CN101460634A - Methods and compositions for targeting C-REL - Google Patents

Abstract

The present invention relates to compositions and methods for targeting c-Rel. In particular, the present invention provides compositions and methods for treating cancers, inflammatory diseases, autoimmune diseases, and transplant rejection by inhibiting c-Rel activity and for regulating c-Rel for research and drug screening applications.

Description

The method and composition that is used for targeting c-rel

The application requires in the right of priority of the 4/13/06 provisional application sequence number of submitting to 60/791,877, and described provisional application integral body is by reference integrated with this paper.

The present invention partly is subjected to be supported by the grant number that CA68155 and CA90405 authorize.Government can have some right in the present invention.

Invention field

The present invention relates to be used for composition and the method for target c-Rel.Especially, the invention provides by suppressing the c-Rel activity, cause that immunological tolerance is used for the treatment of cancer, autoimmune disease, allergy, inflammatory diseases, transplant rejection and bone loss, and be used to regulate c-Rel and be used to study composition and the method for using with drug screening.The invention still further relates to method as the screening c-Rel activity inhibitor of determining by the biological activity of measuring the c-Rel mediation.

Background of invention

Many human diseases comprise that inflammation, autoimmune disease and cancer belong to the abnormal activation of transcription factor, and this causes the expression of target gene of lacking of proper care and evidence and the survival or the proliferative advantage of new biological activity.In the transcription factor field, NF-κ B has attracted important attention as the transcription factor that relates to numerous biological functions and pathological conditions, and described biological function and pathological conditions comprise the adjusting at infection, inflammation, cell survival and tumorigenic inherency and adaptive immune response.

NF-κ B relates at first at 1990 ' s in early days by the group of Dr.David Baltimore in isolating p50 of the Whitehead of MIT Institute (NF-κ B1) and p65 (RelA) subunit.Finding 3 kinds of other protein---c-Rel, RelB and p52 (NF-κ B2) are shared in the sequence homology on the Rel homeodomain (RHD).Therefore, these 5 kinds of protein classifications are the Rel transcription factor family.Although there is similarity, each Rel member with regard to the tissue expression pattern, to receptor signal reply with target gene specific with regard to be different.These differences are conspicuous according to the nonredundancy phenotype that is shown by single Rel knock-out mice.Therefore, the different Rel members' of target therapy has different biological effects and safety/toxicity overview.

C-Rel be different from NF-κ B (p50, p65).C-Rel is the cell homologue by the v-Rel oncogene of bird REV-T retrovirus coding.The NF-κ B p50 that expresses with omnipresence in all cells of body is different with p65, and c-Rel exclusively is expressed in the cell of hematopoietic origin, comprises T cell, B cell, scavenger cell and dendritic cell.In addition, c-Rel and NF-κ B regulate the different target gene groups in the different cells.Therefore, they have different biological functions.C-Rel is the crucial troublemaker (culprit) in many inflammation and the autoimmune disease.

Be used for the anti-inflammatory of inflammation, autoimmune disease, transplanting and immunosuppressive therapy in the past many decades experienced revolutionary development.The early stage therapy that is used for the treatment of the symptom of autoimmunization/inflammatory conditions relies on glucocorticosteroid or reflunomide---1950 ' s find from medulliadrenal hormone.Glucocorticosteroid in eliminating nearly all inflammatory conditions the inflammation S﹠S and the immunopathology that produced in effective especially, described inflammatory conditions comprises rheumatoid arthritis, asthma, atopic dermatitis, inflammatory bowel, multiple sclerosis, transplant rejection, graft versus host (GvH) is sick and organ specificity autoimmune disease for example thyroiditis and diabetes.Unfortunately, reflunomide causes the serious systemic side effects of the nearly all tract of influence, and this hinders its long-term application.Therefore, reflunomide may " healings " chronic autoimmunization and inflammatory diseases joyful even just dissipated fast before 1960s.

Chronic inflammatory illness for example the alleviating of symptom of rheumatoid arthritis is the medicine that is categorized as non-steroidal anti-inflammatory drugs (NSAIDs).Yet the many life-time service in these reagent can cause that stomach and intestine (GI) are hemorrhage.Developed the new class medicine of the selective depressant that is called as Cox2 (Vioxx, Celebrex, Bextra) at 1990s, with treatment pain and inflammation but avoid the side effect of NSAID to the GI road.NSAID and Cox2 inhibitor are only treated symptom and alleviating pain for the autoimmunization patient.Yet these medicines can not be prevented the progress of lysis.In 2004, because the heart attack sickness rate that increases, Vioxx was evicted from market.The black box mark also places on the Bextra.Subsequently, along with cardiovascular danger becomes common in this class medicine, the sale of all Cox2 inhibitor medicaments significantly descends.

Developed blocking-up tumour necrosis factor (TNF)---the new quasi-biology of inflammatory cytokine in nineteen ninety.3 kinds of medicines in this classification---Enbrel, Remicade and Humira have had main influence in the joint injury that is caused by rheumatoid arthritis that slows down, and one of medicine also is approved for treatment psoriatic, Crohn disease and ankylosing spondylitis.Although these neontology medicines have the side effect of lacking than steroid, they are very expensive and relevant with the danger of infecting with some cancer.In addition, because the generation of neutralizing antibody, 30-35% patient became in the past and resists anti-TNF therapy along with the time.

These true making become apparent for the needs of alternative safety with effective therapy, and described therapy also can be provided for treating inflammation and autoimmune disease.As by the successful hint of TNF blocking-up class medicine, target relates to the proteinic therapy of specific cell of autoimmune core disease mechanisms and wishes the progression of disease because this type of therapy will slow down most.Based on the basic function of c-Rel in immunocyte, the c-Rel blocking-up is further found purposes in the treatment of other pathological conditions, comprise inflammation, autoimmune disease, bone loss, transplant rejection, lymphoma and solid tumor.

Cancer is still incurable disease.Most of present cancer therapies for example chemotherapy have widely cellular targets and the patient are shown insupportable side effect.The success of imatinib mesylate in CML and other associated cancers proved following principle: as long as identified carcinogenic target, just can reach targeted therapies.C-Rel at first is characterized by proto-oncogene in children.Subsequently, c-Rel gene amplification or constitutively activate have obtained proof in many human B cell leukemia, lymphoma and the tumour derived from solid tissue.Therefore, c-Rel is the new treatment target about the human cancer with over-reactive c-Rel or NF-kB activity.

Summary of the invention

The present invention relates to be used for composition and the method for target c-Rel.Especially, the invention provides by suppressing the c-Rel activity, cause immunological tolerance and be used to regulate that c-Rel is used for the treatment of the composition of cancer, autoimmune disease, allergy, inflammatory diseases, transplant rejection and bone loss and method is used for research and drug screening is used.The invention still further relates to method as the screening c-Rel activity inhibitor of determining by the biological activity of measuring the c-Rel mediation.

Therefore, the invention provides and be used for target c-Rel as being used for inflammatory conditions and tumor treatment target, and be used for the method and composition that inducing immune tolerance is used for the treatment of autoimmune disease and transplant rejection.

For example, in certain embodiments, the invention provides and be used for suppressing the c-Rel activity inhibitor that c-Rel or c-Rel signal mating partner activity use (for example, antisense, siRNA, fit, antibody, peptide, plan peptide, small molecules and natural compounds).This type of inhibitor finds purposes in the treatment of cancer, autoimmunization, transplant rejection and inflammatory diseases and in research and the drug screening application.For example, in certain embodiments, the invention provides and reduce the active method of c-Rel, it comprises makes the cell of expressing the c-Rel gene contact with the c-Rel activity inhibitor.In certain embodiments, the c-Rel activity inhibitor be antisense oligonucleotide, siRNA (for example SEQ ID NOs:6,10,13,16 or 17-26), fit, peptide, plan peptide or antibody.In other embodiments, the c-Rel activity inhibitor is natural compounds or small molecules.In certain embodiments, small molecules has the structure of formula 1 or formula 2:

Formula 1 formula 2

R wherein ₁, R ₂, R ₅And R ₆Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, CN, NO ₂, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R wherein ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.

Preferred R ₃Group is selected from aryl, substituted aryl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic.For example,

Wherein X is selected from O, S, NH, NR ₇R ₄Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, haloalkenyl group, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, CN, NO ₂, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁, and R wherein ₇, R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, haloalkenyl group, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cyclophane base, substituted cycloalkyl.

In certain embodiments, small molecules has following structure:

R wherein ₁And R ₂Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.R ₃And R ₄Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₃And R ₄Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.

In certain embodiments, small molecules comprises following formula:

Wherein X and Y are independently selected from NH, NR ₄, O and S.R ₁, R ₂And R ₄Be independently selected from hydrogen, aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₁And R ₂Can connect to form ring, described ring can be heterocycle, substituted heterocycle, cyclophane base, substituted cycloalkyl.R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, COR ₁₁, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.

Exemplary compounds includes but not limited to 1,3-dimethyl-5-{3-[2-(4-nitrophenoxy) oxyethyl group] Ben Yajiaji }-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 1,3-dimethyl-5-[3-(2-phenoxy group oxyethyl group) Ben Yajiaji]-2,4,6 (1H, 3H, 5H)-pyrimidine trione, [3-[(tetrahydrochysene-1-methyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl] phenoxy group]-acetate, 4-[(tetrahydrochysene-1-methyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl]-phenylformic acid, 5-[3-bromo-4-(dimethylamino) Ben Yajiaji]-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5-[[4-(dimethylamino)-3-nitrophenyl] methylene radical]-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, 5-[(5-chloro-2-p-methoxy-phenyl) methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-pyrimidine trione, the 5-[[2-[(2-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, the 5-[[3-[(2-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-pyrimidine trione, the 5-[[2-[(4-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, 2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5,5 '-(1,4-phenylene two methynes) two-(9CI) or barbituric acid, 5,5 '-(p-phenylene two methynes) two-(8CI); 5,5 '-two (barbituric acid) benzonitriles of p-Xylol two subunits, 2-[2-methoxyl group-4-[(tetrahydrochysene-1,3-dimethyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl] phenoxy group]-5-nitro-(9CI) 2,4,6 (1H, 3H, 5H)-pyrimidine trione, or 5-[[3-chloro-5-methoxyl group-4-[2-(4-methylphenoxy) oxyethyl group] phenyl] methylene radical]-(9CI).In other embodiments, small molecules is 1H-pyrazoles-1-butyric acid, 3-(4-bromophenyl)-5-(1,2-dihydro-7-methyl-2-oxo-3-quinolyl)-4,5-dihydro-g-oxo-(9CI) 1, the 5-naphthalene disulfonic acid, 3-(4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)-1, the 3-naphthalene disulfonic acid, 7-(3-methyl-5-oxo-2-pyrroline-1-yl)-(8CI) Succinic Acid, or [5-[(4-hydroxy 3-methoxybenzene base) methylene radical]-4-oxo-2-sulfo--3-thiazolidyl].More further in the embodiment, small molecules is 4-hydroxyl-2-oxo-1,2-dihydroquinoline-3-carboxylic acid N-(4-hydroxy phenyl) acid amides or 7-(diethylin)-3-[5-(2,5-dimethoxy benzene amido)-1,3,4-thiadiazoles-2-yl]-2H-chomene-2-ketone.In certain embodiments, cell is people's cell, cancer cells, bone-marrow-derived lymphocyte, T lymphocyte, antigen presenting cell or inflammatory cell.In certain embodiments, cell is biological (for example, people or non-human mammal).In certain embodiments, the people demonstrates the symptom of cancer (for example, those that describe in the table 1).In other embodiments, the people shows the symptom of allergy, inflammation or autoimmune disease (for example, those that describe in the table 1).More further in the embodiment, the people has experienced organ transplantation (for example, those that describe in the table 1).

In certain embodiments, the inhibition of c-Rel cause being selected from that the cell growth stops, the phenotype of apoptosis, immunosuppression and tolerance induction.In certain embodiments, suppress the c-Rel activity and comprise combining of the c-Rel recognition site that reduces on c-Rel and the c-Rel target gene.In other embodiments, suppressing the c-Rel activity comprises blocking-up c-Rel and is selected from the c-Rel transcriptional coactivator, transcribes the interaction of the reagent of medium or other transcription factors.In other other embodiment, suppress the c-Rel activity and comprise prevention and modify via the c-Rel of the reagent that is selected from stream signal molecule, cofactor or enzyme.More further in the embodiment, suppress the c-Rel activity and comprise and makes c-Rel structure conformational change become inactivated state.

The present invention further comprises and suppresses the method that c-Rel target gene (for example, the solvable factor, cytokine, Cycle Regulation agent and cell survival protein) is expressed, and it comprises makes the eukaryotic cell of expressing the c-Rel gene contact with the c-Rel activity inhibitor.

The present invention provides method in addition, it comprises that the eukaryotic cell that makes the display abnormality signal effect contacts under such condition with the c-Rel activity inhibitor, make the abnormal signal effect reduce, the c-Rel activity that wherein said abnormal signal effect causes changing (for example, increase active or the activity that reduces).

The present invention also provides and has been used to modify the method for extracellular signal to eukaryotic influence, the biological activity of wherein said extracellular signal induction c-Rel mediation, described method comprises makes cell contact under such condition with the c-Rel activity inhibitor, makes the abnormal signal effect reduce.

In certain embodiments, the invention provides the method for the disease that treatment causes by excessive c-Rel activity, it comprises to the experimenter who shows disease symptoms uses the c-Rel activity inhibitor.In certain embodiments, disease be inflammatory diseases (for example, acute respiratory distress, Sepsis, hepatitis, colitis, inflammatory bowel, ischemia reperfusion injury or atherosclerosis), autoimmune disease (lympahadenism, systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis or ankylosing spondylitis), bone loss (for example, derived from arthritic bone loss, bone loss derived from inflammation, or derived from the bone loss of autoimmune disease), organ-graft refection's (graft versus host disease (GVH disease) or marrow graft rejection), immunotherapy (for example, inducing of immunological tolerance), and cancer (for example, B cell lymphoma, burkitt's lymphoma, chronic lymphocytic leukemia, multiple myeloma, lymphoma with Pten sudden change, leukemia with Pten sudden change, examine and step on Cotard, tumour with Pten sudden change, prostate cancer, mammary cancer, the metastatic tumo(u)r hepatocellular carcinoma, colorectal carcinoma or gastrointestinal cancer).

The present invention provides the method for the disease that treatment causes by the unconventionality expression of c-Rel target gene in addition, and it comprises to the experimenter who shows disease (for example, those diseases disclosed herein) symptom uses the c-Rel activity inhibitor.

The present invention further provides the test kit of the c-Rel activity inhibitor that is included in the pharmaceutically acceptable carrier.In certain embodiments, the c-Rel activity inhibitor be antisense oligonucleotide, siRNA (for example, SEQ ID NO:6,10,13,16 or 17-26), fit, peptide, plan peptide or antibody.In other embodiments, the c-Rel activity inhibitor is natural compounds or small molecules.In certain embodiments, small molecules has aforesaid structure.

The present invention also provides and has comprised micromolecular composition, and wherein small molecules has aforesaid structure.

The present invention also provides and has comprised the composition that is used to regulate the active siRNA of c-Rel.In certain embodiments, siRNA has SEQ ID NOs:6,10,13,16 or nucleotide sequence or its function equivalent of 17-26.

More further in the embodiment, the invention provides the method for SCREENED COMPOUND, it comprises contacts people c-Rel homodimer and binding partners (for example, the CD28 response elemets in the promoter region of IL-2 gene (CD28RE)); And measure with respect to the level under the situation that does not have test compounds the level of the fluorescence polarization in the presence of test compounds.In certain embodiments, assay method is the high throughput assay method.In certain embodiments, test compounds uses electrophoretic migration determining displacement method further to screen.

In other embodiments, the invention provides and reduce the active method of c-Rel, it comprises the inhibitor that c-Rel signal pathway component and downstream target gene are provided.In certain embodiments, the signal pathway component is the c-Rel activated upstream reporter molecule (for example, TCR, BCR, CD40, TNF receptor family, NOD1, NOD2 and To11 sample acceptor) that is triggered by its cognate ligand.In other embodiments, the signal pathway component is c-Rel activated stream signal molecule (for example, Lyn, Fyn, Lck, PI3-kinases, Pten, Akt, Vav, BSAP, SLP-76, LAT, Itk, Btk, ZAP-70, PKC-β, PKC-θ, PKC-ζ, Bc1-10, MALT1, CARMA1, IKK α, IKK β, IKK γ, NIK, TRAFs, TAK1, TBK1, RIP, MyD88, TIRAP, TRAM and TRIF).In other embodiments, c-Rel downstream target gene includes but not limited to, cytokine (IL-2 for example, IL-3, GM-CSF, IFN-γ, IFN-α, TNF, IL-6, IL-8, IL-10, IL-13, IL-15, IL-12, IL-23, IL-17, IL-27, EBI3, MIPl α, Rantes, VEGF), cytokine receptor (IL-2R α for example, IFN-α acceptor, OCILRP1, NKRP1f, amphiregulin, angiopoietin-like, N-EGF2, FGF1, Bmp-1), costimulatory molecules (CD80 for example, CD86, CD40, CD44, CCR7, CXCR4, ICAM-1, VCAM-1, MMP-9), cyclin white matter (cyclin D1 for example, cyclin D2, cyclin D3, cyclin E, E2Fs, ifi202), cell survival protein (Bc1-X for example, Bf1-1, Mc1-1, c-IAPs, c-FLIP, A20), signaling molecule (IKK-I for example, MKK1, GBP-1, Pim1, Rap1, R-Rad, Map13K, and transcription factor (c-myc for example PLA-γ),, JunB, IRF1, IRF4, Stat5a, B-Atf, Tbx-2, Cited2, Pvit1, Cri1, Siah2, Hox-8).In certain embodiments, 2 kinds of targets or more multipath component.

Other embodiments of the present invention are described among specification sheets and the embodiment hereinafter.

The accompanying drawing summary

Fig. 1 shows the general introduction of the fluorescence polarization screening assay method of using in certain embodiments of the invention.

Fig. 2 shows the interactional sign of specificity dose-dependently between the kB site CD28RE of the people c-Rel protein of purifying and identification.Left figure, the sample electrophoresis migration determining displacement method of c-Rel homodimer.Right figure is from the logarithmic graph of the DNA binding data of EMSA and c-Rel homodimer.

Fig. 3 shows the exploitation and the checking of the assay method of the micromolecular inhibitor of identifying transcription factor c-Rel.3a adds the c-Rel of various concentration in the CD28 RE probe of 10nM FITC mark, and measures fluorescence polarization.3b, the unlabelled CD28 RE probe of different concns and the fluorescence polarization of control oligonucleotide Oct1.3c adds the endogenous inhibitor IkBa of 200nM c-Rel in the reaction that comprises 10nM probe, 100nM c-Rel and other components identical with 3b.3d is from the diffusion profile of the FP data of example 384 hole flat boards.

Fig. 4 shows the micromolecular inhibitor of further identifying c-Rel via EMSA.

Fig. 5 shows that the lymphoma cell derived from Pten mutant mouse has the high proliferation of BCR signal is replied.(A) Pten (+/-) the lymphoglandula lymphadenomatous histology of deriving.(B) Pten (+/-) lymphoma cell is cultivated up to 72 hours in substratum in the existence of anti-IgM or not.Cell cycle and apoptosis are analyzed for flow cytometry subsequently by propidium iodide (PI) dyeing.

Fig. 6 shows that Pten mutant splenocyte and B cell show the spontaneous propagation of response BCR and CD40 signal and the cell cycle progress of acceleration.From Pten+/-and wild-type mice isolating (A) splenocyte or (B) the B cell cultivate with independent substratum (last figure) or anti-IgM (figure below).(C) stimulate after 72 hours B cell percentages show through each cycle in each histogram, from left to right, 0, the 1st, the 2nd, the 3rd, a 4+5 cycle.

Fig. 7 shows that Pten mutant B cell shows that the NF-κ B that continues activates kinetics and expresses high-caliber c-Rel target gene EBI3.(A) stimulate up to 6 hours with anti-IgM derived from the EMSA of Pten mutant with the nuclear extract of contrast B cell.(B) derived from the EMSA of the nuclear extract of Pten (hypomorph) B cell.(C) EBI3 composition in Pten mutant B cell raises.

Fig. 8 shows that pharmacology NF-kB inhibitor effectively blocks cell cycle progress and induce the plastosome apoptosis progress of Pten mutant B cell.CFSE assay method (A) or propidium iodide dyeing (B) are used to assess cell fission.(C) Bay ll and ten thousand jade-like stones are handled the mitochondrial depolarization that causes Pten mutant and contrast B cell.

Fig. 9 shows that the c-Rel disappearance causes the apoptosis and the cell cycle of Pten mutant B cell to stop.Analyze (B) by using PI dyeing (A) or 3tt-thymidine to mix assay method with regard to apoptosis and cell cycle progress derived from B cell with c-Rel or Pten disappearance or both mouse.

Figure 10 shows the external silence of c-Rel.(a) express retrovirus or contrast virus (virus titer: the GFP level in the NIH3T3 cell of Chu Liing 5 x 106/ml) with 100 μ lc-Rel siRNA.(b) western blotting of usefulness c-Rel specific polyclonal antibody.

