CN113528620A - Molecular marker primer group and kit for corn inbred line SHL03 variety protection and application thereof - Google Patents
Molecular marker primer group and kit for corn inbred line SHL03 variety protection and application thereof Download PDFInfo
- Publication number
- CN113528620A CN113528620A CN202110907563.9A CN202110907563A CN113528620A CN 113528620 A CN113528620 A CN 113528620A CN 202110907563 A CN202110907563 A CN 202110907563A CN 113528620 A CN113528620 A CN 113528620A
- Authority
- CN
- China
- Prior art keywords
- seq
- nucleotide sequence
- variety
- sequence shown
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000002017 Zea mays subsp mays Nutrition 0.000 title claims abstract description 54
- 240000008042 Zea mays Species 0.000 title claims abstract description 52
- 239000003147 molecular marker Substances 0.000 title claims abstract description 44
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 title claims abstract description 19
- 235000005822 corn Nutrition 0.000 title claims abstract description 19
- 239000002773 nucleotide Substances 0.000 claims abstract description 128
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 128
- 238000003780 insertion Methods 0.000 claims abstract description 51
- 230000037431 insertion Effects 0.000 claims abstract description 51
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 46
- 235000016383 Zea mays subsp huehuetenangensis Nutrition 0.000 claims abstract description 33
- 235000009973 maize Nutrition 0.000 claims abstract description 33
- 238000000034 method Methods 0.000 claims abstract description 30
- 230000035772 mutation Effects 0.000 claims abstract description 25
- 238000012408 PCR amplification Methods 0.000 claims abstract description 23
- 238000012163 sequencing technique Methods 0.000 claims abstract description 11
- 238000013461 design Methods 0.000 claims abstract description 8
- 230000003321 amplification Effects 0.000 claims description 55
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 55
- 239000012634 fragment Substances 0.000 claims description 53
- 210000000349 chromosome Anatomy 0.000 claims description 43
- 238000001962 electrophoresis Methods 0.000 claims description 18
- 238000006243 chemical reaction Methods 0.000 claims description 10
- 238000011144 upstream manufacturing Methods 0.000 claims description 8
- 239000003550 marker Substances 0.000 claims description 7
- 238000012217 deletion Methods 0.000 claims description 5
- 230000037430 deletion Effects 0.000 claims description 5
- 108090000790 Enzymes Proteins 0.000 claims description 4
- 102000004190 Enzymes Human genes 0.000 claims description 4
- 238000000137 annealing Methods 0.000 claims description 4
- 239000003153 chemical reaction reagent Substances 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 4
- 230000036425 denaturation Effects 0.000 claims description 4
- 238000012257 pre-denaturation Methods 0.000 claims description 4
- 238000012216 screening Methods 0.000 claims description 4
- 238000011161 development Methods 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 3
- 235000009508 confectionery Nutrition 0.000 description 33
- 239000000463 material Substances 0.000 description 14
- 241000196324 Embryophyta Species 0.000 description 9
- 238000003752 polymerase chain reaction Methods 0.000 description 8
- 241000209094 Oryza Species 0.000 description 5
- 235000007164 Oryza sativa Nutrition 0.000 description 5
- 235000009566 rice Nutrition 0.000 description 5
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- 241001168636 Erythronium californicum Species 0.000 description 3
- 238000000246 agarose gel electrophoresis Methods 0.000 description 3
- 241000482268 Zea mays subsp. mays Species 0.000 description 2
- 239000011324 bead Substances 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 230000008014 freezing Effects 0.000 description 2
- 238000007710 freezing Methods 0.000 description 2
- 239000000499 gel Substances 0.000 description 2
- 238000000227 grinding Methods 0.000 description 2
- 238000003384 imaging method Methods 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 240000005373 Panax quinquefolius Species 0.000 description 1
- 235000003140 Panax quinquefolius Nutrition 0.000 description 1
- 229910000831 Steel Inorganic materials 0.000 description 1
- 235000013339 cereals Nutrition 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000037433 frameshift Effects 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 238000005286 illumination Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000012925 reference material Substances 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 239000010959 steel Substances 0.000 description 1
- 239000013077 target material Substances 0.000 description 1
- 238000009333 weeding Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of corn variety identification, in particular to a molecular marker primer group and a kit for corn inbred line SHL03 variety protection and application thereof. The molecular marker primer group comprises one or more groups of primers of primer groups 1-14, and the nucleotide sequence of the primer groups 1-14 is shown as SEQ ID No. 1-42. The invention screens out mutation sites with specific insertion relative to a reference gene by sequencing genome DNA of a maize inbred line SHL03 variety and comparing the sequenced genome DNA with a reference genome B73-V4, designs two pairs of primers according to each mutation site, screens out a molecular marker primer group for protecting the maize inbred line SHL03 variety by utilizing a PCR amplification method, and the primer group can rapidly and accurately identify the maize inbred line SHL03 variety and the identification result is not influenced by external environment change.
Description
Technical Field
The invention relates to the technical field of corn variety identification, in particular to a molecular marker primer group and a kit for corn inbred line SHL03 variety protection and application thereof.
Background
The sweet corn inbred line is one of the parents of a commercial sweet corn variety and has higher commercial value. On one hand, the authenticity of the variety is difficult to ensure because the seed management channels are many, messy and mixed in China and no seed authentication system is implemented; on the other hand, the lack of an accurate, reliable, simple and fast variety detection method often brings inconvenience to seed management departments, variety protection departments, seed producers, operators and farmers, and also brings opportunities to some units and individuals, and during production activities, the phenomena of difficult variety identification and material stealing often occur.
In the conventional breeding work, the main identification method of corn varieties is phenotypic statistical identification, such as plant height, plant shape, spike height and the like, and the statistical method plays a great role in the previous work, but has great instability. The phenotypic characteristics of the corn are easily influenced by external environmental factors, such as temperature, moisture, illumination and the like, which cause inaccurate plant phenotype; at the same time, the phenotypic characteristics of plants have universality, namely, a characteristic phenotype of one corn variety can be reproduced on another multiple varieties. In order to improve the identification accuracy, a plurality of phenotype results need to be counted, and the effect accuracy is not high enough while a large amount of manpower and material resources are consumed.
Disclosure of Invention
In order to solve the problems, the invention provides a molecular marker primer group for protecting a maize inbred line SHL03 variety, a kit and application thereof. The molecular marker primer group provided by the invention can quickly and accurately identify the maize inbred line SHL03 variety, and the identification result is not influenced by external environment change.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a development method of a molecular marker and an identification primer group for corn variety protection, which comprises the following steps:
1) sequencing the variety genome to be protected, comparing the sequenced genome with a reference genome B73-V4, and screening a specific variation site sequence as a specific marker to obtain InDel genotype data;
2) respectively designing 3 primers by taking the length of 500bp fragments on the upstream and downstream of each InDel site as a template region for primer design, wherein the 3 primers are respectively a forward primer F1 at the position of 25-50 bp on the upstream of the InDel, a forward primer F2 at the position of the InDel and a reverse primer R at the downstream of the InDel;
3) according to the combinations F1+ R and F2+ R, respectively taking the genomic DNA of the variety to be protected and the genomic DNA of the B73 variety as templates for PCR amplification;
and (3) analyzing an amplification result: when the variety needing protection has fragment insertion relative to the B73 variety, if the amplification band of F1+ R of the variety needing protection is greater than the amplification band of F1+ R of B73, the amplification band of F2+ R of the variety needing protection is present, and the amplification band of F2+ R of B73 is absent, the mutation site can be used as a molecular marker for protecting the corn variety, and primers F1, F2 and R designed according to the mutation site can be used as a primer group for identification;
when the variety needing protection has fragment deletion relative to the B73 variety, if the amplified band of F1+ R of the variety needing protection is less than the amplified band of F1+ R of B73, the amplified band of F2+ R of the variety needing protection is not, and the amplified band of F2+ R of B73, the mutation site can be used as a molecular marker for protecting the corn variety, and the primers F1, F2 and R designed according to the mutation site can be used as a primer group for identification.
