CN101503670A - Engineering bacterial strain containing integron - Google Patents

Abstract

The invention belongs to the field of microorganism animal cell line, and in particular relates to an engineering strain containing an integron. The engineering strain is eschrichia.coli, with a preservation number of C6MCC No.2353. The strain is named DHS, and the chromosome DNA of the strain has a structure of a sequence 1. In the invention, a transposon is used as a tool to insert an integron having a known sequence into the chromosome DNA of a colon bacillus. Tests show that the strain can capture an addA2 drug-resistance gene cassette in the presence of a high-expression integrase. The establishment of the strain lays a foundation for deeply researching a mechanism for the integron to capture the drug-resistance gene cassette in strains with known genetic background, and the strain can be used as a tool strain in other researches about the integron.

Description

A kind of engineering strain that contains integron

Technical field

The invention belongs to technical field of microbe cell line, be specifically related to a kind of engineering strain that contains integron.

Background technology

It is reported that in the clinical treatment, drug-resistance of bacteria is very serious at present, especially the appearance of multiple antibiotic resistant strain is a huge challenge to the treatment of clinical bacteria infectious diseases.People expect to cause the appearance of the antibiotic bacterial strain of anti-single kind owing to the transgenation meeting, but occur simultaneously in same bacterial strain multiple antibiotic resistance, are difficult to make an explanation with transgenation.Studies have shown that the horizontal transmission of genetic material in bacterial classification and between bacterial classification is that bacterium obtains new chemical sproof important channel.Resistance is propagated widely fast and closely similar resistance mode occurs between different strain, and the importance of above-mentioned mechanism has been described.The recent integron that studies show that plays an important role in the appearance of the horizontal transmission of drug resistant gene and multiple antibiotic resistant strain.A common integron comprises three elements the most basic at least: coding belongs to the gene of the intergrase of tyrosine recombinase family, be positioned at the intergrase coding region and with the intergrase coding staff to opposite driving downstream gene box expression promoter Pc, the recombination site attI that intergrase is discerned.Prior art has disclosed box gene and has been made of a common promoterless opening code-reading frame and 3 ' end intergrase reorganization recognition site attC.Have investigation to one group from community and do not take antibiotic healthy population at least at one month and study, the frequency of occurrences of integron is 15% in the intestinal bacteria that are separated to.People's such as Jones the bacterial strain that carries integron that studies show that more is easy to generate multiple antibiotic resistance than the bacterial strain that does not carry integron.Up to the present, more than 70 kind of drug resistance gene box found in research.More than the explanation integron has great importance in chemical sproof horizontal transmission.

Integron is in some cases by catching favourable box gene, as the drug resistance gene box, and the acquisition survival advantage causes adverse influence but also might catch some to the toxigenous box gene of host, perhaps excessively catches box gene and the breeding of host bacterium is caused certain burden.Therefore, the integron of bacterium infer that it necessarily has the complete and meticulous regulation mechanism of a cover, but this mechanism is not understood yet also in the process of catching the alien gene box.Research to above-mentioned relevant regulation mechanism will help disclosing drug-resistance of bacteria, especially the multi-drug resistant of bacterium.

Summary of the invention

The present invention seeks to provides a strain to contain the engineering strain of integron for overcoming the deficiencies in the prior art.

The present invention adopts the integron of sequence 1 to be inserted into and sets up the engineering strain that contains integron in the bacillus coli DH 5 alpha genomic dna.Described engineering strain is in preservation on January 18 in 2008, depositary institution: CGMCC, Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number: CGMCC No.2353, classification name: colon bacillus (Escherichia.coli).This bacterial strain called after DHS.This engineering strain has following biological characteristics:

Contain the structure (Fig. 1) of sequence 1 on the described engineering strain chromosomal DNA, can catch box gene.

Described box gene of catching is an aadA2 drug resistance gene box.

Engineering strain of the present invention adopts following method to set up:

Adopt transposon as instrument, the integron of known array is cloned into the transposon carrier construction obtains recombinant plasmid, with this recombinant plasmid is that template utilizes pcr amplification to contain the transposon of integron, this transposon mixes formation swivel base complex body with transposase, adopt electroporation with this complex body transformed into escherichia coli DH5 α, select positive colony, utilize the inverse PCR technology to determine the insertion site of integron on e. coli chromosomal dna.By following step:

1) integron of sequence 1 (Fig. 1) is cloned into the transposon carrier construction, obtains recombinant plasmid;

2) above-mentioned recombinant plasmid is template contains integron with pcr amplification a transposon;

3) pcr amplification product of step 2 mixes formation swivel base complex body with transposase, and the method that adopts electroporation is with this complex body transformed into escherichia coli DH5 α;

4) screening positive clone utilizes the inverse PCR technology to determine the insertion site of integron on e. coli chromosomal dna,

Described on position is positioned at the attI site of integron, inserts one section dna fragmentation that contains integron in the 3724784---3724792 of e. coli chromosomal dna (GenBank accession number:U00096.2) position.

