CN101508997A - Wheat salt-sensitive gene TaDi19A and uses thereof - Google Patents

Abstract

The invention provides a wheat salt-sensitivity gene, namely wheat zinc finger protein TaDi19A, a plant expression vector pSTART-Di19A containing the gene TaDi19A, and application of the gene TaDi19A and the plant expression vector of containing the gene TaDi19A in salt resistant plant culture. Experiments prove that the salt resistance of the overexpressed transgene plant is lowered obviously, based on which new variety of salt resistant crops can be cultivated by RNAi strategy.

Description

Wheat salt-sensitive gene TaDi19A and application thereof

Technical field

The invention belongs to technical field of biological genetic engineering, relate in particular to salt-sensitive gene---zinc finger protein gene TaDi19A and application thereof.

Background technology

Salinification land area in the whole world surpasses 800,000,000 hectares, accounts for 6% of the total area.China's soil degree of salinity is even more serious, has 7,000 ten thousand hectares approximately, accounts for 10% of the total area.The soil salinization has a strong impact on crop growth and output.Along with expanding economy, the soil salinization is more and more serious, has become the social concern that a whole world is paid close attention to; Particularly China is populous, and the soil salinization has become the important factor of restriction China's economy and social development.Therefore, cultivating the salt tolerant new crop varieties has become when previous very urgent task.

Except traditional breeding way, utilize new technology such as genetic and cell engineering to obtain have the crop new variety of good salt resistance ability in fast and stable ground.Utilize the transgene improvement plant technology that new proterties is transferred in the crop, develop genetically modified crops new variety efficiently with this, being used for planting in the saltings is a technology with broad prospect of application.Its prerequisite is, must systematically understand plant salt tolerance mechanism, separates relevant with salt tolerant efficiently gene.

For many years, the aspect research of relevant plant salt tolerance mechanism has obtained bigger progress, has cloned a large amount of salt stress genes involveds, provides theoretical clue and foundation for further illustrating plant salt tolerance mechanism.Some experiments show, in gene transferred plant relevant in plant itself and the other biological with salt tolerant, its allos transcribe can the render transgenic plant with translation product saline-alkaline tolerance change.The expression of the goal gene that transforms comprises two aspects: the one, and the gene of raising salt resistance ability can pass through to express or inducible expression improves the plant salt tolerance ability; The 2nd, the salt sensitive gene can improve the plant salt tolerance ability by the constitutive expression of inhibition or induction type inhibition plant itself.

At present, found that some can significantly change the gene of plant salt tolerance ability, wherein major part is the transcription factor genes involved.They can regulate and control the salt resistance ability of plant by the expression of regulating the downstream salt-resistant related gene.Studies show that, these gene transformation in plant, according to their expression characteristics in transfer-gen plant of functionally selective ground control, can obviously be improved the salt resistance ability of plant.

Zinc finger protein is the very important protein of a class, participates in the regulate several biological processes of cell.According to sequence signature, zinc finger protein can be divided into broad variety, and the function of dissimilar zinc finger proteins in cell has significant difference.Existing in recent years test shows that the part zinc finger protein plays a significant role in the plant salt tolerance process.But the effect of zinc finger protein gene in the plant salt tolerance process do not appear in the newspapers as yet under the relevant TaDi19A.

Summary of the invention

At the deficiencies in the prior art, the purpose of this invention is to provide a kind of anti-sensitive gene---wheat zinc finger protein gene TaDi19A and application thereof.

Technical program of the present invention lies in from wheat, separating and obtain zinc finger protein gene---wheat zinc finger protein gene TaDi19A, and make up RNAi carrier or artificial mi RNA carrier and change in the farm crop such as wheat, plant in salinization soil with the realization farm crop, make full use of time matter soil.

Wheat salt-sensitive gene name provided by the invention is called wheat zinc finger protein gene TaDi19A, and the nucleotide sequence of described gene cDNA is shown in SEQ ID No.1.

The present invention also provides the plant expression vector pSTART-Di19A that contains above-mentioned wheat zinc finger protein gene TaDi19A.

Gene TaDi19A of the present invention and the application of plant expression vector pSTART-Di19A in cultivating salt-tolerant plant that contains described gene TaDi19A.Wherein said plant optimization is common wheat or Arabidopis thaliana.

With gene of the present invention, import vegetable cell according to the RNAi strategy, plant just can obtain salt resistance ability.For the ease of transgenic plant or clone are screened, can the plant expression vector pSTART-Di19A that contain described gene TaDi19A be processed, as the antibiotic marker thing (Totomycin that can bring Selection In mark (GUS etc.) or have resistance, kantlex, gentamicin etc.) etc.