The invention also provides application of primers or reagents for detecting multiple sites in preparation of a kit for identifying the maize inbred line SHL03 variety, wherein the multiple sites comprise one or more of sites 1-14;
the site 1 is the insertion of GGACCAAGGAAACAACCTTT fragment existing at position 250447798 of chromosome 1 in B73-V4 genome with gene accession number Zm00001d 033112;
the site 2 is the insertion of GTAGATTCTTCGCATAGGTTTGA fragment at 925909 site of chromosome 5 in B73-V4 genome with gene accession number Zm00001d 012823;
the 3 site is the insertion of AGAAGAACACTAACAAGGAGGGC fragment at 175783391 site of No.5 chromosome in B73-V4 genome with gene accession number Zm00001d 016784;
the site 4 is an insertion of TCATTGTCATGGCACTCCCCGCT fragment at 144731838 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 037998;
the site 5 is an insertion of CTTCTTTAGGTTGATGTCCCAAC fragment at 160583238 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038589;
the site 6 is an insertion of TCGTTTATTTTTCACATGGTTTT fragment at 165363624 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038830;
the site 7 is an insertion of ACAGTGCAAGAGTTAGGCAGAGA fragment at position 168197981 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038982;
the site 8 is an insertion of GATCTATACTGTCGTTGCTAAAA fragment at 171556729 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 039165;
the site 9 is the insertion of TCGGCATCCCACAAAAGGTTCAA fragment existing at position 125979085 of chromosome 7 in B73-V4 genome with gene accession number Zm00001d 020640;
the site 10 is the insertion of AAAAGAAAGGGAATGAGAAAGAA fragment at position 126392786 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010737;
the site 11 is the insertion of CGCACCCGCTCCAGTCTACCATC fragment existing at position 128352484 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010804;
the site 12 is an insertion of ACGAGGAGAAGGAAGCAAGTAGT fragment existing at position 129099756 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010826;
the site 13 is an insertion of GTCTACTTTGAACTTGCTAGGGC fragment at position 39778284 of chromosome 10 in the B73-V4 genome with the gene accession number Zm00001d 024049;
the site 14 is an insertion of TGCTGCAGACAAGGACGAAAGCC fragment existing at position 135307617 of chromosome 10 in the B73-V4 genome with gene accession number Zm00001d 025985.
The invention also provides a molecular marker primer group for protecting the maize inbred line SHL03 variety, wherein the molecular marker primer comprises one or more groups of primers described in the primer group 1-14;
the primer group 1 comprises: fKT10F1 with the nucleotide sequence shown as SEQ ID NO.1, fKT10F2 with the nucleotide sequence shown as SEQ ID NO.2 and fKT10R with the nucleotide sequence shown as SEQ ID NO. 3;
the primer group 2 comprises: fKT41F1 with a nucleotide sequence shown as SEQ ID NO.4, fKT41F2 with a nucleotide sequence shown as SEQ ID NO.5 and fKT41R with a nucleotide sequence shown as SEQ ID NO. 6;
the primer group 3 comprises: fKT46F1 with the nucleotide sequence shown as SEQ ID NO.7, fKT46F2 with the nucleotide sequence shown as SEQ ID NO.8 and fKT46R with the nucleotide sequence shown as SEQ ID NO. 9;
the primer group 4 comprises: fKT56F1 with the nucleotide sequence shown as SEQ ID NO.10, fKT56F2 with the nucleotide sequence shown as SEQ ID NO.11 and fKT56R with the nucleotide sequence shown as SEQ ID NO. 12;
the primer group 5 includes: fKT59F1 with the nucleotide sequence shown as SEQ ID NO.13, fKT59F2 with the nucleotide sequence shown as SEQ ID NO.14 and fKT59R with the nucleotide sequence shown as SEQ ID NO. 15;
the primer group 6 comprises: fKT61F1 with the nucleotide sequence shown as SEQ ID NO.16, fKT61F2 with the nucleotide sequence shown as SEQ ID NO.17 and fKT61R with the nucleotide sequence shown as SEQ ID NO. 18;
the primer group 7 includes: fKT64F1 with the nucleotide sequence shown as SEQ ID NO.19, fKT64F2 with the nucleotide sequence shown as SEQ ID NO.20 and fKT64R with the nucleotide sequence shown as SEQ ID NO. 21;
the primer set 8 includes: fKT65F1 with the nucleotide sequence shown as SEQ ID NO.22, fKT65F2 with the nucleotide sequence shown as SEQ ID NO.23 and fKT65R with the nucleotide sequence shown as SEQ ID NO. 24;
the primer set 9 includes: fKT76F1 with a nucleotide sequence shown as SEQ ID NO.25, fKT76F2 with a nucleotide sequence shown as SEQ ID NO.26 and fKT76R with a nucleotide sequence shown as SEQ ID NO. 27;
the primer set 10 includes: fKT83F1 with the nucleotide sequence shown as SEQ ID NO.28, fKT83F2 with the nucleotide sequence shown as SEQ ID NO.29 and fKT83R with the nucleotide sequence shown as SEQ ID NO. 30;
the primer set 11 includes: fKT84F1 with the nucleotide sequence shown as SEQ ID NO.31, fKT84F2 with the nucleotide sequence shown as SEQ ID NO.32 and fKT84R with the nucleotide sequence shown as SEQ ID NO. 33;
the primer set 12 includes: fKT85F1 with the nucleotide sequence shown as SEQ ID NO.34, fKT85F2 with the nucleotide sequence shown as SEQ ID NO.35 and fKT85R with the nucleotide sequence shown as SEQ ID NO. 36;
the primer set 13 includes: fKT106F1 with the nucleotide sequence shown as SEQ ID NO.37, fKT106F2 with the nucleotide sequence shown as SEQ ID NO.38 and fKT106F 106R with the nucleotide sequence shown as SEQ ID NO. 39;
the primer set 14 includes: fKT111F1 with the nucleotide sequence shown as SEQ ID NO.40, fKT111F2 with the nucleotide sequence shown as SEQ ID NO.41 and fKT111R with the nucleotide sequence shown as SEQ ID NO. 42.
The invention also provides a kit for identifying the maize inbred line SHL03 variety, and the kit comprises the molecular marker primer group.
The invention also provides application of the molecular marker primer group or the kit in identification of maize inbred line SHL03 varieties.