The engineering strain that contains the integron of known array in the e. coli chromosomal dna of the known genetic background that the present invention sets up, can be the Study of Mechanism that the host bacterium catches the drug resistance gene box at integron and set up good experiment porch, help the further investigation of chemical sproof horizontal transmission mechanism.This strain bacterium is convenient to carry out relevant Protocols in Molecular Biology operation, such as the conversion of carrying out related plasmid easily and the research expression of gene.

Description of drawings

Fig. 1 is inserted into a section of bacillus coli DH 5 alpha to contain integron dna sequence dna figure,

Wherein, base in the square frame is represented the recombination sequence that transposase is discerned, dash area is represented the intergrase encoding sequence, black matrix part presentation code is to the chemical sproof DHFR gene of trimethoprim (TMP), italicized item is the ORFF partial sequence of Unknown Function, and vertical arrows is represented the concrete on position of box gene when the generation reorganization of the attI site of integron.

Fig. 2 is the pcr amplification product agarose gel electrophoresis result after the DHS bacterial strain is caught the aadA2 box gene,

Wherein, the employed primer 5CS that increases is at 5 of DHS bacterial strain integron ' end conserved sequence, primer AAFQ is the encoding sequence at aadA2 drug resistance gene box, if the aadA2 box gene is not recombinated in integron, DNA between them is discontinuous, thereby can effectively not increased;

Swimming lane 1 is the amplified production that integration takes place the aadA2 box gene under the situation of high expression level intergrase the DHS bacterial strain, and its length is consistent at the expection length 238bp that integration takes place in the attI site of integron with the aadA2 box gene;

Swimming lane 2 shows that the DHS bacterial strains not under the situation of high expression level intergrase, can not catch the aadA2 box gene, fails to obtain effective amplified production.

Fig. 3 is the pcr amplification product sequencing result after the DHS bacterial strain is caught the aadA2 box gene,

Wherein, line partial sequence and primer AAFQ complementation, integration takes place in the attI site of integron in conclusive evidence aadA2 box gene.

Embodiment

Embodiment 1

1. with the method for PCR amplification integron gene: the primer that adopts in amplification procedure is, INTBH5 ' GCGGGATCCTTACTACCTCTCACTAGTGAGGGGCG 3 ', ORFPF 5 ' GCGCTG CAGCTGCGCAGCCCATGCAGGCGA 3 ', the amplification system of integron gene is: deionized water 68 μ l, 10 * LAbuffer, 10 μ l, dNTP 16 μ l, each 2 μ l of primer I NTBH and ORFPF, LA Taq archaeal dna polymerase 1 μ l (TaKaRa), (sequence of the integron on the integron sequence that this bacterial strain contains and the pCTX-M3 plasmid is identical for No. 148 strain gene group DNA 1 μ l, GenBank accession number:AF550415.2), amplification condition is 95 ℃ of pre-sex change 5 minutes, 95 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 1 minute, totally 30 circulations, last 72 ℃ were extended 7 minutes.

With the integron gene clone in the transposon carrier construction: get 50 μ l integron gene PCR amplified productions with DNA purified reagent (TaKaRa), by specification carries out purifying, uses 55 ℃ of elution buffer wash-outs of 40 μ l at last.Get this purified product 34 μ l, 10 * K buffer, 4 μ l, 65 ℃ of 10min of 30 ℃ of 1h of BamH I (TaKaRa) 2 μ l, after enzyme cut product and cut glue and reclaim purifying, carry out second time enzyme and cut, above-mentioned enzyme is cut purified product 30 μ l, 10 * H buffer, 4 μ l, 65 ℃ of 10min of 30 ℃ of 1h of Pst I (TaKaRa) 2 μ l cut product to enzyme and cut glue recovery purifying, are designated as INTN and cut pure; (EPICENTRE USA) cuts with BamH I and Pst I enzyme, enzyme is cut product cut glue recovery purifying, is designated as pMOD and cuts pure to the pMOD plasmid; Get INTN and cut pure 4 μ l, pMOD cuts pure 1 μ l, connects liquid Solution I (TaKaRa) 5 μ l, 65 ℃ of 10min of 16 ℃ of 10h; Get above-mentioned connection product 5 μ l transform 50 μ l pirl16 competent cells (EPICENTRE, USA), coating penbritin flat board, picking positive colony after 37 ℃ of incubated overnight, extract plasmid and make preliminary evaluation, through the order-checking conclusive evidence, the name recombinant plasmid is pMDINTN.

