CN101503687A - Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use - Google Patents
Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use Download PDFInfo
- Publication number
- CN101503687A CN101503687A CNA2008101596473A CN200810159647A CN101503687A CN 101503687 A CN101503687 A CN 101503687A CN A2008101596473 A CNA2008101596473 A CN A2008101596473A CN 200810159647 A CN200810159647 A CN 200810159647A CN 101503687 A CN101503687 A CN 101503687A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- peptide
- gene
- shi
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Farming Of Fish And Shellfish (AREA)
Abstract
The invention discloses a Procambarus clarkii astacidin antibacterial peptide gene and coded antibacterial peptide thereof, and also discloses application of the Procambarus clarkii astacidin antibacterial peptide gene in preparing recombinant protein with antibacterial activity. The antibacterial peptide of recombinant Procambarus clarkii astacidin obtained through gene expression can be used in antibacterial feed additives, food preservation, animal-plant gene transformation, drug development and other fields.
Description
Technical field
The present invention relates to a kind of Ah peptide west pyridine antibacterial peptide gene and coded antimicrobial polypeptide and application thereof, relate in particular to the former huge legendary turtle shrimp of a kind of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide gene and coded antimicrobial polypeptide thereof and described gene and have application in the recombinant protein of anti-microbial activity in preparation; Belong to gene engineering technology field.
Background technology
The former huge legendary turtle shrimp of Ke Shi (Procambarus clarkii) is commonly called as freshwater crayfish, is the important aquaculture kind of China.The small lobsters delicious flavour, constituent content height such as phosphorus, calcium, iron, the protein content height, and lipid content is low, is the very high economical aquaculture kind of a kind of nutritive value.And the extract of the shrimp shell of small lobsters is in industry, agricultural, and value has a wide range of applications in medicine and the chemical industry.Therefore, the research of disease prevention of small lobsters and treatment aspect is especially important.Small lobsters is stronger to the adaptive faculty of environment, and various epidemic diseases are had certain resistivity, and the antibacterial peptide of Given this studying small lobsters has important effect for the disease-resistant mechanism that we understand shrimps.
Arthropodan immune defense such as shrimps mainly depends on the activity of hemocyte, comprises the activation of pro-phenoloxidase system, the initial and antibacterial peptide of aggegation system synthetic.
(JBC such as Lee So Young, 2003) report freshwater crayfish (Pacifastacus leniusculus) the hemocyanin antibacterial peptide astacidinl that hydrolysis C-end produces under acidic conditions, has broad-spectrum antibacterial activity, can suppress the growth of gram-positive microorganism and negative bacterium, injection lipopolysaccharides or peptidoglycan can quicken hemocyanin and be decomposed into astacidinl in the small lobsters body; Antibacterial peptide astacidin2 in the hemocyte that (Developmental and ComparativeImmunology, 2007) such as Pikul Jiravanichpaisal are reported in freshwater crayfish (P.leniusculus) and the hemopoietic tissue with 3 with the different effect of crust peptide (crustins) in the small lobsters immune response.
Many studies show that, in shrimps constant pitch main drive thing, there be multiple albumen or the peptide class that can resist extraneous pathogenic micro-organism, as the prawn element, crust peptide (crustins) contains the antibacterial peptide gene (SWD) of single whey acidic protein structure domain and coagulogen (ALF) etc.But in relevant report, do not see the report of Ah peptide's west pyridine antibacterial peptide gene that the former huge legendary turtle shrimp of Ke Shi is arranged.Although in small lobsters (P.leniusculus), found similar gene abroad, there are not the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide gene and recombinant expressed and report functional study thereof so far both at home and abroad yet.
Summary of the invention
At present research situation and deficiency thereof, the problem to be solved in the present invention provides the former huge legendary turtle shrimp of a kind of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide gene and coded antimicrobial polypeptide and described gene thereof and has application in the recombinant protein of anti-microbial activity in preparation.
The present invention clones from the former huge legendary turtle shrimp of Ke Shi and has obtained Ah peptide west pyridine gene, but and to its research of carrying out character, genetic expression and location and aspect such as recombinant expressed, obtained to have the reorganization Ah peptide west pyridine (astacidin) of broad spectrum antibiotic activity.