Figure 11 shows that reticent c-Rel causes cell survival and the cell cycle progress that reduces in the B cell lymphoma Wehi-231 cell.(a) GFP ⁺The per-cent of cell, (b) by the cell survival and the cell cycle progress of PI staining analysis, (c) data in (b) are summarised as line chart.

Figure 12 shows that the external silence of c-Rel causes the cell survival and the cell cycle progress of impaired former generation B cellular response antigen and mitogenesis signal.(a) flow cytometry of demonstration efficiency of infection, (b) cell survival and cell cycle progress is analyzed by PI dyeing, (c) cell of the identical culture results from (a) uses the cell inner dyeing method to dye with anti-Ki-67, and analyzes by flow cytometry.

Figure 13 shows that the interior silence of the body of c-Rel causes the cell survival and the cell cycle progress of impaired former generation B cellular response antigen and mitogenesis signal.(a) from the gomphosis mouse spleen, separate and use anti-IgM (10.0 μ g/ml), anti-CD40 (10.0 μ g/ml) and 48 hours former generation B cell of LPS (10.0 μ g/ml) stimulation respectively ³The H thymidine mixes.(b) the B cell that stimulates with anti-CD40 in (a) is further analyzed with regard to cell proliferation with regard to cell survival and cell cycle progress with by Ki-67 dyeing by PI dyeing respectively.

Figure 14 shows that the interior silence of the body of c-Rel causes the impaired T cell-mediated immune responses at the antigen-specific signal.

Figure 15 shows exemplary small molecules of the present invention.

Figure 16 shows exemplary I of the present invention, II and III compounds.(a) the II compounds suppresses c-Rel.(b) the I compounds with c-Rel bonded dna probe suppresses along with I class mixture concentration increases.

Figure 17 shows the synthetic of exemplary compounds of the present invention.

Figure 18 shows the synthetic of exemplary compounds of the present invention.

Figure 19 shows derivative synthetic of exemplary compounds of the present invention.

Figure 20 shows radiochemicals or cold labeling is mixed synoptic diagram in the compound of the present invention.

Figure 21 shows the modification in the carboxylate part of II compounds of the present invention.

Figure 22 shows the neutral sulfone or the sulfanilamide (SN) base group modification of compound of the present invention.

Figure 23 confirms the cell effectiveness that the c-Rel inhibitor compound is expressed the IL-2 in the T cell.(a) IL-2 dyeing in the cell on the T cell that stimulates with anti-CD3 and anti-CD28.The IL-2 that data presentation C04---I compounds reduces in the T cell expresses.(b, c) dose-dependent inhibition of in the presence of some compound of the present invention, producing via the IL-2 of T cell.(d, e) C04 of various dosage and C01 are used for measuring the c-Rel inhibitor compound at the IC50 that suppresses via the IL-2 production of CD4+ or CD8+T cell.

Figure 24 is that the activation that illustrates Rel/NF-κ B is the required model of immunogenic response.The excessive activation that this model also proposes the c-Rel/NF-kB activity in the tolerogenesis cell can cause immunological tolerance to be destroyed and the outbreak of autoimmune disease.

Figure 25 shows that the immature B cell of experience immunological tolerance or disappearance has c-Rel and NF-κ B activated specificity suppresses.

Figure 26 is presented at the impaired activation of specificity of the PI3K signal pathway in the immature B cell that experiences immunological tolerance and disappearance.

Figure 27 shows that Pten sudden change (or disappearance) can recover to survive and the lymphocytic propagation of tolerogenesis is replied, and destroys and autoimmune basis thereby constitute about immunological tolerance.

Figure 28 shows Akt---the downstream effect thing of PI3K/Pten approach can protect the tolerogenesis lymphocyte not to be subjected to apoptosis or disappearance.

Figure 29 has listed use dna microarray technology and has knocked out the selected c-Rel target gene that lymphocyte is identified by c-Rel wild-type and the c-Rel that relatively uses BCR (B cell antigen receptor) stimulation.

Figure 30 has listed and has used the dna microarray technology to knock out the selected c-Rel target gene that lymphocyte is identified by c-Rel wild-type and the c-Rel that relatively stimulates with CD40.

Definition

In order to promote understanding of the present invention, defined hereinafter many terms and phrase:

As used herein; term " c-Rel activity " refers to any biochemistry and the biologically active of c-Rel; include but not limited to express; with binding partners (other NF-κ B members for example; include but not limited to p50; p52; p65 and RelB) combination; be combined with the DNA with specificity Rel response sequence; phosphorylation; acetylation and other posttranslational modifications; nuclear translocation; transcriptional activity; the adjusting of target gene transcript and expression; with the coactivator in the nuclear; the interaction of corpresor or medium, with the interaction of rna plymerase ii, with other transcription factors on the identical promoters on the c-Rel target gene (for example; STATs; IRFs; c-jun; c-fos; Foxp3 and NF-ATs) interaction and signal activity. The c-Rel activity comprise by with the activity of the mediation of other protein or nucleic acid interaction or response upstream receptor signal approach. For example, in certain embodiments, the c-Rel biologically active refers to activate by the c-Rel of cognate ligand acceptor corresponding with it (for example, TCR, BCR, CD40, TNF receptor family, NOD1, NOD2 and To11 sample acceptor) in conjunction with the signal pathway that sends. In other embodiments, the c-Rel biologically active is regulated by the signal component (for example, Lyn, Fyn, Lck, PI3-kinases, Pten, Akt, Vav, BSAP, SLP-76, LAT, Itk, Btk, ZAP-70, PKC-β, PKC-θ, PKC-ζ, Bc1-10, MALT1, CARMA1, IKK α, IKK β, IKK γ, NIK, TRAFs, TAK1, TBK1, RIP, MyD88, TIRAP, TRAM and TRIF) of c-Rel. In another embodiment, the c-Rel activity refers to the adjusting of c-Rel downstream target gene, described target gene includes but not limited to cell factor (IL-2 for example, IL-3, GM-CSF, IFN-γ, IFN-α, TNF, IL-6, IL-8, IL-10, IL-13, IL-15, IL-12, IL-23, IL-27, EBI3, MIP1 α, Rantes, VEGF), cytokine receptor (IL-2R α for example, IFN-α acceptor, OCILRP1, NKRP1f, amphiregulin, angiopoietin-like, N-EGF2, FGF1, Bmp-1), costimulatory molecules (CD80 for example, CD86, CD40, CD44, CCR7, CXCR4, ICAM-1, VCAM-1, MMP-9), cyclin white matter (cyclin D1 for example, Cyclin D2, cyclinD3, cyclin E, E2Fs, ifi202), cell survival protein (Bc1-X for example, Bf1-1, Mc1-1, c-IAPs, c-FLIP, A20), signaling molecule (IKK-I for example, MKK1, GBP-1, Piml, Rapl, R-Rad, Map13K, and transcription factor (c-myc for example PLA-γ),, JunB, IRF1, IRF4, Stat5a, B-Atf, Tbx-2, Cited2, Pvitl, Cril, Siah2, Hox-8).

As used herein, term " c-Rel activity inhibitor " refers to via direct contact c-Rel protein, contact c-RelmRNA, cause the conformation change of c-Rel, reduce the c-Rel protein level, or (for example disturb c-Rel and signal gametophyte, described herein those) interaction, with (for example affect the c-Rel target gene, described herein those) express reduce c-Rel any activity (for example, include but not limited to, activity described herein) any molecule (for example, siRNA, antisensenucleic acids, fit, antibody, peptide, intend peptide, native compound or little molecule). Inhibitor also comprises by blocking stream signal molecule (for example, PI3K, Pten, IKKs) the bioactive molecule of indirect regulation c-Rel.

As used herein, term " abnormal signal " guidance causes abnormal cell and replys the signal pathway of (for example, in growth, survival, apoptosis, differentiation, metabolism, effector function or gene expression model) or the change in the signal pathway component. In certain embodiments, abnormal signal causes the c-Rel activity that changes. In certain embodiments, abnormal signal is the result of the activity that changes of c-Rel target gene or c-Rel stream signal molecule (for example, described herein those).

As used herein, phalangeal cell external signal molecule (for example for term " extracellular signal impact ", pharmaceutical agents, the part for acceptor, cell factor, chemotactic factor (CF), the solvable factor, adhesion molecule or other signaling molecules) impact that cell (for example, eukaryotic) is had. In certain embodiments, extracellular signal is induced the c-Rel activity, changes c-Rel and activates dynamics, or change c-Rel expression of target gene pattern.

As used herein, term " replacement aliphatic " refers to have the alkane less than 10 carbon, and wherein at least one in the aliphatic hydrogen atom substituted by halogen, amino, hydroxyl, nitro, sulfenyl, ketone, aldehyde, ester, acid amides, lower aliphatic, replacement lower aliphatic or ring (aryl, substituted aryl, alicyclic or replace alicyclic etc.). This type of example includes but not limited to 1-chloroethyl etc.

As used herein, term " alkyl " refers to preferably have the branch of about 8 carbon of about 1-or branched hydrocarbon chains not, for example methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, sec-butyl, isobutyl group, the tert-butyl group, 2-methyl amyl, amyl group, hexyl, isohesyl, heptyl, 4,4-dimethyl amyl group, octyl group, 2,2,4-tri-methyl-amyl etc.

As used herein, term " substituted alkyl " comprises the alkyl that optional one or more functional groups of being adhered to by common and this type of chain replace, described functional group such as hydroxyl, bromine, fluorine, chlorine, iodine, sulfydryl or sulfenyl, cyano group, alkylthio group, heterocyclic radical, aryl, heteroaryl, carboxyl, alkoxy carbonyl group, alkyl, thiazolinyl, nitro, amino, alkoxyl, acylamino-etc. are to form alkyl such as trifluoromethyl, 3-hydroxyl hexyl, 2-carboxylic propyl group, 2-fluoro ethyl, carboxymethyl, cyanogen butyl etc.

As used herein, when term " cycloalkyl " uses separately or as the part of another group in this article, comprise and comprise 1-3 ring filling or part unsaturated (comprising 1 or a plurality of pairs of keys) cyclic hydrocarbon group, comprise the monocycle alkyl, bicyclic alkyl and tricyclic alkyl, comprise an altogether 3-20 carbon that forms ring, be preferably formed the 3-10 carbon of ring, and it can merge with 1 or 2 aromatic ring when describing for aryl, and it comprises cyclopropyl, cyclobutyl, cyclopenta, cyclohexyl, suberyl, the ring octyl group, ring decyl and cyclo-dodecyl, cyclohexenyl group.

As used herein; term " substituted cycloalkyl " comprises the optional cycloalkyl that is replaced by one or more substituting groups, any substituting group that described substituting group for example comprises in halogen, alkyl, alkoxyl, hydroxyl, aryl, aryloxy group, aryl alkyl, cycloalkyl, alkylamide, alkanoylamino, oxo, acyl group, aryl-amino-carbonyl, amino, nitro, cyano group, mercaptan and/or alkylthio group and/or " substituted alkyl " definition.

As used herein, term " thiazolinyl " himself or refer to 2-20 carbon in normal chain as the part of another group, preferred 2-12 carbon, the more preferably straight or branched group of 2-8 carbon, it comprises one or more pairs of keys in the normal chain, vinyl for example, the 2-acrylic, the 3-cyclobutenyl, the 2-cyclobutenyl, the 4-pentenyl, the 3-pentenyl, the 2-hexenyl, the 3-hexenyl, the 2-heptenyl, the 3-heptenyl, the 4-heptenyl, the 3-octenyl, 3-nonene base, 4-decene base, the 3-undecenyl, the 4-dodecenyl succinic, 4,8,12-, 14 carbon triolefins etc. " substituted alkenyl " comprises the optional thiazolinyl that is replaced by one or more substituting groups, the substituting group that described substituting group for example above comprises in the definition of " substituted alkyl " and " substituted cycloalkyl ".

As used herein, term " alkynyl " himself or refer in normal chain 2-20 carbon, preferred 2-12 carbon and the more preferably straight or branched group of 2-8 carbon as the part of another group, it comprises one or more three keys in the normal chain, such as 2-propynyl, 3-butynyl, 2-butynyl, 4-pentynyl, 3-pentynyl, 2-hexin base, 3-hexin base, 2-heptyne base, 3-heptyne base, 4-heptyne base, 3-octyne base, 3-n-heptylacetylene base, 4-decynyl, 3-hendecyne base, 4-dodecyne base etc. " substituted alkynyl " comprises the optional alkynyl that is replaced by one or more substituting groups, the substituting group that described substituting group for example above comprises in the definition of " substituted alkyl " and " substituted cycloalkyl ".

As used herein, when term " aryl alkyl ", " aryl alkenyl " and " aromatic yl polysulfide yl " use separately or as the part of another group, refer to alkyl, thiazolinyl and the alkynyl with aryl substituent described above. The representative example of aryl alkyl includes but not limited to, benzyl, 2-phenethyl, 3-phenylpropyl, phenethyl, benzhydryl and menaphthyl etc. " substituted aryl alkyl " comprises the wherein optional aryl alkyl that is replaced by one or more substituting groups of aryl moiety, the substituting group that described substituting group for example above comprises in the definition of " substituted alkyl " and " substituted cycloalkyl ".

As used herein, when term " halogen " or " halogen family " use separately or as the part of another group, refer to chlorine, bromine, fluorine and iodine.

As used herein, term " haloalkyl ", " haloalkenyl group " and " alkynyl " refer to " alkyl ", " thiazolinyl " and " alkynyl " that are replaced by the one or more atoms that are selected from fluorine, chlorine, bromine, fluorine and iodine during separately or as the part of another group.

As used herein, term " aryl " or " Ar " refer to comprise monocycle and the Ppolynuclear aromatic group of 6-10 carbon in loop section (for example phenyl or naphthyl comprises 1-naphthyl and 2-naphthyl) during separately or as the part of another group, and can choose wantonly and comprise the individual other ring of 1-3 that merges with carbocyclic ring or heterocycle (for example assorted alkyl ring of aryl, cycloalkyl, heteroaryl or ring).

As used herein; term " substituted aryl " comprises the optional aryl that is replaced by one or more functional groups, and described functional group is halogen for example; alkylhalide group; alkyl; alkylhalide group; alkoxyl; the halogen alkoxyl; thiazolinyl; trifluoromethyl; trifluoromethoxy; alkynyl; cycloalkyl-alkyl; the assorted alkyl of ring; the assorted alkyl-alkyl of ring; aryl; heteroaryl; aryl alkyl; aryloxy group; aryloxy alkyl; alkoxy aryl; alkoxy carbonyl; aryl carbonyl; aryl alkenyl; the amino carbonyl aryl; arylthio; aryl sulfonyl kia; arylazo; heteroaryl alkyl; the heteroaryl thiazolinyl; the heteroaryl heteroaryl; heteroaryloxy; hydroxyl; nitro; cyano group; amino; wherein amino comprises that (it is alkyl to 1 or 2 substituting group; aryl; or any other aryl compound of mentioning in the definition) substituted-amino; mercaptan; alkylthio group; arylthio; the heteroaryl sulfenyl; arylthio alkyl; the alkoxy aromatic sulfenyl; alkyl-carbonyl; aryl carbonyl; alkyl amino-carbonyl; aromatic yl aminocarbonyl; alkoxy carbonyl; amino carbonyl; the alkyl oxycarbonyl acyloxy; aryl carbonyl acyloxy; alkyl-carbonyl-amino; aryl-amino-carbonyl; aryl sulfonyl kia; the aryl sulfonyl kia alkyl; any alkyl substituent that arlysulfonylamino or aryl sulfonyl amino carbonyl and/or this paper set forth.

As used herein, stable 5-10 the member's that term " heterocycle " expression does not replace or replaces monocycle loop systems, it can be saturated or unsaturated, and formed by carbon atom and 1-4 the hetero atom that is selected from N, O or S, and wherein can to choose wantonly be that oxidation and nitrogen heteroatom can choose wantonly be quaternary ammoniated for nitrogen and sulfur heteroatom. Heterocyclic ring can be attached on any hetero atom or the carbon atom, and this causes the generation of rock-steady structure. The example of this type of heterocyclic group includes but not limited to piperidyl, piperazinyl, the oxo piperazinyl, the oxo-piperidine base, the oxo-pyrrolidine base, oxo nitrogen Zhuo (oxoazepinyl), nitrogen Zhuo (azepinyl), pyrrole radicals, pyrrolidinyl, furyl, thienyl, pyrazolyl, pyrazoles pyridine base, imidazole radicals, imidazolinyl, imidazolidinyl, pyridine radicals, pyrazinyl, pyrimidine radicals, pyridazinyl; oxazolyl; oxazole alkyl; isoxazolyl; isoxazoline-3-yl, morpholinyl, thiazolyl, thiazolidinyl, isothiazolyl, thiadiazolyl group, THP trtrahydropyranyl, thiomorpholine base (thiamorpholinyl), thiomorpholine base sulfoxide, thiomorpholine base sulfoxide is with oxadiazolyl.

As used herein, term " heteroaromatic " separately or refer to 5 or 7 members' aromatic ring as the part of another group, it comprises 1,2,3 or 4 hetero atom, for example nitrogen, oxygen or sulphur, and with aryl, cycloalkyl, heteroaryl or heterocycloalkyl ring (for example, benzo thiophenyl, indyl) this type of ring of merging, and comprise possible N oxide. As used herein, term " substituted heteroaryl " comprises the optional heteroaryl that is replaced by 1-4 substituting group, the substituting group that described substituting group for example above comprises in the definition of " substituted alkyl " and " substituted cycloalkyl ".

As used herein, term " alicyclic " refers to have less than 8 carbon or by the cycloalkane that is no more than the carbocyclic fused ring system that 3 thick alicyclic rings form. This type of example includes but not limited to naphthalene hydrocarbon etc.

As used herein, term " replaces alicyclic " to refer to and has less than 10 carbon or by the cycloalkane that is no more than the carbocyclic fused ring system that 3 condensed ring form, and wherein at least one in the aliphatic hydrogen atom substituted by halogen, nitro, sulfenyl, amino, hydroxyl, ketone, aldehyde, ester, acid amides, lower aliphatic, replacement lower aliphatic or ring (aryl, substituted aryl, alicyclic or replace alicyclic etc.). This type of example includes but not limited to that 1-chlorine ten alkyl, dicyclo-heptane, octane and nonane are (for example, nonrbornyl) etc.

As used herein, term " substituted heterocycle " refer to have less than 8 carbon or by the cycloalkane and/or the aromatic ring system that are no more than the carbocyclic fused ring system that 3 condensed ring form, wherein at least one in the ring carbon atom substituted by oxygen, nitrogen or sulphur and wherein at least one in the aliphatic hydrogen atom substituted by halogen, hydroxyl, sulfenyl, nitro, amino, ketone, aldehyde, ester, acid amides, lower aliphatic, replacement lower aliphatic or ring (aryl, substituted aryl, alicyclic or replace alicyclic etc.). This type of example includes but not limited to 2-chlorine pyranose.

As used herein, term " joint " refer to comprise connect 2 different structures parts up to and comprise 8 in abutting connection with the chain of atom, wherein this type of atom is for example carbon, nitrogen, oxygen or sulphur. Ethylene glycol is a non-limitative example.

As used herein, term " low alkyl group-replacement-halogen " refers to comprise up to and comprise any alkyl chain of 8 carbon atoms, and wherein one of aliphatic hydrogen atom is substituted by halogen. This type of example includes but not limited to chloroethanes etc.

As used herein, term " acetylamino " should mean acetylizad any uncle or secondary amino group. This type of example includes but not limited to acetamide etc.

As used herein, " derivative " of term compound refers to the compound of chemical modification, wherein chemical modification in the functional group of compound or aromatic ring take place.

As used herein, term " pharmaceutical composition " refers to the combination of activating agent and inertia or active carrier, so that composition is particularly suitable in the body, body is interior or diagnosis ex vivo or therapeutical uses.

As used herein, term " pharmaceutically acceptable carrier " refers to any standard pharmaceutical carrier, for example phosphate buffered salt solution, water, emulsion (for example, oil/water or water/oil emulsion) and various types of wetting agent. Composition can also comprise stabilizing agent and anticorrisive agent. Example about carrier, stabilizing agent and adjuvant. (referring to for example, Martin, Remington ' s Pharmaceutical Sciences, the 15th edition, Mack Publ.Co., Easton, PA [1975]).

As used herein, term " pharmacy acceptable salt " refers to any pharmacy acceptable salt (for example, acid or alkali) of compound of the present invention, and it can provide compound of the present invention or its active metabolite or residue after using to the experimenter.As is known to persons skilled in the art, " salt " of compound of the present invention can be derived from inorganic or organic bronsted lowry acids and bases bronsted lowry.The example of acid includes but not limited to hydrochloric acid, Hydrogen bromide, sulfuric acid, nitric acid, perchloric acid, fumaric acid, toxilic acid, phosphoric acid, oxyacetic acid, lactic acid, Whitfield's ointment, succsinic acid, tosic acid, tartrate, acetate, citric acid, methylsulfonic acid, ethyl sulfonic acid, formic acid, phenylformic acid, propanedioic acid, naphthalene-2-sulfonic acid, Phenylsulfonic acid etc.Other acid are oxalic acid for example, although himself be not pharmaceutically acceptable, still can be used for preparing the useful salt of intermediate product as obtaining compound of the present invention and pharmaceutically-acceptable acid addition thereof.