The invention also provides a method for identifying the maize inbred line SHL03 variety, which comprises the following steps:
performing PCR amplification on the genomic DNA of the variety to be detected and the genomic DNA of the SHL03 variety respectively by using the two pairs of primers F1+ R and F2+ R in each primer group to obtain amplification products;
identifying the amplification product, wherein if the amplification products are obtained when two pairs of primers F1+ R and F2+ R in the multiple primer groups of the SHL03 variety are amplified, and the amplification products are obtained when two pairs of primers F1+ R and F2+ R in the multiple primer groups of the variety to be detected are amplified, the variety to be detected is an SHL03 variety;
if the F1+ R and the F2+ R pairs in the multiple primer groups of the SHL03 variety both obtain amplification products during amplification, and the F1+ R and the F2+ R pairs in the multiple primer groups of the to-be-detected variety do not obtain amplification products or obtain amplification products from part of the primer pairs, the to-be-detected variety is not the SHL03 variety.
Preferably, the plurality of sets of primers include 10 or more than 10 of the above sets of molecular marker primers.
Preferably, the reaction progress of the PCR amplification comprises pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 40s, and circulating for 35 times; further extension was carried out at 72 ℃ for 5 min.
Preferably, the reaction system for PCR amplification is 20. mu.L, and comprises 2. mu.L of DNA template, 0.5. mu. L, Easytaq enzyme for each of forward primer and reverse primer, 0.5. mu.L of dNTP 0.5. mu.L, 10 × Easytaq buffer 2. mu.L and the balance ddH2O。
Preferably, the method of identifying the amplification product comprises electrophoresis or sequencing.
Has the advantages that:
the invention provides a molecular marker primer group for protecting a maize inbred line SHL03 variety, which comprises one or more groups of primers described in the primer group 1-14, wherein the nucleotide sequence of the primer group 1-14 is shown in SEQ ID NO. 1-42. The invention screens out mutation sites with specific insertion relative to a reference gene by sequencing genome DNA of a maize inbred line SHL03 variety and comparing the sequenced genome DNA with a reference genome B73-V4, designs two pairs of primers according to each mutation site, screens out a molecular marker primer group for protecting the maize inbred line SHL03 variety by utilizing a PCR amplification method, and the primer group can rapidly and accurately identify the maize inbred line SHL03 variety and the identification result is not influenced by external environment change.
Drawings
FIG. 1 is a schematic diagram of the design of the forward primer F1, the forward primer F2 and the reverse primer R in example 1;
FIG. 2 is the electrophoresis chart of the PCR amplified products of SHL03 strain and control material; wherein the two electrophoretograms corresponding to each molecular Marker site are the amplification electrophoretograms of F1+ R, and the amplification results of lanes of the amplification electrophoretogram of F1+ R from left to right correspond to the molecular weight Marker, SHL03, Shenke No.1, Shenke No. 602, Shanghai red glutinous No.1, Huanuo 2000, sweet glutinous No.1, Rongyunuo No.9, Sukonuo 1901, white sweet glutinous No.2, Yunuo No.7, black sweet glutinous 168, Shennuo No.8, Shennuo No.9, Shennuo No.10, Shanghai sweet No.2 and Tunuo 60 in sequence; the two electrophoretograms below the position corresponding to each molecular Marker are amplification electrophoretograms of F2+ R, the amplification results of lanes of the amplification electrophoretograms of F2+ R from left to right correspond to a molecular weight Marker, SHL03, Megusan I, white beauty, No.3 sweet, No.1 sweet, 169 sweet, white pearl sweet, 5788 sweet, No.2 sweet, No.3 sweet, No.5 Suyunuo, No.16 Yue sweet, No.1 Yu sweet and 811;
FIG. 3 is the electrophoresis chart of the PCR amplified products of SHL03 strain and control material; wherein the two electrophoretograms corresponding to each molecular Marker site are the amplification electrophoretograms of F1+ R, and the amplification results of lanes of the amplification electrophoretogram of F1+ R from left to right correspond to the molecular weight Marker, SHL03, Shenke No.1, Shenke No. 602, Shanghai red glutinous No.1, Huanuo 2000, sweet glutinous No.1, Rongyunuo No.9, Sukonuo 1901, white sweet glutinous No.2, Yunuo No.7, black sweet glutinous 168, Shennuo No.8, Shennuo No.9, Shennuo No.10, Shanghai sweet No.2 and Tunuo 60 in sequence; the two electrophoretograms below the position corresponding to each molecular Marker are amplification electrophoretograms of F2+ R, and the amplification results of lanes of the amplification electrophoretograms of F2+ R from left to right correspond to a molecular weight Marker, SHL03, Megusan I, white beauty, sweet No.3, sweet No.1, sweet 169, sweet white bead, sweet 5788, sweet 2, sweet 3, sweet 5, sweet 16, Yuyunuo No.1 and Shenkotan 811 in sequence.
Detailed Description
The invention provides a development method of a molecular marker and an identification primer group for corn variety protection, which comprises the following steps:
1) sequencing the variety genome to be protected, comparing the sequenced genome with a reference genome B73-V4, and screening a specific variation site sequence as a specific marker to obtain InDel genotype data;
2) respectively designing 3 primers by taking the length of 500bp fragments on the upstream and downstream of each InDel site as a template region for primer design, wherein the 3 primers are respectively a forward primer F1 at the position of 25-50 bp on the upstream of the InDel, a forward primer F2 at the position of the InDel and a reverse primer R at the downstream of the InDel;
3) according to the combinations F1+ R and F2+ R, respectively taking the genomic DNA of the variety to be protected and the genomic DNA of the B73 variety as templates for PCR amplification;
and (3) analyzing an amplification result: when the variety needing protection has fragment insertion relative to the B73 variety, if the amplification band of F1+ R of the variety needing protection is greater than the amplification band of F1+ R of B73, the amplification band of F2+ R of the variety needing protection is present, and the amplification band of F2+ R of B73 is absent, the mutation site can be used as a molecular marker for protecting the corn variety, and primers F1, F2 and R designed according to the mutation site can be used as a primer group for identification;
when the variety needing protection has fragment deletion relative to the B73 variety, if the amplified band of F1+ R of the variety needing protection is less than the amplified band of F1+ R of B73, the amplified band of F2+ R of the variety needing protection is not, and the amplified band of F2+ R of B73, the mutation site can be used as a molecular marker for protecting the corn variety, and the primers F1, F2 and R designed according to the mutation site can be used as a primer group for identification.