The former huge legendary turtle shrimp of Ke Shi of the present invention Ah peptide west pyridine antibacterial peptide gene, its nucleotide sequence is shown in SEQ ID NO.1, and information shown in it is:
(a) sequence signature:
* length: 893 base pairs
* type: nucleic acid
* chain: two strands
* topological framework: linearity
(b) molecule type: cDNA
(c) suppose: not
(d) antisense: not
(e) initial source: the former huge legendary turtle shrimp of Ke Shi (Procambarus clarkii)
(f) sequence description: SEQ ID NO.1
acttgtggag?cgactgactg?ctgaagcaca?attgttacaa?gccccaacaa?ctctatacca 60
ccaccatgcg?tcttctccat?ctcctgctga?gtgttgccct?cgttgctctt?atggccgccg 120
tcccatccca?ggcgtccaat?ggttaccgtc?ccgcctaccg?tcctgcctac?cgtcctagct 180
accgtccagg?caagtaagag?cgtgaagtaa?cactcccgga?cggcttccct?tccctcttgg 240
ctggtcctct?accatcacca?gccacacctc?cgcctccagc?cacacctcca?tctacaacag 300
gcatgcgata?atcggtattc?actatctaca?aatgttgatc?gctatcatcc?agaggttcaa 360
gagcaagtag?gccgacgtcc?gccgatatgt?cagccgtccg?agaaaccaag?gtggtcaggc 420
gtatggctgc?tgacccctgc?tcacgtctcc?cgttgatgtc?ctcctttgac?tgacttcagt 480
taactgatct?gaactgacct?cgctaattga?cttggttact?actttgtctt?cattccttct 540
atgagagagg?ttcacctgcc?catcatcatt?attttcatga?cgttgagaaa?ggcaggtgta 600
ctaggcttgt?gtaaatctgg?agtcttaata?atttgaaacc?tttgaacctc?tccgtacaca 660
tcaaaactgt?tcacatcttt?tgtgttttgg?tcgttaaaat?ttaaatttag?cttaattttg 720
tgtccacatt?tgaagacctt?tgctgttaag?aaataattta?ggcaatattt?taaataattt 780
ccataataaa?ttccacaatt?tatgagtaaa?tgcaaaggcg?tcctctcctg?cactgtctta 840
agtccttctt?gtgtcaataa?agagcattat?atcatggcaa?aaaaaaaaaa?aaa 893。
The antibacterial peptide of the former huge legendary turtle shrimp of Ke Shi of the present invention Ah peptide west pyridine (astacidin) antibacterial peptide gene coding, its aminoacid sequence is shown in SEQ ID NO.2, and information shown in it is:
(a) sequence signature
* length: 43 amino acid
* type: amino acid
* chain: strand
* topological framework: linearity
(b) molecule type: protein
(c) sequence description: SEQ ID NO.2
Met?Arg?Leu?Leu?His?Leu?Leu?Leu?Ser?Val?Ala?Leu?Val?Ala?Leu
5 10 15
Met?Ala?Ala?Val?Pro?Ser?Gln?Ala?Ser?Asn?Gly?Tyr?Arg?Pro?Ala
20 25 30
Tyr?Arg?Pro?Ala?Tyr?Arg?Pro?Ser?Tyr?Arg?Pro?Gly?Lys
35 40
The varient of aminoacid sequence shown in the SEQ ID NO.2 of the present invention is characterized in that: its coding has the homologous variation albumen that is less than 8 amino acid changes, and amino acid change is that conservative amino acid changes.
The cloning process of the former huge legendary turtle shrimp of Ke Shi of the present invention Ah peptide west pyridine antibacterial peptide gene cDNA is:
Adopt single stage method or RNA kit from the former huge legendary turtle shrimp of Ke Shi, to extract total RNA, perhaps use mRNA kit separation and Extraction mRNA; Utilize total RNA or mRNA reverse transcription to synthesize cDNA then;
Wherein: the primer according to the design of the conserved sequence of the former huge legendary turtle shrimp of Ke Shi astacidin antibacterial peptide gene is:
Forward primer: F1 5 ' CTC GTT GCT CTT ATG GCC GCC G 3 '
Reverse primer: R1 5 ' CAT TTG TAG ATA GTG AAT ACC G 3 '
The PCR reaction conditions is: at first 94 ℃ of sex change are 2 minutes, enter following circulation then: 94 ℃ 30 seconds, 53 ℃ 45 seconds, 72 ℃ 45 seconds, carry out 30 circulations altogether, last 72 ℃ were extended 10 minutes.