The example of alkali includes but not limited to basic metal (for example sodium) oxyhydroxide, alkaline-earth metal (for example, magnesium) oxyhydroxide, ammonium and formula NW ₄ ⁺Compound, wherein W is C _1-4Alkyl etc.

The example of salt includes but not limited to: acetate, adipate, alginates, aspartate, benzoate, benzene sulfonate, hydrosulfate, butyrates, Citrate trianion, camphorate, camsilate, cipionate, digluconate, dodecyl sulfate, esilate, fumarate, the fluorine enanthate, glycerophosphate, Hemisulphate, enanthate, hexanoate, hydrochloride, hydrobromide, hydriodide, the 2-isethionate, lactic acid salt, maleate, mesylate, the 2-naphthalenesulfonate, nicotinate, oxalate, palmitate, valerate (pectinate), persulphate, phenpropionate, picrate, Pivalate, propionic salt, succinate, tartrate, thiocyanate-, tosylate, undecylate etc.Other examples of salt comprise and suitable positively charged ion Na for example ⁺, NH ₄ ⁺And NW ₄ ⁺(wherein W is C _1-4Alkyl) negatively charged ion of bonded The compounds of this invention such as.

As used herein, term " immunoglobulin (Ig) " or " antibody " refer to the antigenic protein of binding specificity.Immunoglobulin (Ig) includes but not limited to polyclone, mono-clonal, chimeric and humanized antibody, Fab fragment, F (ab ') ₂Fragment, and comprise the immunoglobulin (Ig) of following classification: IgG, IgA, IgM, IgD, IgE and secretory immunoglobulin (sIg).Immunoglobulin (Ig) generally comprises 2 identical heavy chains and 2 light chains.Yet term " antibody " and " immunoglobulin (Ig) " also comprise single-chain antibody and double-stranded antibody.

As used herein, term " antigen binding proteins " refers to and specific antigens bonded protein." antigen binding proteins " includes but not limited to peptide or immunoglobulin (Ig), comprises polyclone, mono-clonal, chimeric and humanized antibody; The Fab fragment, F (ab ') ₂Fragment and Fab expression library; And single-chain antibody.

As used herein, term " epi-position " refers to the antigen part that contacts with specific immunoglobulins.

When protein or proteinic fragment are used for immune host animal, proteinic numerous zones can induce with protein on given area or three-dimensional structure specificity bonded production of antibodies; These zones or structure are called as " antigenic determinant ".Antigenic determinant can with the combining of complete antigen (that is, being used to cause " immunogen " of immunne response) competition and antibody.

Term " specificity combination " when using, means the existence of ad hoc structure on the interaction dependent protein matter (that is, antigenic determinant or epi-position) with regard to the interaction of antibody and protein or peptide; In other words antibody recognition and combine with the specified protein structure rather than with generally speaking protein bound.For example, if antibody is special for epi-position " A ", the proteinic existence that comprises epi-position A (or free, unlabelled A) so in the reaction of " A " that comprise mark and antibody will reduce the amount with the A of the mark of antibodies.

As used herein, term " non-specific binding " and " background combination " are when using with regard to the interaction of antibody and protein or peptide, mean interaction and do not rely on the existing of specified protein structure (that is, antibody and generally speaking protein rather than ad hoc structure for example epi-position combine).

As used herein, term " experimenter " refers to any animal (for example, Mammals) that will be the acceptor of particular treatment include but not limited to people, non-human primate, rodent etc.Be used interchangeably when usually, term " experimenter " and " patient " are in this article with regard to people experimenter.

As used herein, " diagnosis has the experimenter of cancer " refers to that it has measured and found to have the experimenter of cancer cells.Cancer can use any suitable method to diagnose, and described method includes but not limited to examination of living tissue, x ray, blood count and diagnostic method of the present invention.

As used herein, term " non-human transgenic animal who lacks functional c-Rel gene " refers to that its endogenous c-Rel gene (for example is inactivated, because " c-Rel knocks out " or " c-Rel knocks in ") non-human animal (preferred mammal, more preferably mouse).

As used herein, term " c-Rel knocks out " refers to lack the animal (for example, mouse) of functional c-Rel gene.In certain embodiments, whole c-Rel gene is deleted.In other embodiments, gene carries out deactivation via other modes (for example, the reversing of the deletion of essential part or some or all c-Rel gene).In other embodiments, the c-Rel gene uses Antisense Suppression to carry out deactivation.C-Rel knocks out and comprises that conditionality knocks out (for example, the selectivity of gene activity suppresses).The c-Rel knock-out mice can use any suitable method to be prepared, described method include but not limited to described herein those.The c-Rel gene can also carry out deactivation via the structure of " c-Rel knocks in ", and wherein gene carries out deactivation by foreign DNA being inserted in the required gene region of function.

As used herein, term " c-Rel simulation " finger print is intended the bonded micromolecular compound of c-Rel and part.

As used herein, term " non-human animal " refers to all non-human animals, include but not limited to that vertebrates is rodent, non-human primate, sheep section animal, bovid, ruminating animal, lagomorph, porcine animals, caprid, equine species, Canis animals, feline, birds etc. for example.

As used herein, term " gene transfer system " refers to that the composition that will comprise nucleotide sequence is delivered to any way of cell or tissue.For example, gene transfer system includes but not limited to, carrier (for example, retrovirus, adenovirus, adeno associated virus and other delivery systems) based on nucleic acid, the microinjection of exposed nucleic acid, based on the delivery system of polymkeric substance (for example), biological ballistic injection etc. based on liposome with based on the system of metallic particles.As used herein, term " virogene transfer system " refers to comprise the gene transfer system of viral element (for example, intact virus, modified virus and virus component be nucleic acid or protein for example), to promote sample sending required cell or tissue.As used herein, term " adenoviral gene transfer system " refers to comprise the gene transfer system that belongs to the complete of Adenoviridae or change virus.

As used herein, term " locus specificity reorganization target sequence " refers to provide about the recognition sequence of recombinant factor and the nucleotide sequence of the position of recombination form wherein.

As used herein, term " nucleic acid molecule " refers to comprise the molecule of any nucleic acid, includes but not limited to DNA or RNA.This term comprises the sequence of any known base analogue that comprises DNA and RNA, described analogue includes but not limited to the 4-acetylcytosine, 8-hydroxy-n 6-methyladenosine, the aziridinyl cytosine(Cyt), false iso-cytosine, 5-(carboxyl hydroxymethyl) uridylic, 5 FU 5 fluorouracil, 5-bromouracil, 5-carboxymethylamino methyl-2-deracil, 5-carboxymethylamino 6-Methyl Uracil, dihydrouracil, inosine, the N6-isopentennyladenine, the 1-methyladenine, 1-methyl pseudouracil, the 1-methyl guanine, the 1-methylinosine, 2, the 2-dimethylguanine, the 2-methyladenine, the 2-methyl guanine, the 3-methylcystein, 5-methylcytosine, the N6-methyladenine, the 7-methyl guanine, 5-methylamino 6-Methyl Uracil, 5-methoxyl group amino methyl-2-deracil, β-D-sweet dew is with ammonia quinoline (mannosylqueosine), 5 '-the methoxycarbonyl 6-Methyl Uracil, the 5-methoxyuracil, 2-methyl sulphur-N6-isopentennyladenine, uridylic-5-hydroxyethanoic acid methyl esters, uridylic-5-hydroxyethanoic acid, butoxy chloroquine (oxybutoxosine), pseudouracil, Plaquenil (queosine), 2-sulphur cytosine(Cyt), 5-methyl-2-deracil, the 2-deracil, the 4-deracil, methyl uracil, N-uridylic-5-hydroxyethanoic acid methyl esters, uridylic-5-hydroxyethanoic acid, pseudouracil, Oxychloroquine (queosine), 2-sulphur cytosine(Cyt) and 2,6-diaminopurine.

Term " gene " refers to comprise the nucleic acid that is used to produce the required encoding sequence of polypeptide, precursor or RNA (for example, mRNA, rRNA, tRNA) (for example, DNA) sequence.Polypeptide can be by any part coding of complete encoding sequence or encoding sequence, as long as total length or segmental required activity or functional property (for example, enzymatic activity, part combination, signal transduction, immunogenicity etc.) are retained.This term also comprises the coding region of structure gene and 5 ' and 3 ' end on be positioned at the contiguous sequence in coding region, distance about 1kb or more on arbitrary end, thus make gene pairs answer the length of full length mRNA.Be positioned at coding region 5 ' and the sequence that is present on the mRNA be called 5 ' non-translated sequence.Be positioned at coding region 3 ' or downstream and the sequence that is present on the mRNA be called 3 ' non-translated sequence.Term " gene " comprises the gene of cDNA and genome form.The genome form of gene or clone comprise the coding region of being interrupted by the non-coding sequence that is called " intron " or " interleaving the district " or " intervening sequence ".Intron is the constant gene segment C that is transcribed into nRNA (hnRNA); Intron can comprise for example enhanser of regulatory element.Intron is removed or " montage is fallen " from nuclear or primary transcript; Therefore intron does not exist in messenger RNA(mRNA) (mRNA) transcript.MRNA works to specify aminoacid sequence or the order in the newborn polypeptide at translate duration.

As used herein, term " heterologous gene " refers to non-existent gene in its natural surroundings.For example, heterologous gene comprises from species and introduces gene in another species.Heterologous gene also comprises in some mode (for example, suddenly change, add a plurality of copies, regulate that sequence is connected etc. with non-natural) and changing for the natural gene of biology.Heterologous gene is that with the difference of native gene the general and such dna sequence dna of heterologous gene sequence is connected, described dna sequence dna is not found to combine with gene order is natural in karyomit(e), or with in (for example, the gene of expressing in the locus that gene is not the expressed usually therein) combination of the undiscovered karyomit(e) of occurring in nature part.

As used herein, term " transgenosis " refers to be incorporated in biology (for example, the non-human animal) genome and pass to biological offspring's heterologous gene during syngenesis.

As used herein, term " genetically modified organism " refers to have the genetically modified biology (for example, non-human animal) that is incorporated into the transgenosis in its genome and transgenosis is passed to its offspring during syngenesis.

As used herein, term " genetic expression " refer to by gene " transcribing " (promptly, enzymatic action via RNA polymerase) genetic information of encoding in the gene (for example is transformed into RNA, mRNA, rRNA, tRNA or snRNA) process, with for protein coding gene, " translation " by mRNA is transformed into proteinic process.Genetic expression can be regulated on many stages during the course." rise " or " activation " refers to increase gene expression product (that is adjusting of) production, RNA or protein, and " downward modulation " or " checking " refers to reduce the adjusting of production.Relate to the molecule (for example transcription factor) that raises or reduce and be called " activator " and " repressor " usually.

Except comprising intron, the genome form of gene can also comprise be present in be positioned on the rna transcription thing 5 of sequence ' and 3 ' end on sequence.These sequences are called " flank " sequence or zone (these flanking sequences be positioned at 5 of the non-translated sequence that exists on the mRNA transcript ' or 3 ').The adjusting sequence that 5 ' flanking region can comprise control or influence genetic transcription is promotor and enhanser for example.3 ' flanking region can comprise the sequence that instructs Transcription Termination, transcribes back cutting and polyadenylation.

Term " wild-type " refers to isolating gene or gene product from naturally occurring source.Wild type gene is the most normal observing and the therefore arbitrarily gene of called after gene " normally " or " wild-type " form in colony.By contrast, term " modified " or " mutant " refer to when with wild type gene or gene product relatively the time, display sequence and or functional property (that is the feature of change) in the gene or the gene product of modification.Should be understood that the mutant that can separating natural exists; These are identified by the following fact: when comparing with wild type gene or gene product, they have the feature (nucleotide sequence that comprises change) of change.

As used herein, term " coding ... nucleic acid molecule ", " coding ... dna sequence dna " or " coding ... DNA " refer to order or the sequence of deoxyribonucleotide along dna chain.The order decision amino acid of these deoxyribonucleotides is along the order of polypeptide (protein) chain.Dna sequence dna so encoding amino acid sequence.

As used herein, term " oligonucleotide " and " polynucleotide " with nucleotide sequence of encoding gene with nucleotide sequence of encoding gene, mean the nucleotide sequence of the coding region that comprises gene, or the nucleotide sequence of encoding gene product in other words.The coding region can exist with cDNA, genomic dna or rna form.When existing with dna form, oligonucleotide or polynucleotide can be strand (being sense strand) or two strands.In case of necessity, suitable controlling elements for example enhancers/promoters, splice junction, polyadenylation signal etc. can place with the coding region of gene closely approaching, with the correct processing of the suitable initial and/or original rna transcription thing that allows to transcribe.Alternatively, the coding region of using in expression vector of the present invention can comprise endogenous enhancers/promoters, splice junction, intervening sequence, polyadenylation signal etc., or the combination of endogenous and exogenous controlling elements.

As used herein, term " oligonucleotide " refers to the short length of strand polynucleotide chain.The general length of oligonucleotide is less than 200 residues (for example, 15-100), yet as used herein, this term also is intended to comprise longer polynucleotide chain.Oligonucleotide is mentioned by its length usually.For example 24 residue oligonucleotide are called " 24 aggressiveness ".Oligonucleotide can be hybridized by self or be formed secondary and tertiary structure with other multi-nucleotide hybrids.This class formation can include but not limited to, duplex, hair clip, cruciform, bending and triplex.

As used herein, the polynucleotide that term " complementation " or " complementarity " are just related to by base pairing rules (that is the sequence of Nucleotide) use.For example, for sequence " 5 '-A-G-T-3 ' " and sequence " 3 '-T-C-A-5 ' " complementation.Complementarity can be " part ", wherein has only minority nucleic acid base coupling according to base pairing rules.Perhaps, between nucleic acid, can there be " fully " or " all " complementarity.Complementary degree between the nucleic acid chains has remarkably influenced for the efficient and the intensity of the hybridization between the nucleic acid chains.Has special importance in this bonded detection method between amplified reaction and dependence nucleic acid.

Term " homology " refers to complementary degree.Can there be portion homologous or complete homology (that is identity).The part complementary sequence is the nucleic acid molecule that suppresses complete complementary nucleic acid molecule and the hybridization of " homologous basically " target nucleic acid to small part.The inhibition of the hybridization of fully-complementary sequence and target sequence can use hybridization assays method (DNA or RNA trace, solution hybridization etc.) to check under low stringency.Basically homologous sequence or probe under the condition of low severity will with the competition of complete homologous nucleic acid molecule and inhibition combine (that is, hybridizing) with target.This is not to say that low stringency is such, makes to allow non-specific binding; It is specificity (that is selectivity) interaction with combining each other that low stringency requires 2 sequences.Not existing of non-specific binding can be tested by using non-complementary basically (for example, less than about 30% identity) second kind of target; Under the situation that does not have non-specific binding, probe will not hybridized with second kind of non-complementary target.

When for example cDNA or genomic clone use with regard to the double-strandednucleic acid sequence, term " homologous basically " refer to as mentioned above under low stringency will with any probes of the arbitrary of double-strandednucleic acid sequence or two chain hybridization.

Gene can produce a plurality of RNA kinds by the differential splicing generation of original rna transcription thing.Its cDNAs for the splice variant of homologous genes will comprise sequence identity or fully homologous zone (represent the identical exon on 2 cDNAs or the existence of identical exon part) and complete nonidentity the zone (for example, the existence of the exon " A " on the expression cDNA1, and wherein cDNA2 comprises exon " B ").Because 2 cDNAs comprise the zone of sequence identity, thus they will with derived from complete genome or be included in the probe hybridization of the Gene Partial of the sequence that 2 cDNAs go up to find; 2 splice variants therefore with this type of probe and homology basically each other.

When with regard to the single-chain nucleic acid sequence, using, term " homologous basically " refer to as mentioned above under low stringency can with any probe of single-chain nucleic acid sequence hybridization (that is, it is a complement).

As used herein, term " hybridization " use with regard to the pairing of complementary nucleic acid.The intensity (that is the bonding strength between the nucleic acid) of hybridization and hybridization is subjected to severity, the Tm of formed hybrid and the factor affecting of the ratio of the G:C in the nucleic acid such as the complementary degree between the nucleic acid, the condition that relates to.Be included in complementary nucleic acid paired individual molecule in its structure and be said to be and be " self hybridization ".

As used herein, term " T _m" with regard to " melting temperature(Tm) ", use.Melting temperature(Tm) is that down the colony of double chain acid molecule becomes that half is dissociated into the temperature of strand at it.Be used to calculate the T of nucleic acid _mEquation be well-known in the art.As point out T by the canonical reference document _mThe simple estimation of value can be calculated by following formula: T _m=81.5+0.41 (%G+C), its amplifying nucleic acid is in the aqueous solution, under 1M NaCl (referring to for example, Anderson and Young, Quantitative Filter Hybridization, in Nucleic AcidHybridization[1985]).Other reference comprise for T _mCalculating consider the more complicated calculating of structure and sequence signature.

As used herein, term " severity " is with regard to for example use with regard to the condition of the existence of organic solvent of the temperature, ionic strength and other compounds that carry out down nucleic acid hybridization at it.Under " low stringency ", the purpose nucleotide sequence will complement definite with it, (for example have the sequence of single base mismatch, the sequence that is closely related, have 90% or the sequence of bigger homology) and only have sequence (sequence that for example, the has the 50-90% homology) hybridization of portion homologous.Under " medium stringency ", the purpose nucleotide sequence will be only complement definite with it, have the sequence of single base mismatch and the sequence that is closely related (for example, have 90% or the sequence of bigger homology) hybridization.Under " high stringency ", the purpose nucleotide sequence will be only complement definite and have sequence (the dependence condition the is temperature for example) hybridization of single base mismatch with it.In other words, under high stringency, can elevated temperature, so that get rid of and hybridization with sequence of single base mismatch.

" high stringency " comprises the following condition that is equivalent to when using with regard to nucleic acid hybridization: under 42 ℃ by 5X SSPE (43.8g/l NaCl, 6.9g/l NaH ₂PO ₄H ₂O and 1.85g/l EDTA, pH is adjusted to 7.4 with NaOH), in the solution formed of 0.5% SDS, 5X DenhardtShi reagent and 100 μ g/ml sex change salmon sperm DNAs in conjunction with or hybridization, subsequently in the solution that comprises 0.1 X SSPE, 1.0% SDS in 42 ℃ of washings, when using the probe of about 500 Nucleotide of length.

" medium stringency " comprises the following condition that is equivalent to when using with regard to nucleic acid hybridization: under 42 ℃ by 5X SSPE (43.8g/l NaCl, 6.9g/l NaH ₂PO ₄H ₂O and 1.85g/l EDTA, pH is adjusted to 7.4 with NaOH), in the solution formed of 0.5% SDS, 5 X DenhardtShi reagent and 100 μ g/ml sex change salmon sperm DNAs in conjunction with or hybridization, subsequently in the solution that comprises 1.0 X SSPE, 1.0% SDS in 42 ℃ of washings, when using the probe of about 500 Nucleotide of length.

" low stringency " comprises the following condition that is equivalent to: under 42 ℃ by 5X SSPE (43.8g/l NaCl, 6.9g/l NaH ₂PO ₄H ₂O and 1.85g/l EDTA, pH is adjusted to 7.4 with NaOH), [the every 500ml of 50 X Denhardt ' s comprises: (Type 400, Pharamcia), 5g BSA (FractionV for 5g Ficoll for 0.1% SDS, 5X Denhardt ' s reagent; Sigma)] and in the solution formed of 100 μ g/ml sex change salmon sperm DNAs in conjunction with or hybridization, subsequently in the solution that comprises 5 XSSPE, 0.1% SDS in 42 ℃ of washings, when using the probe of about 500 Nucleotide of length.

Well-known in the art is to use numerous condition of equivalences to comprise low stringency; For example the character of the length of probe and character (DNA, RNA, based composition) and target (DNA, RNA, based composition, exist in solution or fixed etc.) and salt and other components are (for example to consider the factor, the existence of methane amide, T 500, polyoxyethylene glycol or do not exist) concentration, and hybridization solution can change and is different from generation but is equivalent to the low stringency hybridization of condition listed above.In addition, the condition of the hybridization of promotion known in the art under high stringency (for example, increase the temperature of hybridization and/or washing step, in hybridization solution, use methane amide etc.) (referring to above about the definition of " severity ").

As used herein, term " with exercisable combination ", " with exercisable order " refer to being connected by this way of nucleotide sequence with " being operably connected ", make generation can instruct the synthetic nucleic acid molecule of given gene transcription and/or desired protein molecule.This term refers to that also aminoacid sequence connects by this way, makes to produce functional protein.

Term " isolating " when with regard to nucleic acid, using, as in " isolating oligonucleotide " or " isolating polynucleotide ", refer to be identified and with its nucleotide sequence of separating of at least a component of bonded or pollutent usually with it in its natural origin.Isolating nucleic acid is with its sort of different form of finding at occurring in nature or be provided with and exist.By contrast, non-isolating nucleic acid such as nucleic acid, for example DNA and RNA are with its status discovery that exists at occurring in nature.For example, given dna sequence dna (for example, gene) with the approaching host cell chromosome of contiguous gene in find; The RNA sequence, the specific mRNA sequence of encode specific protein matter for example is as finding in cell with the mixture of numerous other mRNAs of coding numerous protein.Yet, the given proteinic isolating nucleic acid of encoding comprises, for example, and at this type of nucleic acid of expressing usually in the given proteinic cell, its amplifying nucleic acid with the sort of different chromosome position of n cell in, or otherwise by the sort of different nucleotide sequence side joint of finding with occurring in nature.Isolating nucleic acid, oligonucleotide or polynucleotide can exist with strand or double chain form.When isolating nucleic acid, oligonucleotide or polynucleotide are ready to use in marking protein, oligonucleotide or polynucleotide include justice or coding strand (promptly with bottom line, oligonucleotide or polynucleotide can be strands), but can include justice and antisense strand (that is, oligonucleotide or polynucleotide can be double-stranded).