Gene of the present invention can be widely used in cultivates salt tolerant farm crop article kind, and can be and deeply illustrate plant salt tolerance mechanism theoretical foundation is provided.

Beneficial effect of the present invention: utilize existing plant gene engineering technology, the present invention clones first and has obtained wheat zinc finger protein gene TaDi19A, and the method that mediates by agrobacterium tumefaciens changes this gene over to Arabidopis thaliana, prove that through comparative analysis the salt resistance ability of transfer-gen plant obviously descends.Can and cultivate the salt tolerant crop new variety by the RNAi strategy Development in view of the above.

Description of drawings

The amplification of Fig. 1 TaDi19A full length gene cDNA sequence is wherein: Marker is λ DNA/ (EcoR I+Hind III); Marker (down together).

Fig. 2 TaDi19A is positioned the PCR result of the short arm of a chromosome 3BS.

Fig. 3 TaDi19A analyzes at the sxemiquantitative RT-PCR that melts in No. 3 on the mountain under the multiple processing.

The Subcellular Localization of Fig. 4 TaDi19A.

Fig. 5 aDi19A transgenic arabidopsis plant PCR identifies.

Wherein: WT: wild-type; VC: transform empty carrier; OE: cross express transgenic plant (down together).

Fig. 6 TaDi19A transgenic arabidopsis plant RT-PCR identifies.

The various seed germination situations of coercing down of Fig. 7 TaDi19A transgenic arabidopsis plant.

The elongation of Fig. 8 TaDi19A transgenic arabidopsis plant seedling phase root is suppressed greater than contrast by salt.

Fig. 9 TaDi19A transgenic arabidopsis plant blossom phase salt tolerance is weaker than contrast.

Coerce the sxemiquantitative RT-PCR result of marker gene in Figure 10 TaDi19A transgenic arabidopsis plant.

Embodiment

The clone of embodiment 1, TaDi19A

1.1 TDi19A5 ' and 3 ' end clone

(1) according to suppressing the TDi19A partial sequence that subtractive library obtains, the design primer;

(2) extract cDNA total length library plasmid, utilize design primer and T3, T7 primer, carry out PCR;

(3) the PCR product is connected to the T carrier, transformed into escherichia coli is chosen the positive colony order-checking;

(4) with the splicing of 5 ' and 3 ' terminal sequence, design upstream and downstream primer is used for the TDi19A full-length clone;

1.2 Wheat Full-length cDNA

1.2.1 wheat RNA extracts

(1) organization material is put into the mortar of liquid nitrogen precooling, abundant grind into powder in liquid nitrogen;

(2) treat that liquid nitrogen volatilization does, transfer to immediately in the centrifuge tube of 2ml that every 100mg material adds 1ml TRIzol extracting solution approximately, after the thawing, inhale repeatedly with the application of sample rifle and to blow that thermal agitation mixing sample makes the abundant cracking of sample, room temperature placement 5 minutes;

(3) add 0.2ml chloroform (chloroform), thermal agitation mixing 15 seconds, room temperature was placed 10 minutes;

(4) 4 ℃, centrifugal 15 minutes of 12000rpm;

(5) with the careful sucking-off of pipettor upper strata water, add in the centrifuge tube of new 1.5ml, add the Virahol (1:1 volume) of 500 μ l, abundant mixing ,-20 ℃, precipitation 30min or spend the night;

(6) 4 ℃, the centrifugal 10min of 12000rpm, careful abandoning supernatant;

(7) RNA precipitation 75% washing with alcohol of 1ml.4 ℃, the centrifugal 10min collecting precipitation of 8000rpm;

(8) repeat with RNA precipitation of 75% washing with alcohol;

(9) remove supernatant, RNA is deposited in and dries about 10-15 minute on the aseptic technique platform, and it is transparent that RNA shows slightly, and the RNase-free water that adds proper volume (30-50 μ l) fully dissolves (can be placed on-80 ℃ of prolonged preservation);

(10) ultraviolet spectrophotometer and 1%Agrose detected through gel electrophoresis RNA concentration and quality.

Annotate: a) use the output of UV spectrophotometer measuring RNA, the absorbancy at the 260nm place, 1OD=40ug/ml.According to light absorption value, detect the purity of RNA, the OD of pure rna at 260nm and 280nm place ₂₆₀/ OD ₂₈₀Ratio should be near 2.0 (ratio be preferably between 1.9～2.1).