Purifying obtains dna fragmentation by chain polymerization enzyme reaction (PCR) amplification;
Get above-mentioned purified product and be cloned into pMD18-T carrier (TaKaRa company product), transform DH5 α cell (common carrier host cell), the dull and stereotyped cultivation;
Extract and plasmid purification amplification plasmid and order-checking;
Through 3 ' and 5 ' terminal rapid amplifying,, promptly get the Ah peptide of the former huge legendary turtle shrimp of Ke Shi shown in SEQ ID NO.1 west pyridine antibacterial peptide gene full length nucleotide sequence again with the splicing of 3 ' and 5 ' terminal sequence.
Pyridine (astacidin) antibacterial peptide gene in the former huge legendary turtle shrimp of Ke Shi of the present invention Ah peptide west has application in the recombinant protein of anti-microbial activity in preparation.
Wherein, the method for described application is by gene recombination technology described gene to be expressed in intestinal bacteria, yeast or insect nuclear polyhedrosis virus, obtains to have the recombinant protein of anti-microbial activity.
For example: the former huge legendary turtle shrimp of the Ke Shi Ah peptide west pyridine antibacterial peptide gene antibacterial peptide gene that obtains is cloned into pGEX4T-1 (Novagen company) expression vector, transformed into escherichia coli BL21 cell, carry out abduction delivering, obtain to have the recombinant protein (being the antibacterial peptide of the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide gene coding) of anti-microbial activity.
The result who carries out bacteriostatic experiment behind the recombinant protein purification of described anti-microbial activity shows: the former huge legendary turtle shrimp of the Ke Shi of reorganization Ah peptide west pyridine antibacterial peptide gene polypeptide expressed has the active (see figure 2) of anti-leather Lan Shi negative bacterium and positive bacteria.
Further, utilize method of the present invention to modify the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide gene and also can be used for other researchs and production by existing gene engineering method; For example: can be used for antibacterial feed additive, Food preservation, animal-plant gene conversion and drug development etc.
Description of drawings
Fig. 1 electrophorogram behind the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) the antibacterial peptide purifying of recombinating
Wherein: 1 induces the supernatant liquor electrophoresis result after the cytoclasis of back, and 2 induce the precipitation electrophoresis result after the cytoclasis of back, the former huge legendary turtle shrimp of the Ke Shi of 3 purifying Ah peptide west pyridine antibacterial peptide electrophoresis result, M protein standard molecular weight marker.
The bacteriostatic experiment of the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide of Fig. 2 reorganization
Wherein: A is the fungistatic effect of the antibacterial peptide of different concns to bacillus megaterium;
B is the fungistatic effect of the antibacterial peptide of different concns to Vibrio anguillarum.
Embodiment
Embodiment 1: the clone of the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide cDNA
1) extraction of total RNA: adopt the prior art single stage method to extract total RNA.
2) cDNA first chain is synthetic: the total RNA of 4 microlitres, add 1 microlitre SmartF and 1 microlitre OligoanchorR, 72 ℃ were reacted 5 minutes, after add 5 times of Buffer4 microlitres, the dNTP1.25 microlitre, RNA enzyme inhibitors 0.625 microlitre, 1 microlitre MMLV reversed transcriptive enzyme, 42 ℃ of reactions of aqua sterilisa 12.875 microlitres of no RNase 60 minutes, 70 ℃ of 10 minutes termination reactions.
3) PCR reaction: chain polymerization enzyme reaction (PCR) reagent and condition:
At first following reagent is mixed:
10xTaq dna polymerase buffer liquid 5 microlitres (μ l)
Template cDNA 1 μ l
Forward primer (10mM) 1 μ l
Reverse primer (10mM) 1 μ l
Deoxynucleoside acid mixture (dNTP) 4 μ l
Taq archaeal dna polymerase 0.25 μ l
Aqua sterilisa 37.75 μ l
Cumulative volume 50 μ l
Primer according to the conserved sequence design of the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide is:
Forward primer: F15 ' CTC GTT GCT CTT ATG GCC GCC G 3 '
Reverse primer: R15 ' CAT TTG TAG ATA GTG AAT ACC G 3 '
The PCR reaction conditions is: at first 94 ℃ of sex change are 2 minutes, enter following circulation then: 94 ℃ 30 seconds, 53 ℃ 45 seconds, 72 ℃ 45 seconds, carry out 35 circulations altogether, last 72 ℃ were extended 10 minutes.