As used herein, term " purifying " or " purifying " refer to remove component (for example, pollutent) from sample.For example, antibody carries out purifying by removing contaminative NIg protein, and they also do not carry out purifying with target molecule bonded immunoglobulin (Ig) by removing.The proteinic removal of NIg and/or do not cause hit increase in the reactive immunoglobulin (Ig) per-cent of sample with the removal of target molecule bonded immunoglobulin (Ig).In another example, recombinant polypeptide is expressed in bacterial host cell, and polypeptide carries out purifying by removing host cell proteins matter; The per-cent of recombinant polypeptide obtains increasing thus in sample.

" aminoacid sequence " and term for example " polypeptide " or " protein " be not intended to make aminoacid sequence be limited to described protein molecule bonded completely, natural acid sequence.

As used herein, term " natural protein " means protein and does not comprise amino-acid residue by the carrier sequence encoding; That is, natural protein only comprises those amino acid of finding when it in protein when occurring in nature exists.Natural protein can produce by recombination form and maybe can separate from naturally occurring source.

As used herein, when term " part " uses with regard to protein (as in " given proteinic part ") refer to the sort of proteinic fragment.Clip size can subtract 1 amino acid for 4 amino-acid residues to whole aminoacid sequence.

As used herein, term " carrier " is used in reference to the DNA section from a kind of cell transfer to alternative nucleic acid molecule.Term " vehicle " can exchange with " carrier " sometimes and use.Carrier is usually derived from plasmid, phage or plant or animal virus.

As used herein, term " expression vector " refers to comprise the recombinant DNA molecules of required encoding sequence and suitable nucleotide sequence, and described nucleotide sequence is essential for express the encoding sequence that is operably connected in the specific host biology.For in prokaryotic organism, express required nucleotide sequence generally include promotor, operon (optional) and ribosome bind site, usually together with other sequences.Known promotor, enhanser and termination and the polyadenylation signal of utilizing of eukaryotic cell.

Term " is crossed and is expressed " and is used in reference to regard to the mRNA level than about 3 times of (or bigger) expression levels of observed the sort of height in the given tissue in contrast or non-transgenic animal.The mRNA level is used any measurement the in many technology well known by persons skilled in the art, includes but not limited to rna blot analysis.Suitable contrast is included on the RNA trace; with control (for example about the difference in the RNA amount of loading by every kind of tissue analyzing; the amount of the 28S rRNA that exists in every kind of sample can or be standardized in the mode of observed mRNA specific signals on the RNA trace as normalizing, described 28S rRNA be enrich the rna transcription thing with what substantially the same amount existed in a organized way).The mRNA amount that exists in the band of the transgenosis RNA of the corresponding correct montage of size is carried out quantitatively; With the RNA of other small kinds of transgenosis probe hybridization transgenosis mRNA express quantitatively in do not considered.

As used herein, term " transfection " refers to foreign DNA is introduced in the eukaryotic cell.Transfection can be finished by the whole bag of tricks known in the art, and described method comprises the transfection of calcium phosphate-DNA coprecipitation, the mediation of DEAE-dextran, transfection, electroporation, microinjection, liposome fusion, fat transfection, protoplastis fusion, retroviral infection and the biolistics of polybrene mediation.

Term " stable transfection " or " stable transfection " refer to the foreign DNA introducing and are incorporated in the genome of transfectional cell.Term " stable transfection " refers to the cell of foreign DNA stable integration in the genomic dna.

Term " transient transfection " or " transient transfection " refer to that wherein foreign DNA can't be incorporated in the genome of transfectional cell in the foreign DNA introducing cell.Foreign DNA continues a couple of days in the nuclear of transfectional cell.In this time course, foreign DNA is implemented to regulate control, this control native gene expression in karyomit(e).Term " transient transfection " refers to absorb foreign DNA but the cell that can't integrate this DNA.

As used herein, term " cell cultures " refers to any cell in vitro cultivation.What comprise in this definition is continuous cell line (for example, having immortal phenotype), primary cell culture, transformation cell lines, limited clone (for example, non-transformed cell) and at external any other cell colony of keeping.

As using, term " eukaryote " refers to the biology that can distinguish with " prokaryotic organism ".Wish that this term comprises all biologies with the cell that shows Eukaryotic common feature, described feature is for example by the existence of the eucaryon of nuclear membrane constraint, have karyomit(e) within it, film is in conjunction with the existence of organoid and observed other features in eukaryote usually.Therefore, this term includes but not limited to that this type of is biological as fungi, protozoon and animal (for example, people).

As used herein, term " external " refers to man-made environment and process that takes place or reaction in man-made environment.External environment can be made up of test tube and cell cultures, but is not limited to test tube and cell cultures.Term " in the body " refers to natural surroundings (for example, animal or cell) and the process or the reaction that take place in natural surroundings.

Term " test compounds " and " candidate compound " refer to any chemical entities, medicament, medicine etc., and it is the material standed for of disease, disease, sufferer or the illness (for example, cancer or inflammatory diseases) that are used for the treatment of or prevent body function.Test compounds comprises known and potential treatment compound.Test compounds can the application of the invention the screening method screening be defined as curative.

As used herein, term " sample " is with its implication use the most widely.In a kind of implication, it is intended to comprise sample or the culture that derives from any source, and biology and environmental sample.Biological sample can derive from animal (comprising the people) and comprise fluid, solid, tissue and gas.Biological sample comprises blood products for example blood plasma, serum etc.Environmental sample comprises environmentally conscious materials for example surface mass, soil, water and production piece.Yet this type of example should not be interpreted as restriction and can be applicable to sample type of the present invention.

As used herein, term " siRNAs " refers to siRNA s.In certain embodiments, siRNAs comprises duplex or the double-stranded region that is about 18-25 Nucleotide; Usually siRNAs is included in the individual unpaired Nucleotide of about 2-4 on 3 ' end of every chain.At least one chain of the duplex of siRNA or double-stranded region and target RNA molecule be homology basically, or complementary basically.With the chain of target RNA complementary element be " antisense strand "; With target RNA molecule homologous chain be " sense strand ", and with the complementation of siRNA antisense strand.SiRNAs can also comprise other sequence; The non-limitative example of this type of sequence comprises catenation sequence or ring and stem and other pleated sheet structures.SiRNAs seems to trigger in invertebrates and vertebrates in the RNA interference, and triggers during the PTGS in the sequence-specific RNA degraded in plant and serve as key intermediate species.

Term " RNA interference " or " RNAi " refer to the reticent or minimizing genetic expression by siRNAs.This be in animal and plant by the process of the initial sequence-specific of siRNA, PTGS, described siRNA in its duplex zone with the sequence homology of silencer.Gene can be endogenous or external source for biology, is incorporated into to exist in the karyomit(e) or be present in the transfection carrier that is not incorporated in the genome.Expression of gene is suppressed wholly or in part.RNAi can also be considered as suppressing the function of target RNA; The function of target RNA can be wholly or in part.

As used herein, term " carcinostatic agent ", " conventional carcinostatic agent " or " cancer treatment drugs " refer to any therapeutical agent (for example, chemotherapy compound and/or molecular therapy compound), radiotherapy or the surgical intervention that (for example in Mammals) uses in cancer therapy.

As used herein, term " medicine " and " chemotherapeutic " (for example refer to be used for diagnosis, treatment or prevention physiology system, experimenter, or body is interior, external or isolated cells, tissue and organ) disease in or the pharmacological activity molecule of pathological conditions.Medicine plays a role by the physiology that the change medicine has been applied to its living organism, tissue, cell or vitro system.Wish that term " medicine " and " chemotherapeutic " comprise anti-hyper-proliferative, antitumor, anti-inflammatory, immunosuppression and immunomodulatory compounds and other biological is learned the treatment compound.

Detailed Description Of The Invention

The present invention relates to be used for composition and the method for target c-Rel.Especially, the invention provides by suppressing the c-Rel activity, cause immunological tolerance and be used to regulate that c-Rel is used for the treatment of the composition of cancer, autoimmune disease, allergy, inflammatory diseases, transplant rejection and bone loss and method is used for research and drug screening is used.The invention still further relates to method as the screening c-Rel activity inhibitor of determining by the biological activity of measuring the c-Rel mediation.

Immune major function is that the protection host is not subjected to infection or the intrusion via the external source main body, and described external source main body comprises bacterium, virus, parasite, allergen and allohisto compatibility (allo-tissue).Meet with exogenous antigen or by behind the pathogenic infection, the host can set the inflammatory immunne response to destroy and to suppress exogenous factor.The immunocyte that relates to inflammatory response comprises inherent immunocyte for example scavenger cell, dendritic cell, neutrophilic granulocyte and granulocyte, and the immunocyte that adapts to for example T lymphocyte and bone-marrow-derived lymphocyte.Cooperation in the immunocyte and interaction cause the generation of the lymphocytic propagation of antigen-specific and differentiation and inflammatory cytokine and medium, cause the destruction of infected cell and the restriction of exogenous factor.The organ-graft refection is the immunne response at external organization in itself.Although inflammation is a defence mechanism, uncontrolled inflammatory response can cause the chronic deterioration of the syndrome or the symptom of acute misery.In those sickness rate, use anti-inflammatory or immunosuppressive drug usually to control unimpaired immunne response.

Although immunity system can be discerned extensively various exogenous factor, its also evolved mechanism of " tolerance " autologous tissue or autoantigen; The mechanism that is called " immunological tolerance ".Because the autoantigen reactive lymphocyte is deleted or become " no response or anergy " by autoantigen between the growth period at lymphocyte, so reach immunological tolerance to autoantigen.Recently, T adjusting cell (T-reg) has also hinted and has facilitated the lymphocytic inhibition of autoreactivity.When the destroyed and autoreactivity lymphocyte of host immune tolerance mechanism was activated, autoimmune disease was ensued, and therefore attacked autologous tissue.

In nineteen sixty, find that the mechanism of the immunosuppressive effect of steroid is the lymphopoietic ability of its blocking-up activated.Equally, in the sixties, except its anti-inflammatory/immunosuppressive effect, find that also steroid is an effective anticancer agent, particularly for lymphoma and leukemia.Yet, although its inflammation-inhibiting makes us with deep impression with the ability of killing the malignant lymphatic cell, but the molecular mechanism of being responsible for retarding effect just was identified up to 1980, when Dr.Kendall A.Smith and team thereof confirm that steroid is blocked production via the interleukin-22 (IL2) of T lymphocyte (T cell).Because IL2 is responsible for the T cell proliferation during immunne response and the T cell growth factor of survival, so this finds to have explained to a great extent that steroid is the so effective reason of immunosuppressor.Subsequently, confirm cyclosporin A and tacrolimus (FK506)---find very effective new immunosuppressive drug in the blocking-up organ-graft refection, also the production by blocking-up IL2 production and other inflammatory cytokines plays a role.

In nineteen ninety, steroid can produce thus this type of widely the mechanism of immunosuppressive effect finally trace back to the inhibition of the molecule family that is called nf κ B (NF-κ B), described NF-κ B regulates many gene transcription and activates, and comprises for example gene of the transmitting inflammation tumour necrosis factor (TNF) of replying of coding IL2 and many other similar cytokine molecules.Since the homology of NF-κ B and v-Rel and c-Rel, the present called after Rel of this transcription factor family family.5 molecule members that have Rel family, wherein (p50, p65) mixture is distributed in all cells of body NF-κ B, and c-Rel mainly is expressed in the immunocyte.

NF-κ B relates at 1990 ' s in early days by the group of Dr.David Baltimore in isolating p50 of the Whitehead of MIT Institute (NF-κ B1) and p65 (RelA) subunit.Finding 3 kinds of other protein---c-Rel, RelB and p52 (NF-κ B2) are shared in the sequence homology on the Rel homeodomain (RHD).Therefore, these 5 kinds of protein classifications are the Rel transcription factor family.Although there is similarity, each Rel member with regard to the tissue expression pattern, to receptor signal reply with target gene specific with regard to be different.These differences are conspicuous according to the nonredundancy phenotype that is shown by single Rel knock-out mice.Therefore, the different Rel members' of target therapy may have different biological effects and safety/toxicity overview.

C-Rel be different from NF-κ B (p50, p65).NF-κ B is for example at U.S. Patent number 6,410, obtains describing in 516, and described patent is integrated with this paper by reference.At first, c-Rel separates as the cell homologue of the v-Rel oncogene of being encoded by bird REV-T retrovirus.Therefore C-Rel finds to be identified as in preceding 6 years proto-oncogene at nineteen ninety NF-κ B.Secondly, the NF-κ B p50 that expresses with omnipresence in all cells of body is different with p65, and c-Rel exclusively is expressed in the cell of hematopoietic origin, comprises T cell, B cell, scavenger cell and dendritic cell.The 3rd, c-Rel and NF-κ B regulate the different target gene groups in the different cells.Therefore, they have different biological functions.The 4th, the many inflammatory responses that belong to NF-κ B at first in fact belong to c-Rel (because compare with NF-κ B, c-Rel is the main mixture in the immunocyte) to a great extent.This obtains the support of the research in the c-Rel knock-out mice.In 1990 ' s mid-term, produce 2 c-Rel knock-out mice strains independently.C-Rel knock-out mice normal development but its immunologic function is a defective for example produces the ability of IL2 and other cytokines, and only the effect in the activated immunocyte is consistent with it.C-Rel in the blocking-up mouse improves the asthma in the animal model, experimental autoimmunization, diabetes and transplant rejection.C-Rel blocking-up in the animal model has also stoped the arthritic outbreak of collagen-induced property.These studies confirm that c-Rel is the crucial participant in inflammation and the autoimmune disease process, because it at immunocyte (for example, lymphocyte, dendritic cell, scavenger cell) in main effect and the existence of NF-κ B in the immunocyte forfeiture that can't compensate the c-Rel function.

C-Rel is important for lymph sample and medullary cell function.C-Rel is required at the lymphocyte responses of antigen and costimulatory signal (for example BCR, TCR, CD28, CD40, CD30, Blys, TNF acceptor), and this is the core of adaptive immunity.Particularly, c-Rel regulates immune cell propagation and survival and cytokine production.C-Rel regulates the expression of cyclin white matter (for example, cyclin E) and cell survival protein (for example, Bc1-X, Bf1-1, Mc1-1).C-Rel is ripe with stimulatory function is required altogether via the antigen presenting cell (for example, dendritic cell) of regulating costimulatory molecules and cytokine.C-Rel is a control T cell cytokine (IL-2, IFN-γ, TNF, IL-17), the general cytokine modulators that B cell cytokine (IL-6, IL-10, IL-15) and dendritic cell cytokine (IL-12, IL-23, IL-27) are expressed.

The aforementioned effect of c-Rel in aspect immune cell function many points out that c-Rel is the crucial troublemaker in many inflammation and the autoimmune disease, and blocking-up c-Rel protection or prevent the outbreak of those diseases.In fact, to be presented in several disease models outbreaks (for example, asthma, experimental autoimmune encephalomyelitis, collagen-induced property sacroiliitis, diabetes, pancreatic islets transplantation and heart transplantation) in the prevention animal be favourable for c-Rel blocking-up.Based on the function of c-Rel in immunocyte, expection c-Rel blocking-up also is favourable for the following pathological conditions of treatment (referring to table 1), wherein some illustration in the present invention.

A. acute and chronic inflammation: cause described immunocyte generation inflammatory cytokine or allergy medium (for example IgE) by the inflammation in allergen or virus and infectation of bacteria inductive lung and the respiratory system by the infiltration of immunocyte to lung.At the adult respiratory distress syndrome (ARDS) that is caused by virus (for example influenza virus, avian influenza virus H 5 N 1, SARS virus) and infectation of bacteria can be under the lethal situation, as can be caused the gaseous interchange of pulmonary edema and infringement lung by " the cytokine storm " that soak into the immunocyte generation.Sepsis is to be discharged another acute replying of performance by the general of inflammatory cytokine and medium, owing to enter the serious cellular invasion in the blood flow.At present, do not exist and be used for ARDS and pyemic effective therapy.Hepatitis, colitis, inflammatory bowel and atherosclerosis are other examples of unsolved chronic inflammatory diseases in the particular organization.In each of these cases, NF-κ B has shown the pathology effect, and in these illnesss of treatment effectively therapeutical agent (commercial or experiment) shown that blocking-up NF-κ B activates.Many researchs have shown that Rel family member activation activates and Rel family activates the ischemical reperfusion injury that responsible a plurality of organs comprise brain, heart and kidney between ischemic stage.Great majority research only concentrates on NF-κ B, and (p50, the effect of c-Rel is not devoted in the p65) effect in aforementioned pathological conditions.The invention provides c-Rel as being used for these organ specificity inflammatory diseasess and the important inflammatory mediator of perfused tissue infringement again.In a word, the invention provides be used to suppress c-Rel method and composition as the therapy that is used for ARDS, breathes inflammatory condition, Sepsis, organ specificity inflammation and ischemic damage.

B. autoimmune disease: autoimmune disease arises from host immune system and attacks himself tissue.Exist and involve the various for example at least 80 kinds of autoimmune diseases of joint (rheumatoid arthritis), central nervous system (multiple sclerosis), intestines (Crohn disease) and skin (psoriatic) of organizing.Estimate that autoimmune disease influences the American population of 5-8%, or up to 23.5 million peoples.Having confirmed to block the c-Rel activity about the previous research of c-Rel knock-out mice makes animal avoid developing autoimmunity encephalomyelitis, type i diabetes and collagen-induced property sacroiliitis.The invention provides the method and composition that in the treatment of following autoimmune disease, is used to block c-Rel.Anti-TNF therapy has in treatment and hints that successfully inflammatory cytokine plays important pathological effect in these diseases in the recent period among the patient of rheumatoid arthritis and ankylosing spondylitis.Because c-Rel relates to the expression that many inflammatory cytokine comprise TNF and IL-6, be used for blocking the method and composition of c-Rel as treatment in these diseases so the invention provides.Autoimmune disease arises from the destruction at the immunological tolerance of autologous tissue or autoantigen.If antigen is wide expression (for example, nuclear DNA), disease is a general so.By contrast, if autoantigen only is expressed in (for example, Regular Insulin) in the particular organization, disease is tissue-specific (for example, the pancreatic tissue under the situation of diabetes) so.Latest Development in the immunology has been identified its expression or the change many genes relevant with the outbreak of tissue specificity or general autoimmune disease.Great majority in these genes have effect in regulating antigen receptor (TCR/BCR) activation threshold, wherein c-Rel is the crucial effector of antigen-receptor signal approach.Therefore, the invention provides the treatment that the active method and composition conduct of c-Rel that is used for specificity inhibition autoreactivity immunocyte is used for tissue specificity and general autoimmune disease, include but not limited to rheumatoid arthritis, multiple sclerosis, diabetes, Crohn disease, Graves' disease, struma lymphomatosa, myasthenia gravis, psoriatic, systemic lupus erythematous (SLE), lymphocytosis disease (ALPS) and sjogren syndrome.

C. organ transplantation: prove that fully host T cell mainly is provided by the repulsion of the allotransplantation that provided by HLA mispairing donor.This Class Activation of host T cell via with graft on the TCR of the allogeneic-MHC molecule mediation that interacts.Because c-Rel is responsible for the T cell proliferation and the effector function of TCR mediation, so the invention provides of treatment and the prevention of the method and composition of the c-Rel that is used for blocking the host immune cell as immunosuppressor and allograft rejection.The c-Rel inhibitor finds purposes as immunosuppressor in the transplanting of many tissues, described tissue includes but not limited to marrow, major organs (heart, lung, kidney, liver) and soft tissue (skin, cartilage, bone).In other embodiments, c-Rel suppresses to be used to prevent graft versus host disease (GVH disease).

D. tolerance induction: present immunosuppressive therapy for example S-Neoral, FK506 and glucocorticosteroid can cause untoward reaction, and this causes serious problems to the patient with chronic disease.In addition, general immunosuppression also makes the host more be subject to the influence of spontaneous infection.Therefore, the current trends in the field of immunology are exploitation immunotherapy strategies, and purpose is that induced tissue or antigen specific immune tolerance are used for the treatment of autoimmune disease and are used to prevent allograft rejection.Immunological tolerance at specific antigens (or tissue) can reach by 3 kinds of main mechanism: deletion, anergy and T regulate cell.It is relevant with these 3 kinds of immunological tolerance mechanism that the experiment confirm c-Rel that carries out in performance history of the present invention suppresses.Having shown at first stimulates unresponsive anergy T cell and anergy B cell to TCR/BCR, has specific inhibition in c-Rel and NF-kB pathway.Secondly, in its c-Rel/NF-κ B and PI3K activated pathway, has specific inhibition about the research of experiencing the immature B cell of deleting.On the contrary, the activation of the PI3K-Rel/NF-kB pathway in the tolerance cell can cause the outbreak (embodiment 8) of immunological tolerance destruction and autoimmune disease.The 3rd, recent research has shown that NF-κ B/Rel and NFAT relate to effector T cell function T via the inhibition of FoxP3 and regulate cell inhibiting.At last, exist the NF-κ B/Rel activity of supporting in the blocking-up dendritic cell can stop a large amount of evidences of maturation and this type of the immature Dendritic Cells Induced T cell tolerance or the T adjusting cytodifferentiation of dendritic cell.Therefore, expection c-Rel/PI3K approach is to be used to determine immunological tolerance to autoimmune signal integration point.More specifically, expect that the sustained activation of this approach causes autoimmune disease, and the inhibition inducing immune tolerance of this approach.