3. the transposon that contains integron with pcr amplification: the primer that adopts in amplification procedure is, PCRFP5 ' ATTCAGGCTGCGCAACTGT 3 ', PCRRP5 ' GTCAGTGAGCGAGGAAGCGGAAG 3 ' gets and is designated as the pMDINTN dilution after 1 μ l pMDINTN plasmid thing adds the dilution of 100 μ l deionized waters; The amplification system that contains the transposon of integron is: deionized water 68 μ l, 10 * LA buffer, 10 μ l, dNTP 16 μ l, each 2 μ l of primer PCR FP and PCRRP, LA Taq archaeal dna polymerase (TaKaRa) 1 μ l, pMDINTN dilutes 1 μ l, and amplification condition is 95 ℃ of pre-sex change 5 minutes, 95 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes, totally 30 circulations, last 72 ℃ were extended 7 minutes; Get the above-mentioned pcr amplification product of 50 μ l DNA purified reagent (TaKaRa), by specification carries out purifying, carries out wash-out with 55 ℃ of TE damping fluids of 40 μ l at last.

4. transposon and transposase form the swivel base complex body: above-mentioned purified product 1 μ l, Transposase 2 μ l (EPICENTRE, USA), 100% sterile glycerol, 1 μ l, mixing, room temperature is placed and was got the swivel base complex body in 30 minutes.

5.DH5 the preparation of α electroreception attitude cell: inoculate among DH5 α to the 20ml LB of 100 μ l incubated overnight, 37 ℃ of 200 rotational oscillation swings and is cultured to OD ₆₀₀Be 0.8, in the ice-water bath 20 minutes, centrifugal 20 minutes of 4 ℃ of 1000g, abandon supernatant, it is resuspended to add the ice-cold sterilization deionized water of 5ml, centrifugal 20 minutes of 4 ℃ of 1000g, abandon supernatant, it is resuspended to add the ice-cold sterilization deionized water of 5ml, centrifugal 20 minutes of 4 ℃ of 1000g, abandon supernatant, the ice-cold glycerine that adds 10% ice-cold sterilization of 5ml is resuspended, and centrifugal 20 minutes of 4 ℃ of 1000g abandon supernatant, the ice-cold glycerine that adds 10% ice-cold sterilization of 100 μ l is resuspended, and the electroreception attitude cell of making is stand-by or to put-70 ℃ of preservations stand-by.

6. the method with electroporation imports the swivel base complex body in the above-mentioned electroreception attitude cell, screening one strain positive colony on the TMP resistant panel: get 100 μ l DH5 α electroreception attitude cells and add the above-mentioned swivel base complex body of 1 μ l, mixing joins in the ice-cold electric revolving cup of 1mm, (Bio-Rad) transforms with the EC2 program, 2.49KV5.60ms.After 37 ℃ of 200 rotational oscillation swings and cultivates 1h, coating TMP (Sigma) flat board, after the incubated overnight, the picking positive colony, called after DHS, adding 5ml LB trains 37 ℃ of 200 rotational oscillation of basic 10 μ l TMP and swings cultivation.