4) reaction product purifying: utilize the product QIAquick Gel Extraction Kit of German Quinn (QIAGEN) company, operation steps is undertaken by product description.
5) the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide cDNA clone: get purified product 3 microlitres, be connected in pMD18-T carrier (TaKaRa company product).Be transformed into e.colistraindh5, in the dull and stereotyped grow overnight that contains penbritin (100 mcg/ml), 5-bromo-4-chloro-3-indoles-β-D-galactoside (X-gal0.2 mcg/ml) and isopropylthiogalactoside (IPTG0.1 mole/milliliter), 3 hickies of picking, overnight incubation in LB liquid nutrient medium (5 milliliters contain 100 mcg/ml peace penicillin G).
6) plasmid purification: collect 2 milliliters of incubated overnight bacterium liquid, centrifugal (6000 rev/mins, 3 minutes) collecting cell.With minim DNA purification kit (Wizard plus SV Minipreps DNA Purification System, U.S. Pu Luomaige Promega company) plasmid purification, the purification step by specification carries out.
7) sequencing and homology retrieval: get plasmid purification 4 microlitres, with carrier primer T7 automatically check order (originally being operated in Shanghai life worker company finishes).Institute's calling sequence and gene pool sequence are compared.
8) the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide cDNA 3 ' end rapid amplifying
According to the antibacterial peptide gene fragment that obtains, forward primer F1 carries out cDNA 3 ' end rapid amplifying, and operation steps is undertaken by precious biological 3 ' RACE test kit specification sheets.
Get the about 20 μ g of the total RNA of hemocyte, the modulation of other reagent and reaction conditions by specification carry out.Carry out 3 ' end pcr amplification with Auele Specific Primer F3 and 3 ' joint, adopt 56 ℃ of annealing, all the other are identical with above-mentioned pcr amplification program, and products therefrom is cloned, verified and check order by preceding method.
9) the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide cDNA5 ' end clone
Utilize total RNA of above-mentioned acquisition, press the SMART of CLONTECH company (U.S.)
TMIt is synthetic that PCR cDNA library construction test kit specification sheets carries out the first chain cDNA.
With above-mentioned cDNA is template, and 5 ' the PCR primer and the reverse primer R1 that provide with test kit are that primer carries out pcr amplification, obtains the 5 ' sequence of the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide cDNA.
With the splicing of 3 ' and 5 ' terminal sequence, promptly obtain the Ah peptide of the former huge legendary turtle shrimp of Ke Shi shown in SEQ ID NO.1 west pyridine antibacterial peptide cDNA full length gene nucleotide sequence.
Embodiment 2: Ah peptide's west pyridine (astacidin) recombinant expression vector structure, expression and bacteria resistance function are measured
(1) according to the sequence of the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide and the cloning site of expression vector pGEX4T-1 (Novagen company), the design primer:
ExF:TACTCA
GAATTCTCCAATGGTTACCGTCCCG (underscore is EcoR I site)
ExR:TACTCA
CTCGAGTTACTTGCCTGGACGGTA (underscore is the XhoI site)
The present invention has selected the EcoR I and the Xho I restriction enzyme site of pGEX4T-1 cloning site, therefore, has introduced EcoR I restriction enzyme site at upstream primer during the design primer, has introduced Xho I restriction enzyme site on the downstream primer.
(2) gene amplification, clone and recombinant plasmid screening
With pMD-18T-Ah peptide west pyridine is template, carries out the PCR reaction with above-mentioned primer, and amplification condition is: 94 ℃, and the pre-sex change of 2min; 94 ℃, 30s, 55 ℃, 45s, 72 ℃, 45s, 35 circulations; 72 ℃ are extended 10min.
2% agarose gel electrophoresis PCR product detects.