B) use the 1%Agrose gel electrophoresis to examine quality and the size of side RNA.Draw the RNase-free water that 1ul RNA adds 3 μ l, add 65 ℃ of sex change of 1 μ l sample-loading buffer 5 minutes.With EB dyeing, the 1kb DNAMarker that other gets 3 μ l in contrast behind the electrophoresis.

1.2.2 cDNA preparation

Utilize the reverse transcription test kit, according to handbook, preparation cDNA.

1.3 TDi19A full-length clone

1. primer sequence: see 1.1 parts.

2.PCR reaction system (50 μ L):

2×GC?buffer 10μl

Template cDNA 1ul

dNTPs(2.5mM?each) 0.5μl

Primer1(10μM) 1μl

Primer2(10μM) 1μl

LA?Taq(TaKaRa) 0.5ul

DdH ₂O adds to final volume 50 μ l

3.PCR response procedures is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 45sec, 55 ℃ of renaturation 45sec, 72 ℃ are extended 1min, circulate 35 times; 72 ℃ are extended 7min.

4. the recovery of amplified fragments, be connected with the T carrier, transformed into escherichia coli, choose positive colony order-checking.The results are shown in Figure 1.

1.4TDi19A the genome of full-length clone location

Extraction and application nullisomic limbs are wheat DNA, utilize the TaDi19A Auele Specific Primer to carry out pcr amplification, and the result shows that TDi19A is positioned at karyomit(e) 3BS.The results are shown in Figure 2.

The expression analysis of embodiment 2, TaDi19A

1. coerce down the extraction of RNA

No. 3 and Jinan 177 normal seed germination are melted in the mountain, and (about 3 time-of-weeks) began to carry out salt stress (200mMNaCl), drought stress (15%PEG), ABA, 6-BA, the processing of cold-peace ethene when the Hoagland nutrient solution was cultured to the about 10cm of plant height.After handling different time, the Trizol method is extracted on seedling root, the leaf RNA.

2. reverse transcription (RT) obtains cDNA

Reverse transcription produces cDNA, and method is the same.

3.PCR reaction and electrophoresis

(1) is template with cDNA, carries out the PCR reaction.Primer is as follows:

5 ' end primer: ATGGACTCGGAGCACTGGAT

3 ' end primer: TCAGTCGTCTCCAAATAAAGTG

(2) PCR system:

ddH ₂O 13.5μl

10×Taq?buffer(Mg2+free) 2μl

MgCl ₂(25mM) 1.2μl

Primer1(10μM) 1μl

Primer2(10μM) 1μl

dNTP(10mM?each) 0.2μl

rTaq?polymerase(5U/μl) 0.1μl

Reverse transcription cDNA template 1 μ l

Total?Volume 20μl

(3) PCR program:

95℃3min，25～30cycles95℃30s，60℃30s，72℃60s；72℃5min.

Determine the cycle number of PCR according to the amplification situation of confidential reference items Actin, adjust the add-on of cDNA template.

(4) 1% agarose gel electrophoresis.The results are shown in Figure 3.

The expression and localization of embodiment 3, TaDi19A

Make up the TDi19A::GFP fusion expression vector, the arabidopsis thaliana transformation protoplastis was cultivated after 1 hour, used fluorescence microscope, carried out the transient expression analysis, determined the Subcellular Localization of TaDi19A.The results are shown in Figure 4.

The structure of embodiment 4, plant expression vector (35S promoter)

Plant expression vector pSTART is the binary vector that contains 35S promoter and NPTII gene, contains restriction enzyme KpnI and SacI site on its multiple clone site.Use restriction enzyme KpnI and SacI double digestion carrier pSTART and goal gene segment respectively.The carrier of complete degestion reclaims, uses the CIAP dephosphorylation through glue after electrophoretic separation on 1% sepharose, links to each other with the cDNA fragment of double digestion then, makes up to obtain plant expression vector.Enzyme is cut system, and transformed into escherichia coli DH10B competence is identified recon.Connection, recovery, conversion and authentication method are the same.

(1) plasmid KpnI and SacI double digestion

The alkaline lysis method of extracting plasmid is respectively got 10 μ g enzymes and is cut, and it is as follows that enzyme is cut system:

KpnI 1μl

SacI 1μl

Plasmid 1 ~ 2 μ l

10×Buffer?K 1μl

ddH ₂O?To 20μl

Cut more than 2 hours in 37 ℃ of thermostat water bath enzymes.Be electrophoretic buffer with 1 * TAE behind the double digestion, enzyme cut product carry out 0.8% agarose gel electrophoresis.Under ultraviolet transilluminator, downcut big fragment of pSTART and goal gene band, reclaim with clean blade.