E. bone loss: C-Rel and NF-κ B have shown and have related to bone loss and osteoporosis process.Several researchs have shown that IKK-β causes c-Rel, RelB and RelA (p65) in the osteoclast to activate, and this causes the bone loss of osteoclast survival and inflammation-induced.In fact, the p50/p52 that knocks out NF-κ B member causes osteopetrosis, and suppresses broken osteogenesis of the active blocking-up of IKK and prevention sacroiliitis osteoclasia.Therefore, in certain embodiments, the invention provides and be used to suppress the method and composition that conventional NF-κ B or c-Rel are used to prevent sacroiliitis or inflammation mediated osteoclasia.

In a word, c-Rel is the treatment target about autoimmune disease, inflammation, organ transplantation and bone loss.Therefore, in certain embodiments, the invention provides the c-Rel inhibitor, it reduces production, the expression of costimulatory molecules and the expression of cell survival and Cycle Regulation agent of multiple inflammatory cytokine in the lymphocyte.Therefore, the c-Rel inhibitor is suppressed at the activation of immunocyte of the main type at immunopathology situation core place: T lymphocyte, bone-marrow-derived lymphocyte, dendritic cell and scavenger cell.The invention provides the c-Rel inhibitor is used for inducing immune tolerance or develops T as auxiliary reagent regulating as the new therapy that is used for autoimmune disease and transplant rejection.

Another key character relevant with safety of medicine/toxicity overview is that the active shortage of c-Rel does not have a strong impact on phylogeny, metabolism or breeding in the c-Rel knock-out mice, and it does not cause as visible core fiberization in the Cox2 knock-out mice yet.The security property of this uniqueness wishes that because its hint is opposite with the Cox2 inhibitor, the c-Rel inhibitor will not cause adverse effect.In addition, target c-Rel has avoided the general toxicity of reflunomide and S-Neoral/FK506, and the cardiac toxic of Cox2 inhibitor.

C-Rel is accredited as proto-oncogene at first.Its viral counterpart v-Rel oncogene transforms at first and makes from the prematurity of spleen and marrow and sophisticated T and B lymph sample, marrow sample and dendritic cell immortalization, and induces the aggressive lymphoma that causes death in infected birdling.The oncogenic potential of v-Rel is confirmed further that by experiment described experiment confirm is expressed in the aggressive T chronic myeloid leukemia/lymphoma of transgenic mice development in mouse of the v-Rel under the control of T cytotropism promotor.

Because the ability that it stops apoptosis (by inducing inhibitor of apoptosis protein matter) and induces propagation (via the agent of inducing cell periodic adjustment), the c-Rel also many cancers with philtrum is relevant.The fact that c-Rel mainly is expressed in the hematopoietic cell makes it become one of oncoprotein the most general in many B cell leukemias and the lymphoma (table 1).For example, people c-Rel locus increases in diffuse large cell lymphoma (23%), Primary Mediastinal B cell lymphoma, folliculus B cell lymphoma and the He Jiejin lymphomas of remarkable ratio.C-Rel gene rearrangement or mistake are expressed and are also detected in diffuse large cell lymphoma, follicular lymphoma and lung cancer in non-cellule type.In addition, composition or trans activation NF-κ B/Rel have comprised in the chronic lymphocytic leukemia (CLL) at human B cell tumour and having detected.The CLL B cell that does not stimulate of fresh separated comprises the high-caliber nuclear NF-κ B/Rel activity of being made up of c-Rel, p50 and p65.NF-κ B/Rel can further be induced by CD40, and described CD40 is relevant in the survival of external prolongation with the CLL cell.Other examples of display abnormality c-Rel activated B cell tumour comprise multiple myeloma, burkitt's lymphoma and mantle cell lymphoma.In certain embodiments, the invention provides blocking-up c-Rel and reduce B cell lymphoma and the propagation of tumour cell and the evidence (embodiment 3, and embodiment 4) of survival with Pten disappearance.The invention is not restricted to concrete mechanism.In fact, Ji Zhi understanding is optional for putting into practice the present invention.Yet expection has obtained the observation of survival advantage in the body based on tumour B cell, and expection composition c-Rel and/or NF-kB activity are facilitated the tumour cell survival.The multiple anti-apoptosis molecule of the known adjusting of NF-κ B/Rel transcription factor comprises Bc1-x, Bc1-2, Mc1-2, IAP and FLIPs.These observations make NF-κ B/Rel family become the attractive treatment target that is used for the treatment of B cell tumour, T chronic myeloid leukemia and He Jiejin and Fei Hejiejinshi disease.

Except lymph sample tumour, unusual composition Rel/NF-kB activity is found in many non-hematopoiesis tumours and solid carcinoma, is comprised mammary cancer, prostate cancer, melanoma, colorectal carcinoma, ovarian cancer and lung cancer in non-cellule type.For example, have the transgenic mice development mammary tumor of the people c-Rel gene under the control of MMT virus (MMTV) long terminal repeat promotor, its average latency is 19.9 months.The HBT of high per-cent and tumour derived cell cording are by the composition nuclear NF-kB activity of the increase level of being made up of c-Rel, p50, Rel-B and Bc1-3, and inhibition NF-kB activity causes the cytotoxicity of breast tumor cell line.In some cases, the activation of Rel/NF-kB activity is shifted or to the malignant progression of chemotherapy resistance with becoming.This type of progress can belong to the effect of Rel/NF-κ B in inducing the gene that relates to survival, propagation, migration and blood vessel generation.

The active inhibition of the experiment confirm c-Rel that carries out in performance history of the present invention reduces and results from the hyperplasia and the lymphoma (embodiment 3) of the sudden change in the Pten gene.The Pten gene is the tumor suppressor gene of frequent sudden change in various solid tumors, and described solid tumor comprises metastatic prostate cancer, carcinoma of endometrium, metastatic melanoma and glioblastoma.The sudden change of Pten gene has the proof of obtaining in the individuality of examining Deng Shi disease (CD) above 80%.The Pten sudden change is also found in various B cell lymphomas.Especially, identified the association between the hyper-proliferative character of B cell and lymphoma cell, described cell-derived from Pten mutant mouse and sustained activation with express NF-κ B/Rel and downstream target gene thereof.In addition, cause the effective inhibition of breeding and the apoptosis induction of Pten mutant cell by pharmacological inhibitor or c-Rel knock-out mice blocking-up NF-kB activity.

Epidemiology survey shown since cancer～15% people is dead relevant with slow virus or infectation of bacteria, hints the association between infection, inflammation and the cancer.For example, the HCV infection is the important risk factor about hepatocellular carcinoma (HCC).Bacterium helicobacter pylori (Helicobactorpylori) is about one of primary accelerator of the second kind of modal cancer cancer of the stomach in the whole world.Supposed that Rel/NF-κ B is the tumor growth of inflammation-induced and the crucial medium of progress via the activation that classical IKK relies on approach.In fact, this hypothesis has obtained the support of 2 kinds of animal models: the inflammation relevant colorectal carcinoma with inflammation of liver cancer (about the model of hepatoma) (about the model of colitis associated cancer) of being correlated with.These models hint Rel/NF-κ B can promote tumour progression by inducible gene expression, described genes encoding excretory cytokine, somatomedin, survivin matter, proteolytic enzyme, and the factor that takes place about chemotaxis, migration and blood vessel.Therefore, in certain embodiments, the invention provides the method and composition of the c-Rel that is used for target inflammation associated cancer.In certain embodiments, the invention provides to be used for the treatment of and infect or chemical preparations inductive virulent c-Rel activity inhibitor described pernicious HCC, colorectal carcinoma, gastrointestinal cancer, lung cancer, carcinoma of the pancreas, bladder cancer and the esophagus cancer of including but not limited to.

Although existed about exploitation and suppressed NF-κ B and the medicine of IKK signal pathway or several pieces of reports of compound, these researchs of great majority concentrate on NF-κ B p50/p65 component.WO2005/046619 (integral body is integrated with this paper by reference) has described and has been used to regulate composition and the method that the c-Rel dependent cell factor is produced.

The experimental identification of in performance history of the present invention, carrying out sequence that can the reticent c-Rel protein expression of specificity in the c-Rel coding mRNA sequence.The silence of c-Rel causes the apoptosis of B cell lymphoma clone Wehi-231 and the inhibition (embodiment 4,5) of cell cycle progress.C-Rel in the reticent former generation B cell makes cell more be subject to the influence of apoptosis induction and reduces the propagation of CD40 signal is replied.Silence causes the remarkable infringement at the T cell-mediated immune responses of antigenic stimulation in the body of c-Rel.

The further experiment that carries out in performance history of the present invention has been identified the active a series of small molecules of inhibition c-Rel (referring to for example, embodiment 1 hereinafter and embodiment 6).

Therefore, in certain embodiments, the invention provides by suppressing the method for c-Rel signal treatment cancer, inflammation, autoimmune disease, transplant rejection and bone loss.For example, in certain embodiments, the invention provides and suppress the active method of c-Rel, to suppress the immunne response of antigen mediation, cause the immunological tolerance (for example, autoantigen, autologous tissue, allergen, allogenic antigen, allohisto compatibility, pathogenic bacteria or virus epitopes) of antigen mediation, and suppress chronic or acute inflammation (for example, ARDS, Sepsis, asthma, colitis are referring to table 1).In other embodiments, the active inhibition of c-Rel is used to suppress the hyperreactive lymphocyte function of autoreactivity (for example, autoimmune disease is lupus, rheumatoid arthritis etc. for example, referring to table 1).In other other embodiment, the active inhibition of c-Rel is with the immunosuppressive therapy that acts on transplanting.More further in the embodiment, the active inhibition of c-Rel is used for induced growth and stops, and induce and (for example have the unusual tumour of composition c-Rel activity or PI3K/Pten, B cell lymphoma, CLL, multiple myeloma, non-hodgkin's, prostate cancer, cowden's disease and mammary cancer are referring to table 1) apoptosis.

The illustrative methods that suppresses c-Rel signal pathway and downstream target gene thereof discusses in more detail hereinafter, and include but not limited to, regulate the PI3K/Pten approach that influences c-Rel and expression of target gene, (for example comprise the immunocyte acceptor, crucial BCR/TCR, the TNF receptor family, NOD1, NOD2 and Toll sample acceptor) and the signal component of known adjusting c-Rel is (for example, Lyn, Fyn, Lck, the PI3-kinases, Pten, Akt, Vav, BSAP, SLP-76, LAT, Itk, Btk, ZAP-70, PKC-β, PKC-θ, PKC-ζ, Bc1-10, MALT1, CARMA1, IKK α, IKK β, IKK γ, NIK, TRAFs, TAK1, TBK1, RIP, MyD88, TIRAP, TRAM and TRIF etc.), suppress c-Rel and downstream target gene thereof, include but not limited to, cytokine (IL-2 for example, IL-3, GM-CSF, IFN-γ, IFN-α, TNF, IL-6, IL-8, IL-10, IL-13, IL-15, IL-12, IL-17, IL-23, IL-27, EBI3, MIP1 α, Rantes, VEGF), cytokine receptor (IL-2R α for example, IFN-α acceptor, OCILRP1, NKRP1f, amphiregulin, angiopoietin-like, N-EGF2, FGF1, Bmp-1), costimulatory molecules (CD80 for example, CD86, CD40, CD44, CCR7, CXCR4, ICAM-1, VCAM-1, MMP-9), cyclin white matter (cyclin D1 for example, cyclin D2, cyclin D3, cyclin E, E2Fs, ifi202), cell survival protein (Bc1-X for example, Bf1-1, Mc1-1, c-IAPs, c-FLIP, A20), signaling molecule (IKK-I for example, MKK1, GBP-1, Pim1, Rap1, R-Rad, Map13K, and transcription factor (c-myc for example PLA-γ),, JunB, IRF1, IRF4, Stat5a, B-Atf, Tbx-2, Cited2, Pvitl, Cril, Siah2, Hox-8).

Suppressing the active illustrative methods of c-Rel comprises and uses antisense, siRNA, fit, antibody, peptide, plan peptide, small molecules and natural compounds.

I. disease treatment and analysis

In certain embodiments, the invention provides the therapy that is used for the treatment of and/or analyzes cancer, inflammation, organ-graft refection and autoimmune disease.In certain embodiments, method suppresses c-Rel activity or biological function (for example, by suppressing the interaction of c-Rel and binding partners).In other embodiments, method is come inhibit feature by regulating c-Rel stream signal conditioning agent, c-Rel transcriptional activity or c-Rel expression of target gene.Drug screening and research purposes (for example, identifying the c-Rel activity inhibitor) have been the present invention further provides.In certain embodiments, the active other inhibitor of c-Rel uses drug screening application disclosed herein to identify.

The invention is not restricted to very pathology or treatment of diseases.The non-limiting tabulation of particular cancers, inflammation and autoimmune disease and symptom provides in table 1.

The disease that shows adaptable c-Rel specific treatment

A. antisense and RNAi treatment

In certain embodiments, the expression of target c-Rel of the present invention or signal mating partner.For example, in certain embodiments, the present invention uses and to comprise the particularly composition of oligonucleotide of oligomerization antisense compounds, is used to regulate the function of the nucleic acid molecule of coding c-Rel or its signal mating partner, finally regulates the amount that c-Rel expresses and influences c-Rel downstream target gene expression.This antisense compounds (for example, antisense oligonucleotide, siRNA etc.) by one or more nucleic acid specificity hybridization of provide and encode c-Rel or its signal mating partner is finished.The normal function of the specific hybrid interfere RNA of oligomeric compounds and its target nucleic acid.

I.RNA disturbs (RNAi)

In certain embodiments, RNAi is used to suppress the c-Rel function.RNAi includes but not limited to siRNA (siRNA), bobby pin RNA (shRNA) and Microrna (miRNA).RNAi represents to be used for to control conservative cytophylaxis in foreign gene comprises the people most of eukaryotes the evolution of expression.RNAi is generally triggered by double-stranded RNA (dsRNA), and response dsRNA causes the sequence-specific mRNA degraded with target sequence homologous strand target RNAs.The medium of mRNA degraded is siRNA duplex (siRNAs), and this is produced by long dsRNA by the enzymatic cutting in cell usually.SiRNAs length is generally about 21 Nucleotide (for example, length 21-23 Nucleotide), and have be characterised in that 2 Nucleotide 3 '-the base pairing structure of overhang.Little RNA or RNAi are introduced in the cell, think that sequence delivery gives the enzyme complex that is called RISC (RNA induces reticent mixture).RISC discerns target and cuts it with endonuclease.Should be understood that if bigger RNA sequence delivery is given cell RNA enzyme III enzyme (Dicer) will be transformed into the double-stranded siRNA fragment of 21-23nt than long dsRNA so.

The siRNAs of chemosynthesis has become the potent agent of full genome analysis of the mammalian genes function of the somatocyte that is used for cultivating.Except it is used to verify the value of gene function, siRNAs also has very big potential (Tuschl and Borkhardt, the Molecular Intervent.2002 as the gene specific therapeutical agent; 2 (3): 158-67, integrate with this paper by reference).

The siRNAs transfection causes effective, long lasting post-transcriptional silencing (people such as Caplen, the Proc Natl Acad Sci U.S.A.2001 of specific gene in the zooblast; 98:9742-7; People such as Elbashir, Nature.2001; 411:494-8; People such as Elbashir, GenesDev.2001; 15:188-200; With people such as Elbashir, EMBO J.2001; 20:6877-88, all these integrate with this paper by reference).The method and composition that is used for carrying out RNAi with siRNAs is for example at United States Patent (USP) 6,506, obtains describing in 559, and described patent is integrated with this paper by reference.

SiRNAs is effective unusually aspect the amount that reduces target RNA, and by prolonging protein, usually to the level that can't detect.Reticent effect can continue the several months, and is specific unusually, and because that 1 Nucleotide mispairing between the central zone of target RNA and siRNA is enough to stop usually is reticent (people such as Brummelkamp, Science 2002; 296:550-3; With people such as Holen, Nucleic Acids Res.2002; 30:1757-66, described both integrate with this paper by reference).

Important factor in the siRNAs design be used for the siRNA bonded can be near the existence in site.People such as Bahoia, (J.Biol.Chem., 2003; 278:15991-15997; Integrate with this paper by reference) purposes of the DNA array type that is called scanning array described, can be used to design effective siRNAs to find near the site among the mRNAs.These arrays comprise by progressively add each base use physical barriers (mask) synthetic in sequence, and size is generally the oligonucleotide of Comers to a certain maximum value from monomer.Therefore array is represented the full length rna oligonucleotide complement in target gene zone.The hybridization of said target mrna and these arrays provides the detailed accessibility overview in this zone of said target mrna.These type of data are useful in antisense oligonucleotide (7 aggressiveness-25 aggressiveness) design, wherein importantly reach the compromise between oligonucleotide length and the binding affinity, to keep efficient and target-specific (people such as Sohail, Nucleic AcidsRes., 2001; 29 (10): 2041-2045).Be used to select the other method of siRNAs and consider at for example WO05054270, WO05038054A1, WO03070966A2, J MolBiol.2005 May 13; 348 (4): 883-93, J Mol Biol.2005 May 13; 348 (4): 871-81 and Nucleic Acids Res.2003 Aug 1; 31 (15): obtain among the 4417-24 describing, each in described reference integral body is by reference integrated with this paper.In addition, software (for example, the online siMAX siRNA of MWG design tool) is that commercially available or open the acquisition is used for selecting use at siRNAs.

Be used for describing among the embodiment 4 and 5 hereinafter in the exemplary siRNA sequence of regulating c-Rel expression use.The invention is not restricted to described sequence.Can design and test other sequence (for example using method described herein).

Ii. antisense

In other embodiments, the present invention uses and comprises the particularly composition of oligonucleotide (for example those that identify in the drug screening method of describing hereinafter) of oligomerization antisense compounds, be used to regulate the function of the nucleic acid molecule of coding c-Rel or its signal mating partner, the final c-Rel that expresses or the amount of signal mating partner of regulating.This antisense compounds by one or more nucleic acid specificity hybridization of provide and encode c-Rel or its signal mating partner is finished.The normal function of the specific hybrid interfere RNA of oligomeric compounds and its target nucleic acid.Target nucleic acid is commonly referred to as " antisense " by regulating with this function of the compound of its specific hybrid.Treat that interferential DNA function comprises and duplicate and transcribe.Treat that interferential RNA function comprises all critical functions, for example RNA be displaced to the protein translation site, from the montage of the protein translation of RNA, RNA to produce one or more mRNA kinds and can participate in or promoted catalytic activity by RNA.With this type of interferential population effect of target nucleic acid function be the adjusting that c-Rel expresses.In background of the present invention, " adjusting " means the increase (stimulation) in genetic expression or reduces (inhibition).For example, can suppress to express with potential treatment cancer or inflammatory diseases.

Preferred target specific nucleic acid is used for antisense.In background of the present invention, making antisense compounds " target " specific nucleic acid is multistep process.This process starts from the evaluation of its function nucleotide sequence to be regulated usually.This can be for example its expression cytogene relevant with particular disorder or the morbid state mRNA of genetic transcription (or by), or from the nucleic acid molecule of infectious agent.In the present invention, target is the proteinic nucleic acid molecule of coding c-Rel.The target process also comprises and is used for determining of one or more sites that antisense interact to take place in this gene, thereby makes and will cause required the effect for example detection or the adjusting of protein expression.In background of the present invention, the site is the transcription initiation of the opening code-reading frame (ORF) that comprises gene or the zone of terminator codon in the preferred gene.Because translation initiation codon generally is 5 '-AUG is (in the mRNA molecule of transcribing; Be 5 in corresponding D NA molecule '-ATG), so the transcription initiation codon is also referred to as " AUG codon ", " initiator codon " or " AUG initiator codon ".The minority gene have contain RNA sequence 5 '-translation initiation codon of GUG, 5 '-UUG or 5 '-CUG, and 5 '-AUA, 5 '-ACG and 5 '-CUG shown in vivo and worked.Therefore, term " translation initiation codon " and " initiator codon " can comprise many codon sequences, although the initial amino acid under every kind of situation generally is methionine(Met) (in eukaryote) or formylmethionine (in prokaryotic organism).Eucaryon and prokaryotic gene can have 2 or how alternative initiator codon, and wherein any one can preferentially be used at particular cell types or tissue, or the translation initiation under the specified conditions group.In background of the present invention, " initiator codon " and " translation initiation codon " refers to be used in vivo one or more codons of the mRNA molecule translation of initial genetic transcription by code book invention tumour antigen, and be irrelevant with the sequence of this type of codon.