The PCR product is used as the preparation electrophoresis, with UNIQ-5Column DNA Gel Extraction Kit (chemical product is given birth in Shanghai) recovery, purified pcr product, through EcoR I and Xho I endonuclease digestion, same expression vector pGEX4T-1 exposes the Xho I and the EcoR I restriction enzyme site at multiple clone site two ends through EcoR I and %ho I endonuclease digestion.Then, the amplified production after enzyme cut is connected with the T4 dna ligase with expression vector, transforms DH5 α competent cell, the dull and stereotyped PCR screening positive clone of LB+Amp.The bacterium colony that picking PCR is sieved to, 37 ℃ of vibrate amplification cultivation and extracting plasmids after EcoR I and Xho I double digestion and the sequence verification, are recombinant expression plasmid pGEX4T-1-Ah peptide west pyridine.Switching through E.coli expression strain BL21 competent cell, coating LB+Amp flat board is inverted incubated overnight for 37 ℃.
(3) screening expression strain
8 mono-clonal bacterium colonies of picking from the above-mentioned LB+Amp flat board, 37 ℃ of shaken overnight of 2ml LB+Amp liquid nutrient medium are cultivated, and get 20 μ l incubated overnight liquid and join the transfer of 2ml LB+Amp liquid nutrient medium and cultivate next day, and 37 ℃ of shaking culture 3h are to OD
600Between 0.5～0.7, add then IPTG to final concentration be 1mM, continue 37 ℃ of shaking culture abduction delivering 4h.Before inducing, from a sample, take out 0.5ml bacterium liquid at random, do not induce contrast during electrophoresis detection.
After having expressed, respectively get 0.5ml bacterium liquid, the centrifugal 3min collecting cell of 6000r/min comprises not inductive sample, is resuspended in the 100 μ l deionized waters, makes 12.5% SDS-PGAE as the electrophoresis sample.According to electrophoresis result, identify expression strain.
(5) the former huge legendary turtle shrimp of reorganization Ke Shi Ah peptide west pyridine (astacidin) peptide expression and purifying
Picking expression strain mono-clonal 37 ℃ of overnight shakings in the LB+Amp liquid nutrient medium are cultivated, next day, join the transfer of 100ml LB+Amp substratum at 1: 100 according to volume ratio and cultivate, behind 37 ℃ of shaking culture 3h, adding IPTG again is 0.5mmol to final concentration, 37 ℃ of vibration inducing culture 4h again.Take out the bacterium liquid of 0.5ml before inducing, as inducing preceding control sample.After inducing culture is intact, the centrifugal 10min collecting cell of bacterium liquid 6000r/min in suitable centrifuge tube, cell is resuspended in 1 * PBS of 5ml precooling, adds the Triton X-100 of 50 μ l20%, fully ice bath 30min behind the mixing.The ultrasonic disruption cell, ultrasonic circulating is: ultrasonic 1s; Interval 1s; Omnidistance 40s.Repeat 4 times, with bacterium liquid mixing in ice bath, avoid local temperature too high during each gap, make protein denaturation.At last, with the centrifugal 20min of bacterium liquid 10000r/min after the fragmentation, collect supernatant liquor and precipitation, supernatant liquor and precipitation keep sample respectively, and be standby.
The electrophoresis result of supernatant liquor after inducing after the cytoclasis and the former huge legendary turtle shrimp of the Ke Shi Ah peptide of precipitation and purifying west pyridine antibacterial peptide is seen Fig. 1.
(6) the recombinant protein bacteriostatic activity is measured
Detect bacteriostatic activity with cup-plate method, method is as follows:
Solid plate preparation: lower floor's glue of solid plate is 1.5% agar of one deck 0.5～1cm thickness, upper strata glue is the low bacterial nutrition substratum (1%tryptone of the 8mL solid that contains 5 μ L logarithmic phase bacteriums of 0.5～1cm thickness, 0.5%NaCl, 1.5%Agar, pH7.5).Level leaves standstill, and cooling is standby.
A plurality of Oxford cuvettes (as Fig. 2) through sterilization are placed in design on above-mentioned solid plate, mark is carried out in bottom surface at flat board, get 50 μ L testing samples (containing the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide) respectively, add in the cuvette of corresponding Oxford, overnight incubation is left standstill in 28 ℃ of fronts, observe fungistatic effect, measure antibacterial circle diameter.
Experimental result: the former huge legendary turtle shrimp of the Ke Shi of reorganization of the present invention Ah peptide west pyridine antibacterial peptide has tangible fungistatic effect (see figure 2) to Vibrio anguillarum or bacillus megaterium.