(2) the big segmental dephosphorization of carrier of plasmid enzyme restriction recovery.

(3) cut through enzyme and carry out 16 ℃ with the carrier segments of dephosphorization and target gene fragment with the ratio of mol ratio 1:4 and be connected and spend the night.

(4) connect product heat shock method transformed into escherichia coli DH10B competent cell, transformed bacteria on the LB solid plate that contains Kan50 μ g/ml 37 ℃ cultivated about 16 hours.

(5) evaluation of recon

1. the PCR of plasmid checking

Picking list bacterium colony is inoculated in 5ml respectively and contains in the LB liquid nutrient medium of Kan 37 ℃ of shaking culture and spend the night, and alkaline denaturation extracts plasmid, carries out pcr amplification with gene specific primer, and system is as follows:

The PCR reaction conditions is as follows: pre-94 ℃ of 3min of sex change, and 35 circulations are: 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 1min, last, 72 ℃ are extended 10min.The PCR product is identified with 1.0% agarose gel electrophoresis.

2. plasmid enzyme restriction is identified

The upgrading grain carries out KpnI and BamHI double digestion, and it is the same that enzyme is cut system.0.8% agarose gel electrophoresis detects the fragment that whether contains expection molecular weight size, the correct structure of checking carrier.

Embodiment 5, the competent preparation of Agrobacterium and conversion

5.1 the competent preparation of Agrobacterium AGL1/EHA105

(1) goes up the single bacterium colony of picking agrobacterium tumefaciens from YEP flat board (containing 50 μ g/ml Rifampins), be inoculated in the YEP liquid nutrient medium that contains 50 μ g/ml Rifampins 200rpm/min, 28 ℃ of overnight incubation.

(2) getting 2ml incubated overnight liquid is inoculated in 50ml and contains in the identical antibiotic YEP liquid nutrient medium and be cultured to OD under the same conditions ₆₀₀Reach 0.5.

(3) bacterium liquid ice bath 30min, 4 ℃, the centrifugal 10min of 5000rpm collects thalline.

(4) thalline is resuspended among the NaCl of 10ml0.15mol/L of ice bath centrifugal collection thalline.

(5) resuspending is divided in bacterium liquid in the 1.5mlEppendorf pipe with 200 μ l/ pipes in the CaCl2 solution of 1ml20mmol/L ice precooling, puts quick-frozen 1min in the liquid nitrogen, and-70 ℃ of preservations are standby.

5.2 freeze-thaw method transforms agrobacterium tumefaciens AGL1/EHA105

(1) at room temperature melts the Agrobacterium competent cell, add 1 μ g expression vector plasmid DNA, ice bath 30min behind the mixing.

(2) put liquid nitrogen flash freezer 1min, move to 37 ℃ of insulation 3min rapidly.

(3) the YEP800 μ l of adding antibiotic-free, 3hr are cultivated in 28 ℃ of concussions.

(4) the centrifugal 30s of 7000rpm collects thalline, is applied on the YEP flat board that contains 50 μ g/ml Rifampins, 50 μ g/ml Kan, is inverted dark the cultivation 2-3 days for 28 ℃.

5.3 thalline PCR identifies

Thalline PCR method and program are the same.

Embodiment 6, Arabidopis thaliana transform and screening

6.1 Arabidopis thaliana plantation

Seed is put into the EP pipe, soak 5min in 70% ethanol, then sanitising agent (20% drift ice (white cat, Shanghai), 0.1%Triton) washing 10-15min, aseptic water washing 4 times, 4 ℃ of vernalization 72h.In the seed that disinfects, add 0.5%agarose and (be cooled to 40 degree in order to avoid seed is scalded dead, adding agarose is to scatter in order to help seed), be laid on the 1/2MS solid medium, dry up on the super clean bench, (can blow for a moment) in order to avoid on the culture dish lid steam is arranged in the seed germination process more.Change in the phytotron and cultivate about a week, can transplant.With pack into the pot of suitable size of artificial soil, 70 degree oven dry (were killed worm's ovum etc. more than 2 hours, otherwise the meeting snake), then pot is placed in the nutritive medium, it is fully absorbed water, to in the artificial soil that is full of nutritive medium, cover preservative film at 7-10 days seedling replanting of growth on the 1/2MS solid medium, and change in the phytotron and cultivate.Throw off preservative film after 1-2 days.Watered a water (watering in iron pan under the POT) every several days.