The invention provides application of primers or reagents for detecting multiple sites in preparation of a kit for identifying a maize inbred line SHL03 variety, wherein the multiple sites comprise one or more of site 1 to site 14;
the site 1 is the insertion of GGACCAAGGAAACAACCTTT fragment existing at position 250447798 of chromosome 1 in B73-V4 genome with gene accession number Zm00001d 033112;
the site 2 is the insertion of GTAGATTCTTCGCATAGGTTTGA fragment at 925909 site of chromosome 5 in B73-V4 genome with gene accession number Zm00001d 012823;
the 3 site is the insertion of AGAAGAACACTAACAAGGAGGGC fragment at 175783391 site of No.5 chromosome in B73-V4 genome with gene accession number Zm00001d 016784;
the site 4 is an insertion of TCATTGTCATGGCACTCCCCGCT fragment at 144731838 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 037998;
the site 5 is an insertion of CTTCTTTAGGTTGATGTCCCAAC fragment at 160583238 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038589;
the site 6 is an insertion of TCGTTTATTTTTCACATGGTTTT fragment at 165363624 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038830;
the site 7 is an insertion of ACAGTGCAAGAGTTAGGCAGAGA fragment at position 168197981 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038982;
the site 8 is an insertion of GATCTATACTGTCGTTGCTAAAA fragment at 171556729 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 039165;
the site 9 is the insertion of TCGGCATCCCACAAAAGGTTCAA fragment existing at position 125979085 of chromosome 7 in B73-V4 genome with gene accession number Zm00001d 020640;
the site 10 is the insertion of AAAAGAAAGGGAATGAGAAAGAA fragment at position 126392786 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010737;
the site 11 is the insertion of CGCACCCGCTCCAGTCTACCATC fragment existing at position 128352484 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010804;
the site 12 is an insertion of ACGAGGAGAAGGAAGCAAGTAGT fragment existing at position 129099756 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010826;
the site 13 is an insertion of GTCTACTTTGAACTTGCTAGGGC fragment at position 39778284 of chromosome 10 in the B73-V4 genome with the gene accession number Zm00001d 024049;
the site 14 is an insertion of TGCTGCAGACAAGGACGAAAGCC fragment existing at position 135307617 of chromosome 10 in the B73-V4 genome with gene accession number Zm00001d 025985. The invention can determine whether the variety to be detected is the maize inbred line SHL03 variety by detecting whether the variety to be detected has the mutation of the site, thereby protecting the maize inbred line SHL03 variety.
The invention provides a molecular marker primer group for protecting a maize inbred line SHL03 variety, wherein the molecular marker primer comprises one or more groups of primers described in the primer group 1-14;
the primer group 1 comprises: the nucleotide sequence is shown as SEQ ID NO. 1: ACCTCCCTCTCATTCACACT, fKT10F1, the nucleotide sequence of which is shown in SEQ ID NO. 2: AGGTGCCGTACCATTTGGATCTTCTGA, wherein the fKT10F2 and the nucleotide sequence are shown in SEQ ID NO. 3: GGACCAAGGAAACAACCTTT, fKT 10R;
the primer group 2 comprises: the nucleotide sequence is shown as SEQ ID NO. 4: AGCCTCCTCGTCGTTGTTGTTGT, fKT41F1, the nucleotide sequence of which is shown in SEQ ID NO. 5: fKT41F2 of GCCTGCTGTTATAGGTTTTGA and the nucleotide sequence is shown in SEQ ID NO. 6: GTAGATTCTTCGCATAGGTTTGA, fKT 41R;
the primer group 3 comprises: the nucleotide sequence is shown as SEQ ID NO. 7: CAGCAGGAATACCAGACAAAAAT, fKT46F1, the nucleotide sequence of which is shown in SEQ ID NO. 8: GTGATAGCCTGGCTGGACGGTGGATTCACCACC, wherein the fKT46F2 and the nucleotide sequence are shown in SEQ ID NO. 9: fKT46R of AGAAGAACACTAACAAGGAGGGC;
the primer group 4 comprises: the nucleotide sequence is shown as SEQ ID NO. 10: GCATCCCTTCCGTTCCCTCGTCT, fKT56F1, the nucleotide sequence of which is shown in SEQ ID NO. 11: fKT56F2 of ACGGGCGAGGACGATGACATGGAC and the nucleotide sequence is shown in SEQ ID NO. 12: fKT56R of TCATTGTCATGGCACTCCCCGCT;
the primer group 5 includes: the nucleotide sequence is shown as SEQ ID NO. 13: AGTACAAAAAAACTACAGCTTGT, fKT59F1, the nucleotide sequence of which is shown in SEQ ID NO. 14: TTTTCGAGAAAAAAAATTATTCCTGTTAGA, wherein the fKT59F2 and the nucleotide sequence are shown in SEQ ID NO. 15: CTTCTTTAGGTTGATGTCCCAAC, fKT 59R;
the primer group 6 comprises: the nucleotide sequence is shown as SEQ ID NO. 16: CCTTCTCTGATGATAGATGGTCC, fKT61F1, the nucleotide sequence of which is shown in SEQ ID NO. 17: fKT61F2 of AATGTTAGAGCCCTCTGCGGCTTTCTACGGCA and the nucleotide sequence is shown in SEQ ID NO. 18: TCGTTTATTTTTCACATGGTTTT, fKT 61R;
the primer group 7 includes: the nucleotide sequence is shown as SEQ ID NO. 19: GTACGGTTACAAAATAAAAAGGA, fKT64F1, the nucleotide sequence of which is shown in SEQ ID NO. 20: CGATGCACTGAACAAAGAATTAGATGGC, wherein the fKT64F2 and the nucleotide sequence are shown in SEQ ID NO. 21: ACAGTGCAAGAGTTAGGCAGAGA, fKT 64R;
the primer set 8 includes: the nucleotide sequence is shown as SEQ ID NO. 22: fKT65F1 of CATCATCAATCTCCACATCTTCT, and the nucleotide sequence is shown as SEQ ID NO. 23: TCCTCAACAGGACCATTTTCA, wherein the fKT65F2 and the nucleotide sequence are shown in SEQ ID NO. 24: GATCTATACTGTCGTTGCTAAAA, fKT 65R;
the primer set 9 includes: the nucleotide sequence is shown as SEQ ID NO. 25: fKT76F1 of GCGCAAAAATATGGCGTCGTCAC, and the nucleotide sequence is shown as SEQ ID NO. 26: fKT76F2 of CGCAGCAAGGGCCGCTGGCATCGACCTTCGCTGGAA and the nucleotide sequence is shown in SEQ ID NO. 27: TCGGCATCCCACAAAAGGTTCAA, fKT 76R;
the primer set 10 includes: the nucleotide sequence is shown as SEQ ID NO. 28: CAGGAAAAACTCGGATAGGAATA, fKT83F1, the nucleotide sequence of which is shown in SEQ ID NO. 29: GCTCTACGGCCGGGTTCCTGAGAGCTGAGC, fKT83F2 and the nucleotide sequence is shown in SEQ ID NO. 30: AAAAGAAAGGGAATGAGAAAGAA, fKT 83R;
the primer set 11 includes: the nucleotide sequence is shown as SEQ ID NO. 31: fKT84F1 of GGAATTCACCTAAACTTCCCGCC, and the nucleotide sequence is shown as SEQ ID NO. 32: fKT84F2 of TACTTCCTTAATTGAATTCGAAC and the nucleotide sequence is shown in SEQ ID NO. 33: CGCACCCGCTCCAGTCTACCATC, fKT 84R;
the primer set 12 includes: the nucleotide sequence is shown as SEQ ID NO. 34: GTTAGGAGCCATGGGATGGTATG, fKT85F1, the nucleotide sequence of which is shown in SEQ ID NO. 35: TCGAGCTGGAGATGGTATAGC, wherein the fKT85F2 and the nucleotide sequence are shown in SEQ ID NO. 36: ACGAGGAGAAGGAAGCAAGTAGT, fKT 85R;
the primer set 13 includes: the nucleotide sequence is shown as SEQ ID NO. 37: GATTATTTGAAATGCGTATTGGT, fKT106F1, the nucleotide sequence of which is shown in SEQ ID NO. 38: fKT106F2 of CCTTCACTTCTTCCTTTCGGGAATGAACTT and the nucleotide sequence is shown in SEQ ID NO. 39: fKT106R of GTCTACTTTGAACTTGCTAGGGC;
the primer set 14 includes: the nucleotide sequence is shown as SEQ ID NO. 40: TGCCAGGTGTAAGAGCAGAGCGG, fKT111F1, the nucleotide sequence of which is shown in SEQ ID NO. 41: fKT111F2 of CTTCGCCTCTGTGTTGGTCACCAGGGCCAGGTC and the nucleotide sequence is shown in SEQ ID NO. 42: TGCTGCAGACAAGGACGAAAGCC, fKT 111R. The invention screens out mutation sites with specific insertion relative to a reference gene by sequencing genome DNA of a maize inbred line SHL03 variety and comparing the sequenced genome DNA with a reference genome B73-V4, designs two pairs of primers according to each mutation site, screens out a molecular marker primer group for protecting the maize inbred line SHL03 variety by utilizing a PCR amplification method, and the primer group can rapidly and accurately identify the maize inbred line SHL03 variety and the identification result is not influenced by external environment change.