Translation stop codon of gene (or " terminator codon ") can have 3 kinds of sequences (that is, and 5 '-UAA, 5 '-UAG and 5 '-UGA; One of corresponding DNA sequence is 5 respectively '-TAA, 5 '-TAG and 5 '-TGA).Term " initiation codon subarea " and " translation initiation codon district " refer to comprise about 25-about 50 this type of mRNA or the Gene Partial in abutting connection with Nucleotide in the either direction that begins from translation initiation codon (that is, 5 ' or 3 ').Similarly, term " termination codon subarea " and " translation termination codon region " refer to comprise about 25-about 50 this type of mRNA or the Gene Partial in abutting connection with Nucleotide in the either direction from the beginning of translation stop codon (that is, 5 ' or 3 ').

Opening code-reading frame (ORF) or " coding region " refer to the zone between translation initiation codon and translation stop codon, also be can efficient targeting the zone.Other target areas comprise 5 ' non-translational region (5 ' UTR), finger begins mRNA part 5 ' direction from translation initiation codon, and therefore comprise 5 ' cap site of the corresponding nucleotide on mRNA or the gene and the Nucleotide between the translation initiation codon, and 3 ' non-translational region (3 ' UTR), finger begins mRNA part 3 ' direction from translation initiation codon, and therefore comprises translation stop codon of the corresponding nucleotide on mRNA or the gene and the Nucleotide between 3 ' end.5 ' cap of mRNA comprises the N7-that is connected with 5 ' terminal residue of mRNA via 5 '-5 ' triphosphoric acid sat linkage guanosine residue that methylates.Think that 5 ' cap zone of mRNA comprises 5 ' cap structure himself and preceding 50 Nucleotide contiguous with cap.The cap zone also can be preferred target area.

Although some eukaryotic mrna transcript is directly translation, many one or more zones that are called " intron " that comprise, described intron excises from transcript before its translation.Therefore all the other (and be translated) zones are called " exon " and montage together to form continuous mRNA sequence.MRNA splice site (that is, intron-exon connects) also can be preferred target area, and the aberrant splicing excessive generation that relates to disease or wherein specific mRNA montage product therein relates under the situation of disease particularly useful.Because it also is preferred target that the unusual fusion of resetting or lacking connects.Found that intron also can be effectively, and therefore be to be used for for example preferred target area of DNA or premessenger RNA of antisense compounds target.

In certain embodiments, the target site that is used for Antisense Suppression uses software program (for example, Biognostik, Gottingen, the Germany that is obtained commercially; SysArris Software, Bangalore, India; Antisense Research Group, University ofLiverpool, Liverpool, England; GeneTrove, Carlsbad CA) identifies.In other embodiments, the target site use that is used for Antisense Suppression can identify that what United States Patent (USP) WO0198537A2 described described patent is integrated with this paper by reference near the site method.

In case one or more target sites identify, just select with the enough complementary oligonucleotide of target (that is, enough abundant and with enough specific hybrids) to produce required effect.For example, in a preferred embodiment of the invention, antisense oligonucleotide target initiator codon or near.

In background of the present invention, " hybridization " means hydrogen bonding with regard to antisense composition and method, and this can be Wo Sen-Ke Like, Hoogsteen or reverse Hoogsteen hydrogen bonding between complementary nucleosides or nucleotide base.For example, adenine and thymine is by forming the complementary nuclear of hydrogen bond paired base.But the sequence that is to be understood that antisense compounds need not the sort of 100% complementation with the target nucleic acid of its specific hybrid.But antisense compounds is a specific hybrid, when the normal function that combining of compound and target DNA or RNA molecule disturbed target DNA or RNA is lost to cause effectiveness, and the complementarity that has enough degree, with avoid antisense compounds and non-target sequence need therein under the specificity bonded condition non-specific binding (promptly, in vivo under the situation that assay method or treatment are handled, under physiological condition, or under the situation of external test method, therein under the condition that assay method is carried out) time.

Antisense compounds is usually as research reagent and diagnostic reagent.For example, can be used to illustrate the function of specific gene with the antisense oligonucleotide of specific inhibition of gene expression.Antisense compounds can for example be used to distinguish each member's of biological approach function.

The specificity of antisense and susceptibility also are applied to therepic use.For example, antisense oligonucleotide is used as the treatment part in the treatment of the morbid state in the animal and human.Antisense oligonucleotide securely and effectively is applied to the people, and numerous clinical trial is underway at present.Therefore determine that oligonucleotide is the useful treatment part that can set in the treatment plan that is used for the treatment of cell, tissue and animal, particularly people.

Although antisense oligonucleotide is the antisense compounds of preferred form, the present invention comprises other oligomerization antisense compounds, includes but not limited to oligonucleotide mimetic for example described below.Longer and shorter sequence preferably comprises about 30 the nuclear bases of about 8-(that is, about 30 of about 8-connects base) according to antisense compounds of the present invention, although also can find purposes in the present invention.Particularly preferred antisense compounds is an antisense oligonucleotide, more preferably comprises those of about 25 the nuclear bases of about 12-again.

Object lesson for the useful preferred antisense compounds of the present invention comprises the oligonucleotide that comprises key between modified main chain or non-natural nucleoside.As defining in this specification sheets, the oligonucleotide with modified main chain be included in keep phosphorus atom in the main chain those and in main chain, do not contain those of phosphorus atom.For the purpose of this specification sheets, the modified oligonucleotide that does not contain phosphorus atom between its nucleosides in the main chain also can be considered as oligonucleoside (oligonucleoside).

Preferred modified oligonucleotide main chain comprises for example phosphorothioate, the chiral phosphorus sulfonyl, phosphorodithioate, phosphotriester, the aminoalkyl group phosphotriester, methyl and other phosphonate esters, comprise 3 ' alkenyl phosphonate and chiral phosphonate, phosphinate, phosphoramidate comprises 3 '-phosphoramidate and aminoalkyl group phosphoramidate, the sulfo-amino phosphoric acid ester, the alkylthio phosphonic acid ester, the alkylthio phosphotriester, with borophosphoric acid with normal 3 '-5 ' key, the analogue of these 2 '-5 ' connection, and wherein the vicinity of nucleosides unit to 3 '-5 ' with 5 '-3 ' or 2 '-5 ' with 5 '-2 ' be connected those with reversed polarity.Also comprise various salt, mixing salt and free acid form.

The preferred modified oligonucleotide main chain that does not comprise phosphorus atom therein has by key between short-chain alkyl or cycloalkyl nucleosides, mixes the main chain that key forms between key between heteroatoms and alkyl or cycloalkyl nucleosides or one or more short chain heteroatoms or heterocycle nucleosides.These comprise having the morpholino key (part is formed by the sugar moieties of nucleosides); Siloxane main chain; Sulfide, sulfoxide and sulfone main chain; Formyl radical (formacetyl) and formyl sulfide base (thioformacetyl) main chain; Methylene radical formyl radical and formyl sulfide base main chain; The main chain that comprises chain hydrocarbon; The sulfamate main chain; Methylene imino-and methylene diazanyl main chain; Sulfonate and sulfonamide backbone; Amide backbone; And have blended N, O, S and CH ₂Other of component part.

In other preferred oligonucleotide mimetics, key between the sugar of nucleotide unit and nucleosides (that is main chain) is replaced by new group.Base unit is kept and is used for and the hybridization of suitable nucleic acid target compound.

A kind of this type of oligomeric compounds---shown that the oligonucleotide mimetic with splendid hybridization character is called peptide nucleic acid(PNA) (PNA).In the PNA compound, the sugar backbone of oligonucleotide is by the main chain that comprises acid amides, and particularly amino-ethyl glycine main chain is replaced.The nuclear base be retained and with direct or indirect combination of aza nitrogen atom of the amide moieties of main chain.The representative United States Patent (USP) of instruction PNA compound includes but not limited to U.S. Patent number: 5,539,082; 5,714,331; With 5,719,262, each in the described patent is integrated with this paper by reference.The further instruction of PNA compound can be people such as Nielsen, and Science 254:1497 finds in (1991).

The most preferred embodiment of the present invention is the oligonucleoside that has the oligonucleotide of phosphorothioate main chain or have the heteroatoms main chain, and U.S. Patent number particularly mentioned above 5,489,677--CH ₂,--NH--O--CH ₂--,--CH ₂--N (CH ₃)--O--CH ₂--[being called methylene radical (methyl-imino) or MMI main chain],--CH ₂--O--N (CH ₃)--CH ₂-,--CH ₂--N (CH ₃)--N (CH ₃)--CH ₂--and--O--N (CH ₃)--CH ₂--CH ₂--[wherein the natural phosphodiester main chain is expressed as--O--P--O--CH ₂--], and the amide backbone of U.S. Patent number mentioned above 5,602,240.The oligonucleotide that further preferably has the morpholino backbone structure of U.S. Patent number 5,034,506 mentioned above.

Modified oligonucleotide can also comprise one or more replacement glycosyl group.Preferred oligonucleotide is included in 2 ' locational one of the following: OH; F; O-, S-or N-alkyl; O-, S-or N-thiazolinyl; O-, S-or N-alkynyl; Or O-alkyl-O-alkyl, wherein alkyl, thiazolinyl and alkynyl can be that replace or unsubstituted C ₁-C ₁₀Alkyl or alkenyl and C ₂-C ₁₀Alkynyl.Particularly preferably be O[(CH ₂) _nO] _mCH ₃, O (CH ₂) _nOCH ₃, O (CH ₂) _nNH ₂, O (CH ₂) _nCH ₃, O (CH ₂) _nONH ₂, and O (CH ₂) _nON[(CH ₂) _nCH ₃)] ₂, wherein n and m are 1-about 10.Other preferred oligonucleotide are included in 2 ' locational one of the following: C ₁-C ₁₀Low alkyl group, replacement low alkyl group, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃, OCN, Cl, Br, CN, CF ₃, OCF ₃, SOCH ₃, SO ₂CH ₃, ONO ₂, NO ₂, N ₃, NH ₂, Heterocyclylalkyl, heterocycle alkaryl, aminoalkyl group amino, poly-alkylamino, replace silyl, RNA cutting group, reporter group, intercalating agent, the group of pharmacodynamic properties that the group or be used to that is used to improve the pharmacokinetic property of oligonucleotide improves oligonucleotide and other substituting groups with similarity.Preferred modify comprise 2 '-methoxy ethoxy (2 '-O--CH ₂CH ₂OCH ₃, be also referred to as 2 '-O-(2-methoxy ethyl) or 2 '-and MOE) (people such as Martin, Helv.Chim.Acta 78:486[1995]) promptly, the alkoxyl group alkoxyl group.Further preferred modify comprise 2 '-dimethylamino oxygen base oxethyl (that is O (CH, ₂) ₂ON (CH ₃) ₂Group), be also referred to as 2 '-DMAOE and 2 '-dimethylamino ethoxy oxyethyl group (be also referred to as 2 in the art '-O-dimethylamino ethoxy ethyl or 2 '-DMAEOE), promptly 2 '-O--CH ₂--O--CH ₂--N (CH ₂) ₂

Other preferably modify comprise 2 '-methoxyl group (2 '-O--CH ₃), 2 '-amino propoxy-(2 '-OCH ₂CH ₂CH ₂NH ₂) and 2 '-fluorine (2 '-F).Similar modification can also be carried out on other positions on the oligonucleotide, particularly on 3 ' terminal nucleotide or 3 ' position of the sugar in the oligonucleotide of 2 '-5 ' connection and 5 ' position of 5 ' terminal nucleotide.Oligonucleotide can also have sugared stand-in for example cyclobutyl moiety replace penta furyl sugar.

Oligonucleotide can also comprise that nuclear base (abbreviating " base " in the art usually as) is modified or displacement.As used herein, " unmodified " or " natural " nuclear base comprises purine base adenine (A) and guanine (G), and pyrimidine bases thymus pyrimidine (T), cytosine(Cyt) (C) and uridylic (U).Modified nuclear base comprises for example 5-methylcytosine (5-me-C) of other synthetic and natural nucleus bases, 5-hydroxymethyl cytosine(Cyt), xanthine, xanthoglobulin, the 2-aminoadenine, and the 6-methyl of VITAMIN B4 and guanine and other alkyl derivatives, the 2-propyl group of VITAMIN B4 and guanine and other alkyl derivatives, the 2-deracil, 2-thio-thymine and 2-sulphur cytosine(Cyt), 5-halogen uridylic and cytosine(Cyt), 5-proyl uridylic and cytosine(Cyt), the 6-azauracil, cytosine(Cyt) and thymus pyrimidine, 5-uridylic (pseudouracil), the 4-deracil, the 8-halogen, 8-amino, 8-mercaptan, 8-sulfane base, 8-hydroxyl and other 8-substituted adenines and guanines, the 5-halogen is the 5-bromine particularly, 5-trifluoromethyl and other 5-substituted uracil and cytosine(Cyt)s, 7-methyl guanine and 7-methyladenine, guanozola and 8-azaadenine, assorted guanine of 7-denitrification and the assorted VITAMIN B4 of 7-denitrification and 3-deazaguanine purine and the assorted VITAMIN B4 of 3-denitrification.Further the nuclear base comprises U.S. Patent number 3,687, those disclosed in 808.In these nuclear bases some is particularly useful for the binding affinity that increases oligomeric compounds of the present invention.These comprise 5-substituted pyrimidines, 6-aza-pyrimidine and N-2, N-6 and 0-6 substituted purin, comprise 2-aminopropyl VITAMIN B4,5-proyl uridylic and 5-proyl cytosine(Cyt).5-methylcytosine displacement has shown makes nucleic acid duplex stability increase 0.6-1.2 ℃, and is at present preferred base substitution, when with 2 '-during the sugar-modified combination of O methoxy ethyl even preferred more especially.

The another kind of oligonucleotide of the present invention is modified to relate to oligonucleotide is connected with one or more parts or conjugate chemistry, and described part or conjugate strengthen activity, cell distribution or the cellular uptake of oligonucleotide.This type of part includes but not limited to lipid part, and for example cholesterol moiety, cholic acid, thioether be (for example, hexyl-S-trityl mercaptan), sulphur cholesterol, aliphatic chain are (for example, dodecanediol or undecyl residue), phosphatide (for example, two-hexadecyl-raC-glycerine or triethylamine 1,2-two-O-hexadecyl-raC-glycerine-S-H-phosphonic acid ester), polyamine or polyglycol chain or adamantane acetic acid, palmityl part or stearylamine or hexylamine base-carbonyl-oxycholesterol part.

Technician in the association area fully understands how to produce the oligonucleotide that comprises above-mentioned modification.The invention is not restricted to above-described antisense oligonucleotide.Can utilize any suitable modification or displacement.

Need not as one man to modify about all positions in the given compound, and in fact surpass a kind of above-mentioned modification can mix individualized compound or even oligonucleotide in single nucleosides on.The present invention comprises that also it is the antisense compounds of chimeric compound." chimeric " antisense compounds or " mosaic " in background of the present invention are antisense compounds, oligonucleotide particularly, it comprises 2 kinds or more chemically different zones, and each free at least one monomer unit is formed, i.e. Nucleotide under oligonucleotide compound situation.These oligonucleotide generally comprise at least one zone, and wherein oligonucleotide is modified so that give the resistance that increases for nuclease degradation, the cellular uptake of increase and/or the binding affinity that increases for target nucleic acid to oligonucleotide.The substrate of the enzyme that can cut RNA:DNA or RNA:RNA hybrid can be served as in the other zone of oligonucleotide.For example, RNA enzyme H is the cellular endonuclease of the RNA chain of cutting RNA:DNA duplex.Therefore, the activation of RNA enzyme H causes the cutting of RNA target, thereby has greatly strengthened the efficient of the oligonucleotide inhibition of genetic expression.Therefore, with the phosphorothioate deoxy-oligonucleotide of identical target area hybridization relatively, when using chimeric oligonucleotide, use short oligonucleotide can obtain comparable result usually.The cutting of RNA target can be carried out conventional sense by gel electrophoresis, and unites nucleic acid hybridization technique known in the art in case of necessity.

Chimeric antisense compounds of the present invention can be used as 2 or more the unitized construction of number Nucleotide, modified oligonucleotide, oligonucleoside and/or aforesaid oligonucleotide mimetic form.

The present invention also comprises pharmaceutical composition and preparation, and it comprises antisense compounds of the present invention as described below.

B. antibody therapy

In other embodiments, the invention provides the c-Rel in target on cancer, inflammation or the autoimmune disease or the antibody of c-Rel pathway component.In preferred embodiments, the antibody that is used for the treatment of is humanized antibody.The method and composition that is used to produce antibody is described hereinafter.

C. small-molecule drug

More further in the embodiment, the biological activity that the invention provides the biological activity by suppressing c-Rel or change the c-Rel pathway component is treated the medicine (for example, small-molecule drug) of cancer, inflammation or autoimmune disease.Exemplary small-molecule drug is described among the embodiment 1,2,6 and 7 hereinafter.

The experimental identification of in performance history of the present invention, carrying out 3 small molecules c-Rel inhibitor families.The I compounds comprises one of following general formula:

Formula 1 formula 2

R wherein ₁, R ₂, R ₅And R ₆Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, CN, NO ₂, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁, R wherein ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.Preferred R ₃Group is selected from aryl, substituted aryl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic.For example,

Wherein X is selected from O, S, NH, NR ₇R ₄Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, haloalkenyl group, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, CN, NO ₂, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁, and R wherein ₇, R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, haloalkenyl group, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cyclophane base, substituted cycloalkyl.

The I compounds that comprises the following core texture of listing is by IT101-113 (Figure 15) illustration.

Y---any substituting group

The II compounds comprises following general pyrazolone naphthalene support

R wherein ₁And R ₂Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.R ₃And R ₄Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₃And R ₄Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.

The II compounds is by IT202-203 (Figure 15) illustration.

The III compounds comprises the following universal architecture of formula 3:

Formula 3

Wherein X and Y are independently selected from NH, NR ₄, O and S.R ₁, R ₂And R ₄Be independently selected from hydrogen, aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₁And R ₂Can connect to form ring, described ring can be heterocycle, substituted heterocycle, cyclophane base, substituted cycloalkyl.R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, COR ₁₁, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl.R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.

The III compounds is by IT201 and IT301-302 (Figure 15) illustration.

The invention is not restricted to compound described herein.The present invention has considered the chemically modified and the derivative of disclosed lead compound especially.

In other embodiments, other small-molecule drug uses drug screening method described below to identify.In particularly preferred embodiments, small-molecule drug of the present invention causes the inhibition or the prevention of cancer, inflammation or autoimmune disease.

D. fit

In other embodiments, fit as the c-Rel inhibitor.The fit vast multifarious distinct rna/DNA polymkeric substance that provides in the tertiary structure.This allows to select with the interactional uniqueness of target protein matter specificity fit.In certain embodiments, fit 1 straight chain by DNA or RNA molecule produces.In other embodiments, use is with the branched DNA molecule of Y type, X type and T type form.These branched DNA molecule increases can't cause the fit library and the fit faster screening of significantly amplification by the diversity of the fit tertiary structure that reaches of routine.

Fit is to have the function oligonucleotide sequence of special avidity with targeted molecular (being generally protein), very similar antibody-AI (Jayasena, 1999.Clin Chem45:1628).Various fit by exponential enrichment (Exponential Enrichment) (SELEX) process people such as (, 1996.Curr Opin Struct Biol 6:281) Uphoff produce via the phylogeny of part.In this process, the linear nucleic acid sequence library that generation can be increased, and just have with the sequence of the specificity binding affinity of target molecule (for example, c-Rel) in this case and carry out rapid screening.Material standed for merges subsequently and increases via PCR.This is selected and enriching step has significantly reduced the complicacy in initial library, and repeats for several times until identifying positive sequence.Fitly successfully be used for diagnosis (Gold, 1995.J Biol Chem 270:13581) and be used for the treatment of people such as (, 1995.Annu Rev Biochem 64:763) Gold as inhibitor as reagent.

In certain embodiments, the c-Rel protein with histidine mark carries out purifying by using the nickel post from intestinal bacteria.Lipidated protein is assessed on sex change SDS-PAGE by electrophoresis.Protein active is assessed by electrophoretic migration determining displacement method (EMSA).

In certain embodiments, design Y-DNA structure.Every arm of Y-DNA is designed to have the long overhang (single stranded DNA or SSDNA) that contains stochastic sequence, and 3 kinds of producing branch's formation physically are potential fit.These branches are fit to have much more diversity and complicacy.X-DNA and T-DNA can be used to produce big, diversified fit library similarly.After the formation, Y-, X-or T-DNA are quite stables.

In certain embodiments, be used for screening DNA-fit mixture (modified SELEX process) via the 6xHis-Ni bonded Solid-phase Assay method of fully determining.In brief, Y-DNA, X-DNA and the T-DNA that has stochastic sequence on each arm synthesized by dna synthesizer.6xHis-c-Rel is used for 96 holes in conjunction with Ni-bag quilt.Incubation, thorough washing are then at first carried out with the c-Rel that adheres in fit library.Tentative binding partners is retained, and unconjugated DNA is washed off.The amplification that Y-DNA-is fit uses 2 kinds of common primers to carry out via PCR, and whole process repeats with enrichment c-Rel to be had the fit of high-affinity for several times.Material standed for further screens (for example, the EMSA assay method of hereinafter describing in the experimental section) via stricter assay method.Also measure binding affinity.Final fit sequence is determined via order-checking.