＜110〉Shandong University
＜120〉antibacterial peptide and the application of the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide gene and coding thereof
<141>2008-10-30
<160>6
<210>1
<211>893
<212>cDNA
＜213〉the former huge legendary turtle shrimp of Ke Shi (Procambarus clarkii)
＜221〉the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide gene
<222>(1)…(893)
<400>1
acttgtggag?cgactgactg?ctgaagcaca?attgttacaa?gccccaacaa?ctctatacca 60
ccaccatgcg?tcttctccat?ctcctgctga?gtgttgccct?cgttgctctt?atggccgccg 120
tcccatccca?ggcgtccaat?ggttaccgtc?ccgcctaccg?tcctgcctac?cgtcctagct 180
accgtccagg?caagtaagag?cgtgaagtaa?cactcccgga?cggcttccct?tccctcttgg 240
ctggtcctct?accatcacca?gccacacctc?cgcctccagc?cacacctcca?tctacaacag 300
gcatgcgata?atcggtattc?actatctaca?aatgttgatc?gctatcatcc?agaggttcaa 360
gagcaagtag?gccgacgtcc?gccgatatgt?cagccgtccg?agaaaccaag?gtggtcaggc 420
gtatggctgc?tgacccctgc?tcacgtctcc?cgttgatgtc?ctcctttgac?tgacttcagt 480
taactgatct?gaactgacct?cgctaattga?cttggttact?actttgtctt?cattccttct 540
atgagagagg?ttcacctgcc?catcatcatt?attttcatga?cgttgagaaa?ggcaggtgta 600
ctaggcttgt?gtaaatctgg?agtcttaata?atttgaaacc?tttgaacctc?tccgtacaca 660
tcaaaactgt?tcacatcttt?tgtgttttgg?tcgttaaaat?ttaaatttag?cttaattttg 720
tgtccacatt?tgaagacctt?tgctgttaag?aaataattta?ggcaatattt?taaataattt 780
ccataataaa?ttccacaatt?tatgagtaaa?tgcaaaggcg?tcctctcctg?cactgtctta 840
agtccttctt?gtgtcaataa?agagcattat?atcatggcaa?aaaaaaaaaa?aaa 893
<210>2
<211>43
<212>PRT
＜221〉antibacterial peptide of the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide gene coding
<222>(1)…(43)
<400>2
Met?Arg?Leu?Leu?His?Leu?Leu?Leu?Ser?Val?Ala?Leu?Val?Ala?Leu
5 10 15
Met?Ala?Ala?Val?Pro?Ser?Gln?Ala?Ser?Asn?Gly?Tyr?Arg?Pro?Ala
20 25 30
Tyr?Arg?Pro?Ala?Tyr?Arg?Pro?Ser?Tyr?Arg?Pro?Gly?Lys
35 40
<210>3
<211>22
<212>DNA
＜213〉artificial sequence
＜221〉F1 (forward primer)
<400>3
ctcgttgctc?ttatggccgc?cg 22
<210>4
<211>22
<212>DNA
＜213〉artificial sequence
＜221〉R1 (reverse primer)
<400>4
catttgtaga?tagtgaatac?cg 22
<210>5
<211>31
<212>DNA
＜213〉artificial sequence
＜221〉ExF (upstream primer)
<400>5
tactcagaat?tctccaatgg?ttaccgtccc?g?31
<210>6
<211>30
<212>DNA
＜213〉artificial sequence
＜221〉ExR (downstream primer)
<400>6
tactcactcg?agttacttgc?ctggacggta 30
Claims (4)
1. the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine (astacidin) antibacterial peptide gene, its nucleotide sequence is shown in SEQ ID NO.1, and information shown in it is:
(a) sequence signature:
* length: 893 base pairs
* type: nucleic acid
* chain: two strands
* topological framework: linearity
(b) molecule type: cDNA
(c) suppose: not
(d) antisense: not
(e) initial source: the former huge legendary turtle shrimp of Ke Shi (Procambarus clarkii)
(f) sequence description: SEQ ID NO.1
acttgtggag?cgactgactg?ctgaagcaca?attgttacaa?gccccaacaa?ctctatacca?60
ccaccatgcg?tcttctccat?ctcctgctga?gtgttgccct?cgttgctctt?atggccgccg?120
tcccatccca?ggcgtccaat?ggttaccgtc?ccgcctaccg?tcctgcctac?cgtcctagct?180
accgtccagg?caagtaagag?cgtgaagtaa?cactcccgga?cggcttccct?tccctcttgg?240
ctggtcctct?accatcacca?gccacacctc?cgcctccagc?cacacctcca?tctacaacag?300
gcatgcgata?atcggtattc?actatctaca?aatgttgatc?gctatcatcc?agaggttcaa?360
gagcaagtag?gccgacgtcc?gccgatatgt?cagccgtccg?agaaaccaag?gtggtcaggc?420
gtatggctgc?tgacccctgc?tcacgtctcc?cgttgatgtc?ctcctttgac?tgacttcagt?480
taactgatct?gaactgacct?cgctaattga?cttggttact?actttgtctt?cattccttct?540
atgagagagg?ttcacctgcc?catcatcatt?attttcatga?cgttgagaaa?ggcaggtgta?600
ctaggcttgt?gtaaatctgg?agtcttaata?atttgaaacc?tttgaacctc?tccgtacaca?660
tcaaaactgt?tcacatcttt?tgtgttttgg?tcgttaaaat?ttaaatttag?cttaattttg?720