The invention also provides a kit for identifying the maize inbred line SHL03 variety, and the kit comprises the molecular marker primer group.
The invention also provides application of the molecular marker primer group or the kit in identification of maize inbred line SHL03 varieties. The primer group provided by the invention can quickly and accurately identify the maize inbred line SHL03 variety, and the identification result is not influenced by external environment change.
The invention also provides a method for identifying the maize inbred line SHL03 variety, which comprises the following steps:
performing PCR amplification on the genomic DNA of the variety to be detected and the genomic DNA of the SHL03 variety respectively by using the two pairs of primers F1+ R and F2+ R in each primer group to obtain amplification products;
identifying the amplification product, wherein if the amplification products are obtained when two pairs of primers F1+ R and F2+ R in the multiple primer groups of the SHL03 variety are amplified, and the amplification products are obtained when two pairs of primers F1+ R and F2+ R in the multiple primer groups of the variety to be detected are amplified, the variety to be detected is an SHL03 variety;
if the F1+ R and the F2+ R pairs in the multiple primer groups of the SHL03 variety both obtain amplification products during amplification, and the F1+ R and the F2+ R pairs in the multiple primer groups of the to-be-detected variety do not obtain amplification products or obtain amplification products from part of the primer pairs, the to-be-detected variety is not the SHL03 variety.
The method for extracting the genome DNA of the variety to be tested and the SHL03 variety does not have special requirements, and an advanced method which is well known by a person skilled in the art can be adopted.
In the present invention, the plurality of sets of primers preferably include 10 or more sets, and more preferably 14 sets, of the above molecular marker primers. Because the specificity of 14 sites is different, when variety identification is carried out, the accuracy of the identification result can be improved by selecting 10 sites or more than 10 sites for combined identification, and the identification accuracy of the SHL03 material can be improved by adding more sites.
In the present invention, the reaction process of the PCR amplification preferably comprises pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 40s, and the cycle is 35 times; further extension at 72 deg.C for 5 min; the reaction system for PCR amplification is 20. mu.L, preferably comprises 2. mu.L of DNA template, 0.5. mu. L, Easytaq enzyme for each of forward and reverse primers, 0.5. mu.L of dNTP 0.5. mu.L, 10 × Easytaq buffer 2. mu.L and the balance ddH20; the concentration of the DNA template is preferably 30-50 ng/. mu.L, more preferably 40 ng/. mu.L, and the concentration of each of the forward primer and the reverse primer is preferably 10. mu. mol/L. The present invention does not require any special source for each reagent in the reaction system for PCR amplification, and commercially available products known to those skilled in the art may be used.
In the present invention, the method for identifying an amplification product preferably comprises electrophoresis or sequencing, more preferably electrophoresis.
The method provided by the invention is based on the methods of genome second generation high-throughput sequencing, PCR (polymerase chain reaction) method and molecular marker assisted breeding, and the specific molecular marker in the target material is identified; the molecular markers at different positions on the chromosome form a specific combination, and the specific combination is displayed by the result of PCR (presence or absence) strips to form a gene code form so as to achieve the purpose of variety protection; the method provided by the invention is simple to operate, and the result is accurate and reliable.
In order to further illustrate the invention, the molecular marker primers, the kit and the application thereof for the protection of the maize inbred line SHL03 variety provided by the invention are described in detail below with reference to the examples, but they should not be construed as limiting the scope of the invention.
Example 1
The molecular marker primer group for the protection of the maize inbred line SHL03 variety is prepared by the following steps of:
1) carrying out field sampling on the variety SHL03 to be protected, taking 0.1g of leaf tissue sample, placing the leaf tissue sample in a 2ml centrifugal tube, then placing the centrifugal tube in liquid nitrogen for quick freezing, and freezing the sample in an ultra-low temperature refrigerator at minus 80 ℃;
2) taking the sample out of the ultra-low temperature refrigerator, adding one steel ball with the diameter of 6mm and made of 304 materials, then placing the sample in a sample grinding machine, and grinding the sample for 30s at the frequency of 50Hz (the whole process of the step is placed on the ice surface or in liquid nitrogen to keep the temperature at low temperature);
3) extracting plant genome DNA by using a CTAB method, taking 2 mu l of the plant genome DNA, detecting the concentration of the plant genome DNA by using an ultraviolet spectrophotometer, and taking 1 mu l of the plant genome DNA, detecting the quality of the plant genome DNA by using agarose gel electrophoresis;
4) selecting the DNA sample of the SHL03 extracted in the step 3), sending the DNA sample to Beijing Nuo standing grain Sourchin science and technology Co., Ltd for 2-generation sequencing, comparing the sequencing depth of 30 x with a reference genome B73-V4, selecting the frameshift deletion mutation InDel with more than 20bp of InDel as a primer screening region object, and selecting 112 InDel sites in total to obtain InDel genotype data;
5) selecting 500bp fragment lengths of upstream and downstream as a template region for primer design by taking the selected site in the step 4) as a coordinate on a genome;
designing 3 primers according to sites, namely a forward primer F1 at a position of 25-50 bp upstream of InDel, a forward primer F2 at the position of InDel and a reverse primer R at the downstream of InDel, wherein the primers are shown in figure 1; according to the combinations of F1+ R and F2+ R, the genome DNA of SHL03 and the genome DNA of B73 strain are respectively taken as templates for PCR amplification, and different banding patterns can be amplified; the reaction process of the PCR amplification is as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 40s, and circulating for 35 times; further extension at 72 deg.C for 5 min; the reaction system of the PCR amplification is as follows: 2. mu.L of DNA template (concentration: 40 ng/. mu.L), 0.5. mu. L, Easytaq each of forward and reverse primers (concentration: 10. mu. mol/L), 0.5. mu.L of enzyme, 0.5. mu.L of dNTP, 10 XEasytaqbuffer 2. mu.L, and ddH2014 μ L; the phenotype acquisition method comprises the steps of separating PCR products by a PCR amplification method and agarose gel electrophoresis, detecting by a gel imaging system and photographing;
in the case of an insertion (Insert) mutation (the SHL03 material has a fragment insertion relative to B73), if the amplified band for F1+ R of SHL03 > the amplified band for F1+ R of B73; f2+ R of SHL03 is amplified to have a band, F2+ R of B73 is amplified to have no band, and primers F1, F2 and R designed according to the mutation site can be used as identified primer groups;
if the mutation is Deletion mutation, the phenotypes are opposite;
according to the amplification result of PCR, the Insert sites relative to B73-V4 were screened, and the sites and the corresponding primers are shown in Table 1.