In other embodiments, the combination of X, Y and T is used for producing different fit (except as 3 kinds of the fit visible of Y-DNA-) of tiring.This has more increased diversity.For example, Y-DNA can be connected with Y-DNA self.Branch tires obtaining geometrically increasing and increasing.By using different geometry and tiring, can produce many set in branched DNA-fit library, thereby make the number of free end (it carries fit sequence) from 3 (Y-DNA), 4 (X-DNA) are adjusted to almost required any number.For example, five tire (5 arm) can reach by Y-DNA is connected simply with X-DNA.Similarly, 6 tire (6 arm) can prepare by 2 tetravalence X-DNAs are connected simply.Generally speaking, when n was even number, in order to prepare n free end, needed was to connect (n-2) individual Y-DNA.When n was odd number, in order to prepare n arm, this was more complicated but still very feasible: can always n-be tired and cut into 2 parts: even number (m) and little odd number (p), wherein n=m+p.11 example of tiring: 11=6+5 have been shown herein.6 tire (6) and 5 tire (5) can easily make.By making 6-5DNA add extra Y, obtain to have 11 ramose multivalent dnas.Use this strategy, can assemble the fit DNA of any ramose.

Fitly stop c-Rel protein and NF-kB site bonded ability to be screened with regard to it.This type of material standed for changes three grades of confirmations of c-Rel (original text is confirmation, doubts to be conformation, conformation) or combines with the proteinic critical DNA identification of c-Rel, therefore disturbs the interaction of c-Rel and NF-kB site.The fit cell in vitro assay method (for example, using NF-κ B-luciferase report assay method) of using that shows inhibitor activity in the EMSA assay method is further tested.With NF-κ B-luciferase report plasmid and c-Rel fit with various ratio cotransfections in the 3T3 fibroblast.After 48 hours, cell lysate is prepared and uses the photometric determination luciferase activity by these transfectants.The fit inhibition of required c-Rel stops the homology NF-κ B motif bonded in c-Rel and the promoter region to be indicated by the luciferase activity of NF-κ B promoters driven as them.

E. peptide and intend peptide therapy

In certain embodiments, peptide and plan peptide therapy are used to reduce the active and/or expression of c-Rel.In certain embodiments, therapy be with c-Rel or the interactional peptide of c-Rel pathway component to reduce or to suppress the biological activity of c-Rel.

The present invention comprises that further modified peptide is to improve one or more useful in medical compounds character.For example, in certain embodiments, peptide is modified to strengthen the ability that it enters intracellular compartment.This type of modification include but not limited to add charged group, lipid, myristate (referring to for example, United States Patent (USP) 5,607,691; Integrate with this paper by reference) or derived from the permeable peptide of cell of HIV tat peptide or feeler foot dna homolog structural domain.

In other embodiments, peptide of the present invention can be with the form of liposome, wherein except other pharmaceutically acceptable carriers, the lipid combination that isolating peptide and amphiphilic reagent for example exist with aggregated forms, the platy layer in described aggregated forms such as micella, insoluble monolayer, liquid crystal or the aqueous solution.The suitable lipid that is used for Liposomal formulation includes but not limited to monoglyceride, triglyceride, sulfatide, lysolecithin, phosphatide, saponin(e, bile acide etc.The preparation of this type of Liposomal formulation is in the art technology level, as for example in U.S. Patent number 4,235,871; U.S. Patent number 4,501,728; U.S. Patent number 4,837,028; With U.S. Patent number 4,737, disclosed in 323, described all patents are integrated with this paper by reference.

In other embodiments, utilize the plan peptide.The various designs that are used for these type of stand-in all are fine.For example, considered to comprise the peptide of ring especially, wherein be used for the required conformation of bonded and stablize by non-peptide.All by reference at U.S. Patent number 5,192,746, U.S. Patent number 5,169,862, the U.S. Patent number 5 of this merging, 539,085, U.S. Patent number 5,576, and 423, U.S. Patent number 5,051,448 and U.S. Patent number 5,559,103 method that is used to prepare this compounds has been described.

The synthetic of the non-peptide compound of simulating peptide sequence also is known in the art.People such as Eldred (J.Med.Chem., 37:3882[1994]) have described the non-peptide antagonists of simulating peptide sequence.Similarly, people such as Ku (J.Med.Chem., the 38:9[1995]) synthetic that provided a series of these compounds is further set forth.Simulating this type of non-peptide compound of inhibitor peptides of the present invention is considered especially by the present invention.

The present invention has also considered the synthetic simulated compound, and it is the poly-compounds of repetition related peptides sequence.As known in the art, peptide can synthesize by making amino the connection with carboxyl, described carboxyl by with coupling agent for example dicyclohexylcarbodiimide (DCC) react and obtain activation.The attack of the free amine group on the activated carboxyl causes the formation of peptide bond and the release of dicyclohexylurea.May protect except that the amino of anticipation reaction and the potential reactive group the carboxyl.For example, the alpha-amino group that comprises the component of activated carboxyl can be blocked with tert-butoxycarbonyl.This blocking group can remove by the acid that makes peptide be exposed to dilution subsequently, and this is kept perfectly peptide bond.

Make in this way, peptide can be by solid phase method by easily synthetic on the peptide chain that amino acid progressively is added on growth, and described peptide chain and insoluble matrix for example polystyrene bead are connected.The C-terminal amino acid of required peptide sequence (having the amido protecting group) at first with the polystyrene bead grappling.The amino acid whose blocking group of subsequent removal.Add next amino acid (having blocking group) with coupling agent.This is cycles of washing subsequently.Repeat this circulation in case of necessity.

In one embodiment, plan peptide of the present invention is and has required active peptide and have the peptide of sequence homology.Be used for the assessment sequence homology and more importantly a kind of common methods of statistically evident similarity be to use and analyze Monte Carlo, use the algorithm of writing by Lipman and Pearson to obtain the Z value.According to this analysis, be considered as statistically evident (Pearson and Lipman, Proc.Natl.Acad.Sci. (USA), 85:2444-2448 (1988) greater than the possible significance of 6 Z value indication with greater than 10 Z value; Lipman and Pearson, Science, 227:1435 (1985)).

In certain embodiments, having required active peptide uses drug screening method described herein to identify with the plan peptide.

F. gene and transplantation therapy

In other other embodiment, the present invention has considered to be used for to express the purposes of any genetic manipulation of using regulating c-Rel.The example of genetic manipulation includes but not limited to send (for example, the giving cell, tissue or experimenter) of c-Rel inhibitor.Nucleic acid construct is delivered to cell and can uses any suitable method to carry out in external or body.Suitable method is that nucleic acid construct is introduced in the cell, thereby the sort of (for example, separately or with the expression of the siRNA construct of therapeutical agent or targeting agent combination) that make that required incident takes place.For example, cell can exsomatize to infect to reduce c-Rel and express, and cells transfected can migrate to tumour or other diseases site.

Carrying the molecule of genetic information and/or therapeutical agent introduces in the cell by any the reaching in the whole bag of tricks, described method includes but not limited to the direct injection of naked DNA construct, with the gold grain bombardment of loading described construct with use for example transgenosis of the macromole mediation of liposome, biological polymer etc.Preferred method uses the gene delivery vehicle derived from virus, and described virus includes but not limited to adenovirus, retrovirus, vaccinia virus and adeno associated virus.Because the efficient higher, be the preferred gene delivery vehicle that is used in vivo nucleic acid molecule being transferred in the host cell derived from the carrier of adenovirus with retrovirus.Adenovirus carrier has shown to be provided in the various solid tumors of very effective vivo gene transfer in the animal model, and transfers in the human solid tumor heterograft in the immunodeficient mouse.The example and the method that are used for the adenovirus carrier of transgenosis disclose WO 00/12738 and WO00/09675 and Application No. 6,033,908,6,019 at PCT, 978,6,001,557,5,994,132,5,994,128,5,994,106,5,981,225,5,885,808,5,872,154,5,830,730 and 5,824,544, described patent separately by reference integral body integrate with this paper.

Carrier can be applied to the experimenter in every way.For example, in certain embodiments of the invention, carrier uses direct injection to be administered to tumour, the tissue relevant with tumour or Inflamed tissue for example in the arthritis knuckle.In other embodiments, use via blood vessel or lymphokinesis (referring to for example, the whole by reference PCT that integrates with this paper discloses 99/02685).The exemplary dosage level of adenovirus carrier is preferably and adds 10 in the perfusion liquid ⁸-10 ¹¹Carrier granule.

G. pharmaceutical composition

The present invention further provides pharmaceutical composition (for example, comprising above-described treatment compound).Pharmaceutical composition of the present invention can be used in many ways, and relying on the part still to be whole body therapeutic and zone to be treated.Using can be partial (comprising that eye and mucous membrane comprise that vagina and rectum send), and lung (for example, by pulvis or aerocolloidal suction or be blown into, comprises and passes through atomizer; In the tracheae, in the nose, epidermis and through skin), oral area or parenteral.Parenteral administration comprises intravenously, intra-arterial, subcutaneous, intraperitoneal or intramuscularly or infusion; Or encephalic, for example use in the sheath or in the ventricle.

The pharmaceutical composition and the preparation that are used for topical application can comprise through skin patch, ointment, lotion, emulsifiable paste, gel, drops, suppository, sprays, liquid and pulvis.Conventional pharmaceutical carrier, water, powder or oil base, thickening material etc. may be essential or wish.

Be used for composition that oral area uses and preparation comprise pulvis and granula, at suspension or solution, capsule, wafer or the tablet of water or non-water vehicle.Thickening material, seasonings, thinner, emulsifying agent, dispersing auxiliary or tackiness agent may be wished.

Be used in the parenteral, sheath or composition and the preparation used in the ventricle can comprise aseptic aqueous solution, it can also comprise buffer reagent, thinner and other suitable additives, such as but not limited to, penetration enhancers, carrier compound and other pharmaceutically acceptable carrier or vehicle.

Pharmaceutical composition of the present invention includes but not limited to solution, milk sap and comprises the preparation of liposome.These compositions can be produced by various components, and described component includes but not limited to preformed liquid, self-emulsification solid and self-emulsifying semisolid.

The pharmaceutical preparation of the present invention that can present with unit dosage routinely can be prepared according to well-known routine techniques in the pharmaceutical industry.This type of technology comprises makes activeconstituents and pharmaceutical carriers or vehicle bonded step.Generally speaking preparation is prepared by following: activeconstituents and liquid vehicle or the meticulous solid carrier that separates or both are combined equably and intimately, make the product moulding then in case of necessity.

Composition of the present invention can be mixed with many possible formulations, such as but not limited to tablet, capsule, liquid syrups, soft gel, suppository and enema.Composition of the present invention can also be formulated as suspension in water, non-water or blending agent.Aqeous suspension can further comprise the material of the viscosity that increases suspension, for example comprises Xylo-Mucine, Sorbitol Powder and/or dextran.Suspension can also comprise stablizer.

In one embodiment of the invention, pharmaceutical composition can be prepared and use as foam.The pharmacy foam comprises preparation, such as but not limited to milk sap, microemulsion, emulsifiable paste, gelifying agent and liposome.Although substantially similar in character, these preparations are different aspect the component of final product and consistence.

The reagent that strengthens the picked-up of oligonucleotide on cell levels also can add in medicine of the present invention and other compositions.For example, cation lipid is Lipofectin (U.S. Patent number 5,705,188), positively charged ion glycerol derivative and polycation molecule polylysine (WO97/30731) for example for example, also strengthens the cellular uptake of oligonucleotide.

Composition of the present invention can be additionally contained in other annexing ingredients of normal discovery in the pharmaceutical composition.Therefore, for example composition can comprise other, compatible, pharmaceutical active material, for example antipruritic, astringent matter, local anesthetic or anti-inflammatory agent, maybe can be included in physics and prepare other material useful in the various formulations of composition of the present invention, for example dyestuff, seasonings, sanitas, antioxidant, opalizer, thickening reagent and stablizer.Yet this type of material should not disturb the biological activity of the component of composition of the present invention undeservedly when regulating.Preparation can be sterilized, when needing with can not be nocuously mix for example lubricant, sanitas, stablizer, wetting agent, emulsifying agent, the salt that is used to influence osmotic pressure, buffer reagent, tinting material, food flavouring and/or aromatic essence etc. with the auxiliary reagent of the nucleic acid interaction of preparation.

Administration relies on the severity and the responsiveness of morbid state to be treated, and wherein the course of treatment from a couple of days continues to the several months, or until the minimizing that realizes curing or reaching morbid state.Best dosage regimen can be calculated by the measurement of the intravital drug accumulation of patient.Use the doctor and can easily determine optimal dose, medication and repetition rate.Optimal dose can become according to the relative potency of single oligonucleotide, and generally can be based on finding effective EC in the animal model in external or body ₅₀S, or estimate based on embodiment described herein.Generally speaking, dosage is 0.01 μ g-100g/kg body weight, and can every day, weekly, every month or give one or many every year.The treatment doctor can be based on the residence time of measuring and medicine the concentration in body fluid or tissue estimate to be used for the repetition rate of administration.After success is treated, may wish to make the experimenter to experience supportive care to stop the recurrence of morbid state, wherein therapy is used with the maintenance dose of 0.01 μ g-100g/kg body weight, once a day or repeatedly to per 20 years once.

H. with combination of anti-c-Rel compound or the therapeutical agent used altogether

In certain embodiments, c-Rel target compound of the present invention is used altogether with other therapeutical agent.The therapeutical agent of broad range finds purposes in the present invention.Any therapeutical agent that can use altogether with the compound of target c-Rel or related protein.

The expection of all kinds of antitumour drugs (for example, anticancer) reagent is used for using in certain embodiments of the invention.Be suitable for including but not limited to the carcinostatic agent that the present invention uses, apoptosis-induced reagent, and following reagent: suppress the adenosine deaminase function, suppress the pyrimidine biosynthesizing, suppress the purine skeleton biosynthesizing, suppress the Nucleotide change, suppress ribonucleotide reductase, it is synthetic to suppress thymidine monophosphate (TMP), suppress dihydrofolate reduction, it is synthetic to suppress DNA, forms adducts with DNA, infringement DNA, suppressing DNA repairs, the intercalation of DNA makes the l-asparagine deamination, and it is synthetic to suppress RNA, arrestin matter is synthetic or stable, suppress the synthetic or function of microtubule, arrestin matter kinase activity, blocking-up is about somatomedin, cytokine, the acceptor of activation part etc.

In certain embodiments, being adapted for the exemplary carcinostatic agent that uses in the compositions and methods of the invention includes but not limited to: 1) alkaloid, (for example comprise the microtubule inhibitor, vincristine(VCR), vinealeucoblastine(VLB) and vindesine etc.), microtubule stabilizer (for example, taxol (TAXOL) and docetaxel etc.), with the chromatin depressant of functions, comprise topoisomerase enzyme inhibitor, epipodophyllotoxin (for example Etoposide (VP-16) and teniposide (VM-26) etc.) for example, with the reagent of target topoisomerase I (for example, camptothecine and Rinotecan (irinotecan) (CPT-11) etc.); 2) covalency DNA wedding agent (alkylating agent), comprise that mustargen (for example, mustargen, Chlorambucil, endoxan, ifosfamide and busulfan (MYLERAN) etc.), nitrosourea (for example, carmustine, Luo Mositing and semustine etc.), with other alkylating agents (for example, Dacarbazine, melamine methylol, thiophene are for group and mitomycin etc.); 3) non-covalent DNA wedding agent (antitumor antibiotics), (for example comprise the nucleic acid inhibitor, gengshengmeisu (dactinomycin) etc.), anthracene nucleus (for example, daunoblastin (daunomycin and Rubomycin C), Dx (Zorubicin) and darubicin (idarubicin) etc.), amerantrone (for example, anthracene nucleus analogue for example mitoxantrone etc.), bleomycin (BLENOXANE) etc., and Plicamycin (Plicamycin) etc.; 4) antimetabolite, comprise that antifol (for example, methotrexate, FOLEX and MEXATE etc.), the purine antimetabolite (for example, 6-mercaptopurine (6-MP, PURINETHOL), 6-thioguanine (6-TG), azathioprine, acyclovir, ganciclovir, the chlorine Desoxyadenosine, 2-chlorodeoxyadenosine (CdA), with 2 '-Deoxycofomycin (pentostatin) etc.), the pyrimidine antagonist (for example, the fluorine pyrimidine (for example, 5 FU 5 fluorouracil (ADRUCIL), floxuridine (FdUrd) (floxuridine) etc.), with cytosine(Cyt) cytosine arabinoside (for example, CYTOSAR (ara-C) and fludarabine etc.); 5) enzyme comprises altheine enzyme and hydroxyurea etc.; 6) hormone comprises glucocorticosteroid, estrogen antagonist (for example, Tamoxifen etc.), on-steroidal androgen antagonist (for example, flutamide etc.), on-steroidal estrogen antagonist (estrogens) is (for example, and aromatase inhibitor (for example, Anastrozole (ARIMIDEX) etc.) Tamoxifen); 7) platinic compound (for example, cis-platinum and carboplatin etc.); 8) monoclonal antibody (for example, liking) of puting together with anticarcinogen, toxin and/or radionuclide than appropriate, Rituxin, Avastin etc.; 9) biological response modifier (for example, Interferon, rabbit (for example, IFN-α etc.) and interleukin (for example, IL-2 etc.) etc.); 10) adoptive immunotherapy; 11) hemopoieticgrowth factor; 12) reagent of inducing tumor cell differentiation (for example, all-trans-retinoic acid etc.); 13) gene therapy technology; 14) antisense therapy technology; 15) tumor vaccine; 16) at the treatment (for example, Batimastat etc.) of metastases; 17) angiogenesis inhibitor; 18) the proteoplast inhibitor (for example, VELCADE); 19) acetylize and/or methylation inhibitor (for example, hdac inhibitor); 20) NF κ B conditioning agent; 21) Cycle Regulation inhibitor (for example, CDK inhibitor); 22) p53 protein function conditioning agent; 23) radiation kinases inhibitor (for example Gleevec) and 23).

The conventional any oncolytic reagent that uses finds purposes in the compositions and methods of the invention in the cancer therapy background.For example, FDA support approval is used for using in the U.S. prescription of oncolytic reagent.International similar means about U.S.F.D.A. is supported similar prescription.Table 2 provides approval to be used for the tabulation of the exemplary antitumour drug that uses in the U.S..Those skilled in the art are to be understood that about the chemotherapy of all U.S. approval required " product mark " and describe indication about the approval of exemplary agents, drug administration information, toxicity data etc.