tgtccacatt?tgaagacctt?tgctgttaag?aaataattta?ggcaatattt?taaataattt?780
ccataataaa?ttccacaatt?tatgagtaaa?tgcaaaggcg?tcctctcctg?cactgtctta?840
agtccttctt?gtgtcaataa?agagcattat?atcatggcaa?aaaaaaaaaa?aaa 893。
2. the antibacterial peptide of the former huge legendary turtle shrimp of the described Ke Shi of claim 1 Ah peptide west pyridine antibacterial peptide gene coding, its aminoacid sequence is shown in SEQ ID NO.2, and information shown in it is:
(a) sequence signature
* length: 43 amino acid
* type: amino acid
* chain: strand
* topological framework: linearity
(b) molecule type: protein
(c) sequence description: SEQ ID NO.2
Met?Arg?Leu?Leu?His?Leu?Leu?Leu?Ser?Val?Ala?Leu?Val?Ala?Leu
5 10 15
Met?Ala?Ala?Val?Pro?Ser?Gln?Ala?Ser?Asn?Gly?Tyr?Arg?Pro?Ala
20 25 30
Tyr?Arg?Pro?Ala?Tyr?Arg?Pro?Ser?Tyr?Arg?Pro?Gly?Lys
35 40
3. the varient of aminoacid sequence shown in the described SEQ ID of claim 2 NO.2 is characterized in that: its coding has the homologous variation albumen that is less than 8 amino acid changes, and amino acid change is that conservative amino acid changes.
4. pyridine antibacterial peptide gene in the former huge legendary turtle shrimp of the described Ke Shi of claim 1 Ah peptide west has application in the recombinant protein of anti-microbial activity in preparation.
5. has application in the recombinant protein of anti-microbial activity as the former huge legendary turtle shrimp of Ke Shi Ah peptide west pyridine antibacterial peptide gene as described in the claim 4 in preparation, its method is by gene recombination technology described gene to be expressed in intestinal bacteria, yeast or insect nuclear polyhedrosis virus, obtains to have the recombinant protein of anti-microbial activity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101596473A CN101503687B (en) | 2008-11-11 | 2008-11-11 | Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101596473A CN101503687B (en) | 2008-11-11 | 2008-11-11 | Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101503687A true CN101503687A (en) | 2009-08-12 |
| CN101503687B CN101503687B (en) | 2010-12-08 |
Family
ID=40976064
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101596473A Expired - Fee Related CN101503687B (en) | 2008-11-11 | 2008-11-11 | Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101503687B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886081A (en) * | 2010-06-04 | 2010-11-17 | 山东大学 | Procambarus clarkia chitin peptide gene and encoded chitin peptide and application thereof |
| CN101942473A (en) * | 2010-08-17 | 2011-01-12 | 山东大学 | Procambrus clarkii type i lysozyme gene, lysozyme coded by lysozyme gene and application of lysozyme |
| CN105219779B (en) * | 2015-11-12 | 2018-06-15 | 厦门大学 | Red claw crayfish coagulogen and preparation method and application |
| CN111171133A (en) * | 2020-02-18 | 2020-05-19 | 深圳华大海洋科技有限公司 | Botrychus macranthus amylin antibacterial peptide and coding sequence, application and preparation method thereof |
| WO2023065491A1 (en) * | 2021-10-20 | 2023-04-27 | 海南三元星生物科技股份有限公司 | Antimicrobial peptide drug from marine organisms, and preparation method therefor |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101213950B (en) * | 2008-01-16 | 2011-10-26 | 淮阴师范学院 | Procambarus clarki ovum in-vitro breeding technique |
| CN101253949A (en) * | 2008-03-25 | 2008-09-03 | 何金林 | Freshwater crayfish feed stuff and its processing method thereof |
-
2008
- 2008-11-11 CN CN2008101596473A patent/CN101503687B/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886081A (en) * | 2010-06-04 | 2010-11-17 | 山东大学 | Procambarus clarkia chitin peptide gene and encoded chitin peptide and application thereof |