TABLE 1 location of different molecular markers and corresponding primers
Example 2
Extracting the genome DNA of the SHL03 strain and the control material respectively by adopting the method of the steps 1) to 3) in the example 1, wherein the specific information of the control material is shown in Table 2;
the primers in table 1 screened in example 1 were used to perform PCR amplification with combinations F1+ R and F2+ R, using genomic DNA of SHL03 and genomic DNA of a control material as templates, respectively, the PCR amplification system and the reaction process were the same as in example 1, and the phenotype was obtained by separating PCR products by PCR amplification method and agarose gel electrophoresis, detecting by a gel imaging system and photographing, and the experimental results are shown in fig. 2 and fig. 3.
TABLE 2 detailed information of different reference materials
| 1 | Shenke glutinous rice No.1 | 16 | Meiguo No. one |
| 2 | Shenke glutinous rice 602 | 17 | White beauty |
| 3 | Shanghai red glutinous rice No.1 | 18 | Hetian No.3 |
| 4 | Huanuo 2000 | 19 | Hexie No.1 |
| 5 | Heyunuo No.1 | 20 | Sheng Tian No.1 |
| 6 | Rongyunuo No.9 | 21 | Saint sweet 169 |
| 7 | Suke glutinous rice 1901 | 22 | Sheng sweet white bead |
| 8 | Jingbai sweet glutinous No.2 | 23 | Shengtian 5788 |
| 9 | Yunuo No.7 | 24 | Sheng Tian No.2 |
| 10 | Black sweet glutinous rice 168 | 25 | Mei Tian No.2 |
| 11 | Shennuo No.8 | 26 | Mei Tian No.3 |
| 12 | Shennuo No.9 | 27 | Suyunuo No.5 |
| 13 | Shennuo No.10 | 28 | Yueyan No.16 |
| 14 | Shanghai sweet No.2 | 29 | Yu sweet glutinous No.1 |
| 15 | Weeding sweet 60 | 30 | Shenketan 811 |
As can be seen from the results of FIGS. 2 and 3, 6-160583238 among the sites detected was the most specific, and the insertion mutation site was present only in SHL03, with very high material representativeness; other sites present relative specificity, in part, spots appearing less frequently in all control materials, e.g., 1-250447798, 5-925909, 6-168197981, 8-126392786, 10-39778284, etc., with higher representativeness of sites; the rest sites have certain representativeness, the specificity of the sites among materials is slightly weak, and the sites have the situation of variation, but the universality does not exist, so the method can be used for variety identification work; due to the difference of the specificity of 14 sites, when the variety identification is carried out, 10 sites or more than 10 sites are selected for combined identification, and the addition of more sites can improve the identification accuracy of the SHL03 material.
In conclusion, the molecular marker primer group provided by the invention can quickly and accurately identify the maize inbred line SHL03 variety, is simple to operate, and the identification result is not influenced by external environment change.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> molecular marker primer group and kit for corn inbred line SHL03 variety protection and application thereof
<160> 42
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
acctccctct cattcacact 20
<210> 2
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aggtgccgta ccatttggat cttctga 27
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggaccaagga aacaaccttt 20
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agcctcctcg tcgttgttgt tgt 23
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcctgctgtt ataggttttg a 21
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtagattctt cgcataggtt tga 23
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cagcaggaat accagacaaa aat 23
<210> 8
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gtgatagcct ggctggacgg tggattcacc acc 33
<210> 9
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
agaagaacac taacaaggag ggc 23
<210> 10
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gcatcccttc cgttccctcg tct 23
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
acgggcgagg acgatgacat ggac 24
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tcattgtcat ggcactcccc gct 23
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
agtacaaaaa aactacagct tgt 23
<210> 14
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ttttcgagaa aaaaaattat tcctgttaga 30
<210> 15
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cttctttagg ttgatgtccc aac 23
<210> 16
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
ccttctctga tgatagatgg tcc 23
<210> 17
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
aatgttagag ccctctgcgg ctttctacgg ca 32
<210> 18
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
tcgtttattt ttcacatggt ttt 23
<210> 19
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
gtacggttac aaaataaaaa gga 23
<210> 20
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
cgatgcactg aacaaagaat tagatggc 28
<210> 21
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
acagtgcaag agttaggcag aga 23
<210> 22
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
catcatcaat ctccacatct tct 23
<210> 23
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
tcctcaacag gaccattttc a 21
<210> 24
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gatctatact gtcgttgcta aaa 23
<210> 25
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gcgcaaaaat atggcgtcgt cac 23
<210> 26
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
cgcagcaagg gccgctggca tcgaccttcg ctggaa 36
<210> 27
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
tcggcatccc acaaaaggtt caa 23
<210> 28
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
caggaaaaac tcggatagga ata 23
<210> 29
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
gctctacggc cgggttcctg agagctgagc 30
<210> 30
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
aaaagaaagg gaatgagaaa gaa 23
<210> 31
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
ggaattcacc taaacttccc gcc 23
<210> 32
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
tacttcctta attgaattcg aac 23
<210> 33
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
cgcacccgct ccagtctacc atc 23
<210> 34
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
gttaggagcc atgggatggt atg 23
<210> 35
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
tcgagctgga gatggtatag c 21
<210> 36
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
acgaggagaa ggaagcaagt agt 23
<210> 37
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
gattatttga aatgcgtatt ggt 23
<210> 38
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
ccttcacttc ttcctttcgg gaatgaactt 30
<210> 39
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
gtctactttg aacttgctag ggc 23
<210> 40
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
tgccaggtgt aagagcagag cgg 23
<210> 41
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
cttcgcctct gtgttggtca ccagggccag gtc 33
<210> 42
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
tgctgcagac aaggacgaaa gcc 23
Claims (10)
1. A development method of a molecular marker and an identification primer group for corn variety protection is characterized by comprising the following steps:
1) sequencing the variety genome to be protected, comparing the sequenced genome with a reference genome B73-V4, and screening a specific variation site sequence as a specific marker to obtain InDel genotype data;
2) respectively designing 3 primers by taking the length of 500bp fragments on the upstream and downstream of each InDel site as a template region for primer design, wherein the 3 primers are respectively a forward primer F1 at the position of 25-50 bp on the upstream of the InDel, a forward primer F2 at the position of the InDel and a reverse primer R at the downstream of the InDel;
3) according to the combinations F1+ R and F2+ R, respectively taking the genomic DNA of the variety to be protected and the genomic DNA of the B73 variety as templates for PCR amplification;
and (3) analyzing an amplification result: when the variety needing protection has fragment insertion relative to the B73 variety, if the amplification band of F1+ R of the variety needing protection is greater than the amplification band of F1+ R of B73, the amplification band of F2+ R of the variety needing protection is present, and the amplification band of F2+ R of B73 is absent, the mutation site can be used as a molecular marker for protecting the corn variety, and primers F1, F2 and R designed according to the mutation site can be used as a primer group for identification;
when the variety needing protection has fragment deletion relative to the B73 variety, if the amplified band of F1+ R of the variety needing protection is less than the amplified band of F1+ R of B73, the amplified band of F2+ R of the variety needing protection is not, and the amplified band of F2+ R of B73, the mutation site can be used as a molecular marker for protecting the corn variety, and the primers F1, F2 and R designed according to the mutation site can be used as a primer group for identification.