7. extract the genomic dna of positive colony, adopt the flanking sequence of inverse PCR technology amplification transposon, the PCR product is carried out T-A clone back order-checking, with BLAST sequencing result is compared to determine the insertion site of transposon: the primer that uses in amplification procedure is, SQFP 5 ' GCCAACGACTACGCACTAGCCAAC3 ', SQRP 5 ' GAGCCAATATGCGAGAACACCCGAGAA 3 ', the positive colony of incubated overnight is extracted genomic dna, carrying out enzyme with following enzyme cuts, be respectively EcoRV (TaKaRa), Nco I (TaKaRa), Scal I (TaKaRa), Sal I (TaKaRa), Xba I (TaKaRa), enzyme is cut product purification, connect with ligase enzyme, reaction conditions is: above-mentioned enzyme is cut purified product 20 μ l, connects liquid (TaKaRa) 20 μ l, 65 ℃ of 10min of 16 ℃ of 10h; To connect product purification, amplification, amplification condition: deionized water 68 μ l, 10 * LA buffer, 10 μ l, dNTP 16 μ l, each 2 μ l of primer SQFP and SQRP, LA Taq archaeal dna polymerase (TaKaRa) 1 μ l, purified product 1 μ l after the above-mentioned connection, amplification condition is 95 ℃ of pre-sex change 5 minutes, 95 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes, totally 30 circulations, last 72 ℃ were extended 7 minutes, and amplification finishes laggard row agarose gel electrophoresis, the EcoRV enzyme is cut the ligation amplification product cut and carry out T-A clone (TaKaRa) behind the glue purification, positive colony is checked order.Sequencing result is inserted in the bacillus coli DH 5 alpha chromosomal DNA after comparing with BLAST, specifically inserts the site and is:

GCACCCGGGgaattgagc＜integron (sequence 1)〉gaattgagcTTAAAAATTGG3724784---3724792 (GenBank accession number:U00096.2)

Embodiment 2

The DHS engineering bacteria is caught the application of the aadA2 drug resistance gene box on the pACDA plasmid:

1. with the described DHS bacterial strain of the conventional cultivation of LB liquid nutrient medium, be made into competent cell by standard method;

2. transform above-mentioned competent cell with the plasmid pACDA that contains aadA2 drug resistance gene box, coating contains the LB agar plate of paraxin, after 37 ℃ of incubated overnight, selects positive colony and is made into competent cell by standard method;

3. the plasmid pUCINT with the high expression level intergrase transforms above-mentioned competent cell, coating contains the LB agar plate of penbritin, 37 ℃ of overnight incubation are selected the LB liquid nutrient medium that positive colony inoculation 5ml contains paraxin and penbritin, 37 ℃ of incubated overnight;

4. get the DHS bacterium liquid 1ml that contains pACDA and pUCINT plasmid of incubated overnight, get simultaneously only contain the pACDA plasmid DHS bacterium liquid 1ml as negative control, the centrifugal 1min of 1000rpm, abandon supernatant, with the 1ml deionized water wash once, abandon supernatant and add in the 200ul water, the vibration mixing, 100 ℃ of 10min, the centrifugal 1min of 1000rpm.Getting this supernatant liquor 0.25 μ l is template, and each 0.5 μ l of AAFQ and 5CS primer is a primer, and the sequence of primer AAFQ is 5 ' CATCCACTGCGGAGCCGTAC 3 ', the sequence of primer 5CS is 5 ' GGCATCCAAGCAGCAAGC 3 ', water 17 μ l, 10 * damping fluid, 2.5 μ l, dNTP4 μ l, Taq archaeal dna polymerase (TaKaRa) 0.25 μ l, amplification condition are 95 ℃ of pre-sex change 5 minutes, 95 ℃ 1 minute, 55 ℃ of 30s, 72 ℃ of 30s, totally 30 circulations, 72 ℃ were extended 7 minutes; Get 5 μ l pcr amplification products and carry out agarose gel electrophoresis; Positive amplified production is cut glue reclaim purifying, adopt primer 5CS to check order.

Claims (4)

1, a kind of engineering strain that contains integron is characterized in that described engineering strain is escherichia coli Eschrichia.coli, deposit number: CGMCC No.2353, contain the structure of sequence 1 on its chromosomal DNA, and can catch box gene.

2, want 1 to ask the described engineering strain that contains integron by right, it is characterized in that described box gene of catching is an aadA2 drug resistance gene box.

3, right wants 1 to ask the described preparation method who contains the engineering strain of integron, it is characterized in that by following step:

1) integron of sequence 1 is cloned into the transposon carrier construction, obtains recombinant plasmid;

2) above-mentioned recombinant plasmid is template contains integron with pcr amplification a transposon;

3) pcr amplification product of step 2 mixes formation swivel base complex body with transposase, and the method that adopts electroporation is with this complex body transformed into escherichia coli DH5 α;

4) screening positive clone utilizes the inverse PCR technology to determine the insertion site of integron on e. coli chromosomal dna.

4, by the described method of claim 3, it is characterized in that the described insertion of step 4) site is positioned at the attI site of integron, insert the dna fragmentation that contains integron in the 3724784---3724792 position of e. coli chromosomal dna.

Images