| CN101942473A (en) * | 2010-08-17 | 2011-01-12 | 山东大学 | Procambrus clarkii type i lysozyme gene, lysozyme coded by lysozyme gene and application of lysozyme |
| CN105219779B (en) * | 2015-11-12 | 2018-06-15 | 厦门大学 | Red claw crayfish coagulogen and preparation method and application |
| CN111171133A (en) * | 2020-02-18 | 2020-05-19 | 深圳华大海洋科技有限公司 | Botrychus macranthus amylin antibacterial peptide and coding sequence, application and preparation method thereof |
| WO2023065491A1 (en) * | 2021-10-20 | 2023-04-27 | 海南三元星生物科技股份有限公司 | Antimicrobial peptide drug from marine organisms, and preparation method therefor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101503687B (en) | 2010-12-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110643612B (en) | Trachinotus ovatus antimicrobial peptide NK-lysin gene and application thereof | |
| CN101503687B (en) | Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| CN100420750C (en) | Chinese prawn C-type agglutinin gene and its coded C-type agglutinin peptide and uses | |
| CN111690054A (en) | Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application | |
| Tan et al. | Complete genome sequence analysis of Ralstonia solanacearum strain PeaFJ1 provides insights into its strong virulence in peanut plants | |
| CN101892241A (en) | Grass carp interleukin 1 beta gene and protein and recombinant expression method thereof | |
| CN102586286A (en) | Expression system of bacillus thur ingiens (Bt) insecticidal protein Cry1Ac-a | |
| CN101942473B (en) | Procambrus clarkii type i lysozyme gene, lysozyme coded by lysozyme gene and application of lysozyme | |
| CN101886081A (en) | Procambarus clarkia chitin peptide gene and encoded chitin peptide and application thereof | |
| CN108396030A (en) | Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and its recombinant protein and application | |
| CN101525617A (en) | Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression | |
| CN103387992A (en) | Gene for coding recombinant porcine beta-defensin-1 and preparation method of porcine beta-defensin-1 | |
| CN101921788B (en) | Meretrix lysozyme gene and coding protein and application thereof | |
| CN108794613A (en) | It is a kind of with the Hong Kong oyster LysM albumen and its encoding gene of bacteriostatic activity and application | |
| CN102086452A (en) | Bt protein in-vitro insect resistance identification method | |
| CN102241756B (en) | High expression of tenebrio molitor antibacterial peptide TmAMP3m in escherichia coli and application of TmAMP3m | |
| CN107602686A (en) | A kind of polypeptide resistant to gram-positive bacteria | |
| CN101942464B (en) | Fenneropenaeus chinensis ubiquitin-conjugating enzyme gene and ubiquitin-conjugating enzyme coded by same and application | |
| CN101565462B (en) | Large yellow croaker BPI-BN protein, primer and applications thereof in preparing antibiotic drugs | |
| CN100352841C (en) | Antibiotic peptide and its coding sequence and uses | |
| CN110317821B (en) | Fusion protein THG and application thereof | |
| CN103484467B (en) | Diamondback moth cecropin 3, preparation method and application thereof | |
| CN106479987A (en) | A kind of preparation method and applications of solubility housefly MdproPO1 recombiant protein | |
| CN101423839A (en) | Rockfishes chitinase A gene, expression vector containing the same, recombinant strain and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101208 Termination date: 20111111 |