2. The application of primers or reagents for detecting multiple loci in the preparation of a kit for identifying the variety of maize inbred line SHL03 is characterized in that the multiple loci comprise one or more of loci 1 to 14;
the site 1 is the insertion of GGACCAAGGAAACAACCTTT fragment existing at position 250447798 of chromosome 1 in B73-V4 genome with gene accession number Zm00001d 033112;
the site 2 is the insertion of GTAGATTCTTCGCATAGGTTTGA fragment at 925909 site of chromosome 5 in B73-V4 genome with gene accession number Zm00001d 012823;
the 3 site is the insertion of AGAAGAACACTAACAAGGAGGGC fragment at 175783391 site of No.5 chromosome in B73-V4 genome with gene accession number Zm00001d 016784;
the site 4 is an insertion of TCATTGTCATGGCACTCCCCGCT fragment at 144731838 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 037998;
the site 5 is an insertion of CTTCTTTAGGTTGATGTCCCAAC fragment at 160583238 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038589;
the site 6 is an insertion of TCGTTTATTTTTCACATGGTTTT fragment at 165363624 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038830;
the site 7 is an insertion of ACAGTGCAAGAGTTAGGCAGAGA fragment at position 168197981 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 038982;
the site 8 is an insertion of GATCTATACTGTCGTTGCTAAAA fragment at 171556729 of chromosome 6 in B73-V4 genome with gene accession number Zm00001d 039165;
the site 9 is the insertion of TCGGCATCCCACAAAAGGTTCAA fragment existing at position 125979085 of chromosome 7 in B73-V4 genome with gene accession number Zm00001d 020640;
the site 10 is the insertion of AAAAGAAAGGGAATGAGAAAGAA fragment at position 126392786 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010737;
the site 11 is the insertion of CGCACCCGCTCCAGTCTACCATC fragment existing at position 128352484 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010804;
the site 12 is an insertion of ACGAGGAGAAGGAAGCAAGTAGT fragment existing at position 129099756 of chromosome 8 in B73-V4 genome with gene accession number Zm00001d 010826;
the site 13 is an insertion of GTCTACTTTGAACTTGCTAGGGC fragment at position 39778284 of chromosome 10 in the B73-V4 genome with the gene accession number Zm00001d 024049;
the site 14 is an insertion of TGCTGCAGACAAGGACGAAAGCC fragment existing at position 135307617 of chromosome 10 in the B73-V4 genome with gene accession number Zm00001d 025985.
3. The molecular marker primer group for the protection of the maize inbred line SHL03 variety is characterized by comprising one or more groups of primers 1-14;
the primer group 1 comprises: fKT10F1 with the nucleotide sequence shown as SEQ ID NO.1, fKT10F2 with the nucleotide sequence shown as SEQ ID NO.2 and fKT10R with the nucleotide sequence shown as SEQ ID NO. 3;
the primer group 2 comprises: fKT41F1 with a nucleotide sequence shown as SEQ ID NO.4, fKT41F2 with a nucleotide sequence shown as SEQ ID NO.5 and fKT41R with a nucleotide sequence shown as SEQ ID NO. 6;
the primer group 3 comprises: fKT46F1 with the nucleotide sequence shown as SEQ ID NO.7, fKT46F2 with the nucleotide sequence shown as SEQ ID NO.8 and fKT46R with the nucleotide sequence shown as SEQ ID NO. 9;
the primer group 4 comprises: fKT56F1 with the nucleotide sequence shown as SEQ ID NO.10, fKT56F2 with the nucleotide sequence shown as SEQ ID NO.11 and fKT56R with the nucleotide sequence shown as SEQ ID NO. 12;
the primer group 5 includes: fKT59F1 with the nucleotide sequence shown as SEQ ID NO.13, fKT59F2 with the nucleotide sequence shown as SEQ ID NO.14 and fKT59R with the nucleotide sequence shown as SEQ ID NO. 15;
the primer group 6 comprises: fKT61F1 with the nucleotide sequence shown as SEQ ID NO.16, fKT61F2 with the nucleotide sequence shown as SEQ ID NO.17 and fKT61R with the nucleotide sequence shown as SEQ ID NO. 18;
the primer group 7 includes: fKT64F1 with the nucleotide sequence shown as SEQ ID NO.19, fKT64F2 with the nucleotide sequence shown as SEQ ID NO.20 and fKT64R with the nucleotide sequence shown as SEQ ID NO. 21;
the primer set 8 includes: fKT65F1 with the nucleotide sequence shown as SEQ ID NO.22, fKT65F2 with the nucleotide sequence shown as SEQ ID NO.23 and fKT65R with the nucleotide sequence shown as SEQ ID NO. 24;
the primer set 9 includes: fKT76F1 with a nucleotide sequence shown as SEQ ID NO.25, fKT76F2 with a nucleotide sequence shown as SEQ ID NO.26 and fKT76R with a nucleotide sequence shown as SEQ ID NO. 27;
the primer set 10 includes: fKT83F1 with the nucleotide sequence shown as SEQ ID NO.28, fKT83F2 with the nucleotide sequence shown as SEQ ID NO.29 and fKT83R with the nucleotide sequence shown as SEQ ID NO. 30;
the primer set 11 includes: fKT84F1 with the nucleotide sequence shown as SEQ ID NO.31, fKT84F2 with the nucleotide sequence shown as SEQ ID NO.32 and fKT84R with the nucleotide sequence shown as SEQ ID NO. 33;
the primer set 12 includes: fKT85F1 with the nucleotide sequence shown as SEQ ID NO.34, fKT85F2 with the nucleotide sequence shown as SEQ ID NO.35 and fKT85R with the nucleotide sequence shown as SEQ ID NO. 36;
the primer set 13 includes: fKT106F1 with the nucleotide sequence shown as SEQ ID NO.37, fKT106F2 with the nucleotide sequence shown as SEQ ID NO.38 and fKT106F 106R with the nucleotide sequence shown as SEQ ID NO. 39;
the primer set 14 includes: fKT111F1 with the nucleotide sequence shown as SEQ ID NO.40, fKT111F2 with the nucleotide sequence shown as SEQ ID NO.41 and fKT111R with the nucleotide sequence shown as SEQ ID NO. 42.
4. A kit for identifying a maize inbred line SHL03 variety, which comprises the molecular marker primer set of claim 3.
5. The use of the molecular marker primer set of claim 3 or the kit of claim 4 for identifying the maize inbred line SHL03 variety.