6.2 Arabidopis thaliana transforms

(1) when Arabidopis thaliana (Colombia's wild-type) inflorescence forms, the inflorescence top is cut to induce the generation of side inflorescence.Before transforming material is irrigated nutritive medium.

(2) transform the day before yesterday, get 2ml activatory Agrobacterium AGL1 and be added to and contain in the corresponding antibiotic 200ml YEP substratum, incubated overnight is to OD ₆₀₀=1.0-1.2.

(3) centrifugal collection thalline, and be resuspended in the dip-dyeing solution (5% sucrose, 0.04% Silwet L-77), make OD ₆₀₀=0.8.

(4) inflorescence was immersed dip-dyeing solution 30 seconds, the swing inflorescence makes and forms a skim on the inflorescence therebetween.

(5) cover inflorescence with preservative film, secretly cultivate after one day and throw off preservative film, cultivate as for 19-22 ℃ of culturing room.

(6) contaminated once with method again every 5-7 days.

(7) gather in the crops seed after about one month.

6.3 it is screening that Arabidopis thaliana transforms positive strain

(1) Shou Huo T0 for seed disinfection after (75% ethanol 5min, detergent wash 10-15min, aseptic water washing 3-5 times), be laid on the MS screening culture medium that contains 50 μ g/mL Kan or 50 μ g/mL Hygo (method is the same).

(2) 4 ℃ of vernalization 48h move on to phytotron growth 7-10 days.The resistance seedling is moved on to continued growth in the soil.

(3) etc. the most petals of plant pod has as a result been tied up the plant individual plant with marline, so that individual plant is gathered in the crops T1 for seed.

(4) pcr amplification is a template with the genomic dna of transformation plant, uses gene specific primer.PCR reaction system and reaction conditions see before.The results are shown in Figure 5.

(5) the T1 seed treatment is the same, selects resistance in for plant than the single independent strain system that inserts for 3:1 at T2.

(6) the RT-PCR checking shows that TaDi19A is normal expression in transformed plant.The results are shown in Figure 6.

Embodiment 7, commentaries on classics TaDi19A Arabidopis thaliana resistance are analyzed

7.1 germination rate is measured

To contrast, change empty carrier, change TaDi19A Arabidopis thaliana seed after sterilization (method is the same), and implant and contain NaCl, ABA, N.F,USP MANNITOL and H ₂O ₂The MS substratum in, 25 degree are cultivated, and observe the sprouting situation.The results are shown in Figure 7.

7.2 the plant resistance is analyzed

(1) Arabidopis thaliana seed disinfection, sprouting (method is the same);

(2) will sprout 4 days seedling and transfer to contain among the 125mM NaCl and vertically cultivate in the MS substratum, observe growth of seedling difference.The results are shown in Figure 8.

(3) earth culture 3 all left and right sides transfer-gen plants in flowering period and contrast are irrigated processing with 200mM NaCl, observe plant salt tolerant situation.The results are shown in Figure 9.

7.3 change the relevant Marker genetic analysis of salt tolerant in the TaDi19A Arabidopis thaliana seedling

(1) Arabidopis thaliana seed disinfection, sprouting, cultivation (method is the same);

(2) after salt, drought, ABA handle, extract root, leaf RNA, reverse transcription forms cDNA, carries out RT-PCR and analyzes.Method the results are shown in Figure 10 with embodiment 2.

Sequence table

＜110〉Shandong University

＜120〉wheat salt-sensitive gene TaDi19A and application thereof

<141>2009-2-17

<160>1

<210>1

<211>747

<212>cDNA

＜213〉wheat

＜221〉wheat salt-sensitive gene TaDi19A gene

<222>(1)…(747)

<400>1

Claims (5)

1. wheat salt-sensitive gene TaDi19A, it is characterized in that: the nucleotide sequence of described gene cDNA is shown in SEQID No.1.

2. plant expression vector pSTART-Di19A who contains the described gene TaDi19A of claim 1.

3. the application of the described gene TaDi19A of claim 1 in cultivating salt-resistant plant.

4. the application of the described plant expression vector pSTART-Di19A of claim 2 in cultivating salt-resistant plant.

5. as claim 3 or 4 described application, it is characterized in that: described plant is common wheat or Arabidopis thaliana.

Images