en) | SSR molecular marker and application with sesame black seed coat gene close linkage | |
| CN106967797B (en) | Specific sequence for detecting purity of melon seeds, detection method and application | |
| CN106520762A (en) | Molecular marks closely linked to glomerella leaf spot resistant genetic loci of apple and application | |
| CN106148510A (en) | Resistance gene of rice blast Pi5 specific Function molecular marker and application thereof | |
| CN104928396A (en) | Method for rapidly identifying hot pepper species and golden pepper purity degree by using EST-SSR molecular markers | |
| CN104004845B (en) | Identify that whether kind to be measured is method and the primer special group thereof of CCRI 63 | |
| CN106222262A (en) | Primer to and differentiate Oryza sativa L. nitrogen efficiently utilize the application in gene NRT1.1B genotype | |
| CN110863064B (en) | Linkage marker of barley ear trait gene locus and application thereof | |
| CN101619358B (en) | Method for identifying breeds of Chinese cabbage and special kit thereof | |
| Kyaligonza et al. | Identification of F1 cassava (Manihot esculenta Crantz) progeny using microsatellite markers and capillary electrophoresis | |
| CN116716426A (en) | SSR molecular marker primer combination based on aquilaria sinensis genome, kit and application | |
| CN113265481B (en) | Lycoris fluorescent EST-SSR molecular marker primer, method for identifying lycoris interspecific hybrid F1 generation and application thereof | |
| CN101914626A (en) | SSR (Simple Sequence Repeat) molecular marker identification method of goat breeds | |
| CN101760556A (en) | Molecular marker technology for identifying red grains and white grains of wheat | |
| CN106755558A (en) | A set of primer special and its application for willow improved seeds Genetic identification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120530 Termination date: 20160328 |