6. A method for identifying a maize inbred line SHL03 variety is characterized by comprising the following steps:
the primer group of claim 3 is utilized, and the F1+ R and F2+ R pairs of primers in each primer group are respectively used for carrying out PCR amplification on the genomic DNA of the variety to be detected and the SHL03 variety to obtain an amplification product;
identifying the amplification product, wherein if the amplification products are obtained when two pairs of primers F1+ R and F2+ R in the multiple primer groups of the SHL03 variety are amplified, and the amplification products are obtained when two pairs of primers F1+ R and F2+ R in the multiple primer groups of the variety to be detected are amplified, the variety to be detected is an SHL03 variety;
if the F1+ R and the F2+ R pairs in the multiple primer groups of the SHL03 variety both obtain amplification products during amplification, and the F1+ R and the F2+ R pairs in the multiple primer groups of the to-be-detected variety do not obtain amplification products or obtain amplification products from part of the primer pairs, the to-be-detected variety is not the SHL03 variety.
7. The method of claim 7, wherein the plurality of primer sets comprises 10 or more than 10 of the molecular marker primer sets of claim 3.
8. The method of claim 6, wherein the reaction progress of the PCR amplification comprises a pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 40s, and circulating for 35 times; further extension was carried out at 72 ℃ for 5 min.
9. The method as claimed in claim 6 or 8, wherein the reaction system for PCR amplification comprises 2. mu.L of DNA template, 0.5. mu.L of each of forward and reverse primers, 0.5. mu. L, Easytaq of enzyme, 0.5. mu.L of dNTP, 2. mu.L of 10 XEasytaq buffer, and the balance ddH, in 20. mu.L2O。
10. The method of claim 6, wherein the method of identifying the amplification product comprises electrophoresis or sequencing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110907563.9A CN113528620A (en) | 2021-08-09 | 2021-08-09 | Molecular marker primer group and kit for corn inbred line SHL03 variety protection and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110907563.9A CN113528620A (en) | 2021-08-09 | 2021-08-09 | Molecular marker primer group and kit for corn inbred line SHL03 variety protection and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113528620A true CN113528620A (en) | 2021-10-22 |
Family
ID=78090776
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110907563.9A Pending CN113528620A (en) | 2021-08-09 | 2021-08-09 | Molecular marker primer group and kit for corn inbred line SHL03 variety protection and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113528620A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114774566A (en) * | 2022-03-04 | 2022-07-22 | 江汉大学 | Primer pair combination, kit and detection method for detecting cotton transgenic components |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101545004A (en) * | 2008-03-28 | 2009-09-30 | 上海市农业科学院 | Waxy maize inbred line Shen-W22 specific molecular marker and application thereof in offspring variety identification |
| CN102505044A (en) * | 2011-11-10 | 2012-06-20 | 南京农业大学 | Method for quickly identifying genetic purity of glutinous corn hybrid |
| CN108476970A (en) * | 2018-02-14 | 2018-09-04 | 北京市农林科学院 | The method that molecular labeling assists 728 plant type of rapid drop corn Leaf angle improvement Jing Nong sections |
| CN110724758A (en) * | 2019-11-27 | 2020-01-24 | 北京市农林科学院 | Method for identifying purity of Jingnongke 728 corn hybrid based on SNP marker |
-
2021
- 2021-08-09 CN CN202110907563.9A patent/CN113528620A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101545004A (en) * | 2008-03-28 | 2009-09-30 | 上海市农业科学院 | Waxy maize inbred line Shen-W22 specific molecular marker and application thereof in offspring variety identification |
| CN102505044A (en) * | 2011-11-10 | 2012-06-20 | 南京农业大学 | Method for quickly identifying genetic purity of glutinous corn hybrid |
| CN108476970A (en) * | 2018-02-14 | 2018-09-04 | 北京市农林科学院 | The method that molecular labeling assists 728 plant type of rapid drop corn Leaf angle improvement Jing Nong sections |
| CN110724758A (en) * | 2019-11-27 | 2020-01-24 | 北京市农林科学院 | Method for identifying purity of Jingnongke 728 corn hybrid based on SNP marker |
Non-Patent Citations (2)
| Title |
|---|
| 王慧等: "优质广适甜玉米新品种‘申科甜2号’的选育及营养成分分析", 《上海农业学报》 * |
| 胡俏强等: ""逆境严选"鲜食玉米自交系选育方法及育种应用", 《上海农业科技》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114774566A (en) * | 2022-03-04 | 2022-07-22 | 江汉大学 | Primer pair combination, kit and detection method for detecting cotton transgenic components |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112501343B (en) | MNP (MNP) marker primer combination for identifying rape varieties and substantive derived varieties thereof and application of MNP marker primer combination | |
| CN106480228B (en) | The SNP marker and its application of rice low cadmium-accumulation gene OsHMA3 | |
| CN112280881B (en) | SNP (Single nucleotide polymorphism) marker combination for identifying broccoli germplasm resources and varieties and application | |
| CN110106279B (en) | Single-site SSR primer group developed based on Miscanthus formosanus genome sequence and application thereof | |
| CN107012217B (en) | SNP molecular markers for distinguishing bred sesame varieties in China | |
| CN114350841B (en) | Polymorphic molecular marker based on whole genome sequencing, preparation method and application | |
| KR101961653B1 (en) | SNP molecular marker for selecting cultivars of sweet potatoes and uses thereof | |
| CN112391487B (en) | SNP marker for identifying broccoli variety Zhe Qing 75 | |
| CN108220473B (en) | Identification of maize S-type cytoplasmic male sterile material by using chloroplast InDel marker | |
| CN113528620A (en) | Molecular marker primer group and kit for corn inbred line SHL03 variety protection and application thereof | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN112813186A (en) | Soybean core SNP marker based on KASP and application thereof | |
| CN111471790A (en) | Molecular marker closely linked with wheat grain filling rate QT L QGfr. sicau-7D.1 and application thereof | |
| CN116515858A (en) | Peanut early leaf spot resistance major gene AhESR 1 and application of molecular marker thereof | |
| Jie et al. | Genetic diversity and population structure analysis of sand pear (Pyrus pyrifolia)‘Nakai’varieties using SSR and AFLP markers | |
| CN110305981A (en) | The molecular labeling PG1524 and its detection method of a kind of Apricot Fruit hardness key gene and application | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN112226433B (en) | SNP (Single nucleotide polymorphism) site primer combination for identifying white bark pine germplasm resources and application | |
| CN111235301B (en) | Method for identifying authenticity of bitter gourd varieties and special SSR primer combination thereof | |
| CN113789407A (en) | SNP molecular marker combination for cyperus esculentus genotyping and application thereof | |
| CN114058732A (en) | Primer combination for efficiently identifying different alleles of grain weight gene GW5, identification method and application | |
| CN113197089A (en) | Breeding method facilitating early generation selection of soft weak gluten wheat | |
| CN107354203B (en) | Primer combination and kit for identifying cured tobacco Bina No. 1, application and detection method | |
| CN113481313B (en) | Multiple fluorescence SSR (simple sequence repeat) labeled primers and method for identifying three Chinese torreya varieties | |
| CN113736908B (en) | SNP locus combination for detecting tomato leaf mold resistance and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20211022 |