Table 2

RIL-2 (takes off-alanyl-1, Serine-125 human interleukin-2) A Lun pearl monoclonal antibody (IgG1 κ anti-CD 52 antibody) A Li vitamin A acid (9-cis-retinoic acid) Zyloric (1,5-dihydro-4H-pyrazoles [3,4-d] pyrimidin-4-one one sodium salt) altretamine (N, N, N ', N ', N ' ', N ' ',-vegolysen, 3,5-triazine-2,4, the 6-triamine) amifostine (sulfur alcohol, the 2-[(3-aminopropyl) amino]-, dihydrogen orthophosphate (ester)) Anastrozole (1,3-benzene diacetonitrile, a, a, a ', a '-tetramethyl--5-(1H-1,2,4-triazol-1-yl methyl)) white arsenic asparaginase (altheine amide group lytic enzyme, the EC-2 type) the BCG Live (freeze-dried preparation of Mycobacterium bovis attenuated strain (bacille Calmette-Guerin vaccine [BCG], the inferior strain in Montreal)) (4-[1-(5 for the bexarotene capsule, 6,7,8-tetrahydrochysene-3,5,5,8,8-pentamethyl--2-naphthyl) vinyl] phenylformic acid) the bexarotene gel

Proleukin Campath Panretin Zyloprim Hexalen Ethyol Arimidex Trisenox Elspar TICE BCG Targretin Targretin

Chiron Corp.， Emeryville，CA Millennium and ILEX Partners，LP， Cambridge，MA Ligand Pharmaceuticals， Inc.，San Diego CA GlaxoSmithKline， Research Triangle Park，NC US Bioscience，West Conshohocken，PA US Bioscience AstraZeneca Pharmaceuticals，LP，Wilmington，DE Cell Therapeutic， Inc.，Seattle，WA Merck & Co.，Inc.， Whitehouse Station， NJ Organon Teknika， Corp.，Durham，NC Ligand Pharmaceuticals Ligand Pharmaceuticals

Bleomycin is (by the cytotoxicity glycopeptide antibiotic of wheel silk Streptomycin sulphate (Streptomyces verticillus) production; Bleomycin A 2With bleomycin B 2) capecitabine (5 '-deoxidation-5-fluoro-N-[(pentyloxy) carbonyl]-cytidine) carboplatin (platinum, diamines [1, the two carboxylic acids (2-)-0 of 1-tetramethylene, 0 ']-, (SP-4-2)) carmustine (1,3-two (2-chloroethyl)-1-nitrosourea) contains carmustine celecoxib (as 4-[5-(4-tolyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl] benzsulfamide) Chlorambucil (4-[two (second monochloroethane) amino] kynurenine) cis-platinum (PtCl of polifeprosan 20 implants 2H 6N 2) Cladribine (2-chloro-2 '-deoxidation-b-D-adenosine) and endoxan (2-[two (2-chloroethyl) amino] tetrahydrochysene-2H-13; 2-oxynitride phosphor ring 2-oxide monohydrate) cytarabine (1-b-D-arabinofuranosyl adenin cytimidine, C9H 13N 3O 5) (5-(3 for cytosine arabinoside liposome Dacarbazine, 3-dimethyl-1-triazenyl)-and imidazoles-4-methane amide (DTIC)) gengshengmeisu, dactinomycin is (by the actinomycin that slight Streptomycin sulphate (Streptomyces parvullus) is produced, C 62H 86N 12O 16) reach according to pool spit of fland α (recombinant peptide) daunoblastin liposome ((8S-cis)-8-ethanoyl-10-[(3-amino-2; 3; 6-three deoxidations-á-L-lysol-own pyranyl) oxo]-7; 8; 9,10-tetrahydrochysene-6,8; 11-trihydroxy--1-methoxyl group-5,12-tetracene dione hydrochloride)

Blenoxane Xeloda Paraplatin BCNU，BiCNU Gliadel Wafer Celebrex Leukeran Platinol Leustatin，2-CdA Cytoxan， Neosar Cytosar-U DepoCyt DTIC-Dome Cosmegan Aranesp DanuoXome

Bristol-Myers Squibb Co.，NY，NY Roche Bristol-Myers Squibb Bristol-Myers Squibb Guilford Pharmaceuticals， Inc.，Baltimore，MD Searle Pharmaceuticals， England GlaxoSmithKline Bristol-Myers Squibb R.W.Johnson Pharmaceutical Research Institute， Raritan，NJ Bristol-Myers Squibb Pharmacia & Upjohn Company Skye Pharmaceuticals， Inc.，San Diego，CA Bayer AG，Leverkusen，Germany Merck Amgen，Inc.，ThousandOaks，CA Nexstar Pharmaceuticals， Inc.，Boulder，CO

Daunoblastin HCl; daunomycin ((1S; 3S)-3-ethanoyl-1; 2; 3; 4; 6; 11-six hydrogen-3; 5; 12-trihydroxy--10-methoxyl group-6; 11-dioxo-1-naphthacenyl 3-amino-2; 3; 6-three deoxidations-(α)-L-lysol-own pyranoside hydrochloride denileukin (recombinant peptide) dexrazoxane ((S)-4; 4 '-(1-methyl isophthalic acid; 2-ethane two bases) two-2; the 6-piperazinedione) docetaxel ((2R; 3S)-N-carboxyl-3-phenylisoserine; the N-tert-butyl ester; the 13-ester contains 5b-20-epoxy-12a; 4; 7b, 10b, 13a-hexahydroxy-tax-11-alkene-9-ketone 4-acetate 2-benzoate; trihydrate) Zorubicin HCl (8S; 10S)-and 10-[(3-amino-2,3,6-three deoxidations-a-L-lysol-own pyranyl) oxo]-8-glycolyl-7; 8; 9,10-tetrahydrochysene-6,8; 11-trihydroxy--1-methoxyl group-5,12-tetracene dione hydrochloride) Dx	Cerubidine Ontak Zinecard Taxotere Adriamycin, Rubex Adriamycin PFS intravenous injection	Wyeth Ayerst， Madison，NJ Seragen，Inc.， Hopkinton，MA Pharmacia & Upjohn Company Aventis Pharmaceuticals， Inc.，Bridgewater，NJ Pharmacia & Upjohn company Pharmacia & Upjohn Company
			Mycocet dromostanolone propionate (17b-hydroxyl-2a-methyl-5a-androstane-3-one propionic salt) dromostanolone propionate Elliott ' s B solution epirubicin ((8S-cis)-10-[(3-amino-2; 3; 6-three deoxidations-a-L-Arab-own pyranyl) oxo]-7; 8; 9; 10-tetrahydrochysene-6; 8; 11-trihydroxy--8-(glycolyl)-1-methoxyl group-5; 12-tetracene dione hydrochloride) Epoetin Alfa α (recombinant peptide) estramustine (female steroid-1; 3; 5 (10)-triolefins-3; 17-glycol (17 (β))-; 3-[two (2-chloroethyl) carbaminate] 17-(dihydrogen orthophosphate); disodium salt; monohydrate; or estradiol 3-[two (2-chloroethyl) carbaminate] 17-(dihydrogen orthophosphate); disodium salt, monohydrate)	Doxil Dromostanolone Masterone injection Elliott′s B Solution Ellence Epogen Emcyt	Sequus Pharmaceuticals， Inc.，Menlo park，CAEli Lilly & Company， Indianapolis，IN Syntex，Corp.，PaloAlto，CA Orphan Medical，Inc Pharmacia & UpjohnCompany Amgen，Inc Pharmacia & UpjohnCompany

The phosphoric acid Etoposide (4 '-demethyl epipodophyllotoxin 9-[4,6-0-(R)-ethylidene-(β)-the D-glucopyranoside], 4 '-(dihydrogen orthophosphate)) Etoposide, VP-16 4-demethyl epipodophyllotoxin 9-[4,6-0-(R)-ethylidene-(β)-the D-glucopyranoside] Exemestane (6-methylene radical androstane-1,4-diene-3, the 17-diketone) filgrastim (r-metHuG-CSF) floxuridine (endarterial) (2 '-deoxidation-5-floxuridine) fludarabine (the antiviral agent vidarabine fluoridize nucleotide analog, 9-b-D-arabinofuranosyladenine (ara-A)) Fluracil, 5-FU (5-fluoro-2,4 (1H, 3H)-and pyrimidine dione) (7-α-[9-(4 for fulvestrant, 4,5,5,5-five fluorine amyl group sulfinyls) nonyl] female steroid-1,3,5-(10)-triolefin-3, the 17-beta-diol) gemcitabine (2 '-deoxidation-2 ', 2 '-difluocytosine mono-hydrochloric salts (b-isomers)) lucky trastuzumab ozogamicin is (anti--CD33hP67.6) acetate goserelin ([D-Ser (But) 6，Azgly 10] acetate of LHRH; Jiao-Glu-His-Trp-Ser-Tyr-D-Ser (But)-Leu-Arg-Pro-Azgly-NH2 acetate [C 59H 84N 18O 14·(C 2H 4O 2) x) the hydroxyurea ibritumomab tiuxetan (result from monoclonal antibody Ibritumomab and joint-sequestrant tiuxetan[N-[2-two (carboxymethyl) amino]-two (the methyl)-ethyls of 2-] the immunoconjugates darubicin (5 of thiocarbamide covalent linkage between the glycine; 12-tetracene diketone; 9-ethanoyl-7-[(3-amino-2; 3; 6-three deoxidations-(α)-L-lysol-own pyranyl) oxo]-7; 8; 9; 10-tetrahydrochysene-6; 9; 11-trihydroxy-hydrochloride; (7S-cis) ifosfamide (3-(2-chloroethyl)-2-[(2-chloroethyl) amino] tetrahydrochysene-2H-1; 3,2-oxynitride phosphor ring 2-oxide compound) imatinib mesylate (4-[(4-methyl isophthalic acid-piperazine) methyl]-the N-[4-methyl

Etopophos Vepesid Aromasin Neupogen FUDR Fludara Adrucil Faslodex Gemzar Mylotarg Zoladex implant Hydrea Zevalin Idamycin IFEX Gleevec

Bristol-Myers Squibb Bristol-Myers Squibb Pharmacia & Upjohn Company Amgen，Inc Roche Berlex Laboratories， Inc.，Cedar Knolls， NJ ICN Pharmaceuticals， Inc.，Humacao，PuertoRico IPR Pharmaceuticals， Guayama，Puerto Rico Eli Lilly Wyeth Ayerst AstraZeneca Pharmaceuticals Bristol-Myers Squibb Biogen IDEC，Inc.， Cambridge MA Pharmacia &Upjohn Company Bristol-Myers Squibb Novartis AG，Basel， Switzerland

-3-[[4-(3-piperidyl)-2-pyrimidyl] amino]-phenyl] the benzamide mesylate) Intederon Alpha-2a (recombinant peptide) Interferon Alpha-2b (recombinant peptide) Rinotecan HCl ((4S)-4; 11-diethyl-4-hydroxyl-9-[(4-piperidines-diazonium piperidines) carbonyl acyloxy]-the 1H-pyrans [3 ' .4 ': 6; 7] benzazole also [1; 2-b] quinoline-3; 14 (4H; 12H) dione hydrochloride trihydrate) letrozole (4; 4 '-(1H-1; 2; 4-triazol-1-yl methylene radical) formyl tetrahydrofolic acid (L-L-glutamic acid two benzonitriles); N[4[[(2 amino-5-formyl radical-1; 4; 5; 6; 7; 8 tetrahydrochysenes, 4 oxo 6-pteridyls) methyl] amino] benzoyl]; calcium salt (1:1)) LEVAMISOLE HCL HCl ((-)-(S)-2; 3; 5; 6-tetrahydrochysene-6-phenylimidazole [2,1-b] thiazole mono-hydrochloric salts C 11H 12N 2SHCl) Luo Mositing (2-chloro-N-(2-chloroethyl)-N-methyl aminoethyl hydrochloric acid) acetate megestrol 17 α (acetoxyl group)-6-methyl pregnant steroid-4; 6-diene-3; 20-diketone melphalan; L-PAM (4-[two (2-chloroethyl) amino]-the L-phenylalanine) mercaptopurine; 6-MP (1; 7-dihydro-6H-purine-6-thioketones monohydrate) mesna (sodium 2-mercapto esilate) methotrexate (N-[4-[[(2; 4-diamino-6 pteridyl) methyl] methylamino-] benzoyl]-L-L-glutamic acid) Methoxsalen (9-methoxyl group-7H-fluorine [3; 2-g] [1]-cumarone-7-ketone) ametycin ametycin mitotane (1; 1-two chloro-2-(o-chloro-phenyl-)-2-(rubigan) ethane) mitoxantrone (1; 4-dihydroxyl-5; 8-two [[the 2-[(2-hydroxyethyl) amino] ethyl] amino]-9,10-amerantrone dihydrochloride)

Roferon-A Intron A (Betaseron of freeze-drying) Camptosar Femara Wellcovorin, Leucovorin Ergamisol Mustargen Megace Alkeran Purinethol Mesnex Methotrexate Uvadex Mutamycin Mitozytrex Lysodren Novantrone

Hoffmann-La Roche，Inc.，Nutley，NJ Schering AG，Berlin，Germany Pharmacia & Upjohn Company Novartis Immunex，Corp.， Seattle，WA Janssen Research Foundation， Titusville，NJ Merck Bristol-Myers Squibb GlaxoSmithKline GlaxoSmithKline Asta Medica Lederle Laboratories Therakos，Inc.，WayExton，Pa Bristol-Myers Squibb superGen，Inc.， Dublin，CA Bristol-Myers Squibb Immunex Corporation

Nrolone Phenylpropionate nofetumomab oprelvekin (IL-11) oxaliplatin (cis-[(1R; 2R)-1; 2-cyclohexanediamine-N; N '] [oxalic acid closes (2-)-O; O '] platinum) taxol (5 β; 20-epoxy-1; 2a; 4; 7 β; 10 β; 13a-hexahydroxy-tax-11-alkene-9-ketone 4; 10-diacetin 2-benzoate 13-ester and (2R; 3S)-N-benzoyl-3-phenylisoserine) pamldronate (phosphonic acids (3-amino-1-hydroxy propylidene) two-; disodium salt; pentahydrate; (APD)) pegademase ((mono methoxy polyethylene glycol succinimido) 11-17-adenosine deaminase) pegaspargase (mono methoxy polyethylene glycol succinimido altheine enzyme) Pei Feisi booth (covalent conjugates of reorganization methionyl human G-CSF (filgrastim) and mono methoxy polyethylene glycol) pentostatin pipobroman Plicamycin, Plicamycin (by the microbiotic of fold streptomycete (Streptomyces plicatus) production) porfimer sodium Procarbazine (N-sec.-propyl-μ-(2-methyl hydrazine)-toluoyl amine mono-hydrochloric salts) acrinamin (6-chloro-9-(1-methyl-4-diethyl-amine) butyl amino-2-methoxyl group acridine) rasburicase

Durabol in-50 Verluma Neumega Eloxatin TAXOL Aredia Adagen (pegademase bovine) Oncaspar Neulasta Nipent Vercyte Mithracin Photofrin Matulane Atabrine Elitek

Organon，Inc.，West Orange，NJ Boehringer Ingelheim Pharma KG，Germany Genetics Institute Inc.，Alexandria，VA Sanofi Synthelabo， Inc.，NY，NY Bristol-Myers Squibb Novartis Enzon Pharmaceuticals， Inc.，Bridgewater， NJ Enzon Amgen，Inc.， Parke-Davis Pharmaceutical Co.， Rockville，MD Abbott Laboratories， Abbott Park，IL Pfizer，Inc.，NY，NY QLT Phototherapeutics， Inc.，Vancouver， Canada Sigma Tau Pharmaceuticals， Inc.，Gaithersburg， MD Abbott Labs Sanofi-Synthelabo，

(recombinant peptide) Rituximab (restructuring anti-CD 20 antibodies) Sargramostim (recombinant peptide) streptozotocin (streptozotocin 2-deoxidation-2-[[(methyl nitrosamine) carbonyl] amino]-a (and b)-D-glucopyranose and 220mg anhydrous citric acid) talcum (Mg3Si 4O 10(OH) 2) Tamoxifen ((Z) 2-[4-(1,2-phenylbenzene-1-butylene base) phenoxy group]-N, N-dimethyl amine 2-hydroxyl-1,2,3-tricarballylic acid salt (1:1) Temozolomide (3,4-dihydro-3-methyl-4-oxo-imidazole [5,1-d]-also-and tetrazine-8-methane amide) teniposide, VM-26 (4 '-demethyl epipodophyllotoxin 9-[4,6-O-(R)-2-thenylidene-(β)-the D-glucopyranoside]) testolactone (13-hydroxyl-3-oxo-13,17-ring expansion androstane-1,4-diene-17-acid [dgr]-lactone) Tioguanine, 6-TG (2-amino-1,7-dihydro-6H-purine-6-thioketones) thiophene is for sending (aziridine, 1,1 ' 1 ' '-phosphoric acid thionyl time tromethamine-, or Tris (1-'-aziridino) phosphine sulfide) topotecan HCl ((S)-10-[(dimethylamino) methyl]-4-ethyl-4,9-dihydroxyl-1H-pyrans [3 ', 4 ': 6,7] indoles [1,2-b] quinoline-3,14-(4H, 12H)-and the diketone mono-hydrochloric salts) toremifene (2-(p-[(Z)-4-chloro-1,2-phenylbenzene-1-butylene base]-phenoxy group)-N, N-dimethyl amine Citrate trianion (1:1)) tositumomab, I 131 tositumomabs (reorganization muroid immunotherapy mono-clonal IgG 2A λ anti-CD 20 antibodies (I131 is a radioimmunotherapy antibody)) Herceptin (recombinant monoclonal IgG 1κ resists-HER2 antibody) vitamin A acid, ATRA (all-trans-retinoic acid) uracil mustard

Rituxan Prokine Zanosar Sclerosol Nolvadex Temodar Vumon Teslac Thioguanine Thioplex Hycamtin Fareston Bexxar Herceptin Vasanoid Uracil Mustard

Inc.， Genentech，Inc.， South San Francisco， CA Immunex Corp Pharmacia & Upjohn Company Bryan，Corp.，Woburn，MA AstraZeneca Pharmaceuticals Schering Bristol-Myers Squibb Bristol-Myers Squibb GlaxoSmithKline Immunex Corporation GlaxoSmithKline Roberts Pharmaceutical Corp.，Eatontown，NJ CorixaCorp.， Seattle，WA Genentech，Inc Roche Roberts Labs

Valrubicin, N-TFA Zorubicin-14-valerate ((2S-cis)-2-[1,2; 3; 4,6,11-six hydrogen-2; 5; 12-trihydroxy--7 methoxyl group-6,11-dioxo-[[42,3; 6-three deoxidations-3-[(trifluoroacetyl group)-and amino-α-L-lysol-own pyranyl]-oxyl]-the 2-naphthacenyl]-2-oxoethyl valerate vinealeucoblastine(VLB), leurocristine (C 46H 56N 4O 10·H 2SO 4) vinealeucoblastine(VLB) (C 46H 56N 4O 10·H 2SO 4) vinorelbine (3 ', 4 '-two dehydrogenations-4 '-deoxidation-C '-navelbine [R-(R *，R *)-2,3 dihydroxybutanedioic acid salt (1:2) (salt)]) Zoledronic acid, Zoledronic acid ((1-hydroxyl-2-imidazoles-1-base-phosphonoethyl) phosphonic acids monohydrate

Capsules Valstar Velban Oncovin Navelbine Zometa

Anthra-->Medeva Eli Lilly Eli Lilly GlaxoSmithKline Novartis

In other embodiments, other reagent (for example, immunomodulator, anti-inflammatory agent, NSAID and immunotherapeutic agent) are used together with composition of the present invention.

Useful non-steroid class anti-inflammatory agent includes but not limited to acetylsalicylic acid, Ibuprofen BP/EP, diclofenac, Naproxen Base Compd 90459, chlorine is than Lip river sweet smell, fenoprofen, flubufen, Ketoprofen, indoprofen, pyrroles's sweet smell, carprofen, Taisho), Pu Moluofen, Mo Luoluofen, three oxygen Lip river sweet smell, sutoprofen, aminoprofen, tiaprofenic acid, R.D. 17345, the bucloxonic acid, indomethacin, sulindac, how U.S. fragrant, zomepirac, R.D. 17345, zidometacin, acemetacin, fentiazac, clidanac, oxygen Lip river sweet smell, mefenamic acid, meclofenamic acid, Flufenamic Acid, niflumic acid, tolfenamic acid, the auspicious rope of two sulphur, flufenisal, piroxicam, sudoxicam, isoxicam; Salicyclic acid derivatives comprises acetylsalicylic acid, sodium salicylate, choline magnesium trisalicylate, salsalate, diflunisal, Sasapyrin, sulfasalazine and olsalazin; The p-aminophenyl amphyl comprises second ammonia phenol and Phenacetin; Indoles and indeneacetic acid comprise indomethacin, sulindac and R-ETODOLAC; Heteroaryl acetic acid comprises tolmetin, diclofenac and ketorolac; Anthranilic acid (fenamic acid ester) comprises mefenamic acid and meclofenamic acid; Bmap acid comprises former times health (piroxicam, tenoxicam), and pyrrolidine-diones (Phenylbutazone, oxyphenthartazone); With alkane ketone, comprise nabumetone and pharmacy acceptable salt thereof and composition thereof.About the more detailed description of NSAIDs, referring to Paul A.Insel, Analgesic-Antipyretic andAnti-inflammatory Agents and Drugs Employed in the Treatmentof Gout, in Goodman ﹠amp; (Perry B.Molinhoff and Raymond W.Ruddon edit Gilman ' s The Pharmacological Basis ofTherapeutics 617-57, the 9th edition, 1996) and Glen R.Hanson, Analgesic, (A.R.Gennaro edits Antipyreticand Anti-Inflammatory Drugsi n Remington:The Science andPractice of Pharmacy Vol II 1196-1221, the 19th edition, 1995), described reference is whole by reference in this merging.

Other examples of prevention and therapeutical agent include but not limited to immunomodulator, anti-inflammatory agent (adrenocortical hormone for example, reflunomide (for example, beclometasone, budesonide, flunisolide, fluticasone, triamcinolone, methylprednisolone, prednisolone, prednisone, hydrocortisone), glucocorticosteroid, steroid, non-steroid class anti-inflammatory agent (for example, acetylsalicylic acid, Ibuprofen BP/EP, diclofenac and cox 2 inhibitor), and leukotriene antagonist (for example, Singulair, methyl xanthine, Zafirlukast and zileuton), β 2-agonist (for example, salbutamol, bit sieve, Partusisten, that woods of different second, Orciprenaline, pirbuterol, salbutamol, the terbutaline formoterol, the special step of Salmeterol and salbutamol his woods), anticholinergic agents (for example, ipratropium bromide and oxitropium bromide), sulfasalazine, Trolovol, sulphenone, antihistaminic, anti-malarial agents (for example Oxychloroquine), antiviral agent, and microbiotic (for example, gengshengmeisu (actinomycin in the past), bleomycin, erythromycin, penicillin, Plicamycin and anthramycin (AMC)).

The well-known any immunomodulator of those skilled in the art can use in application process altogether of the present invention and composition.Immunomodulator can influence one or more or all aspects of the immunne response among the experimenter.The aspect of immunne response includes but not limited to, the cell communication in inflammatory response, complement cascade, white corpuscle and lymphocyte differentiation, propagation and/or effector function, monocyte and/or basophil count and the immune system cell.In certain embodiments of the invention, immunomodulator is regulated an aspect of immunne response.In other embodiments, immunomodulator is regulated the aspect that surpasses of immunne response.In a preferred embodiment of the invention, immunomodulator is applied to one or more aspects that the experimenter suppresses or reduce experimenter's immunne response ability.In a specific embodiments of the present invention, immunomodulator suppresses or checks immunne response among the experimenter.

The example of immunomodulator includes but not limited to that proteinaceous reagent is cytokine for example, and peptide mimics and antibody are (for example, people, humanization, chimeric, mono-clonal, polyclone, Fvs, ScFvs, Fab or F (ab) 2 fragments or epi-position binding fragment), nucleic acid molecule (for example, antisense nucleic acid molecule and triple helical), small molecules, organic compound, mineral compound, self antigen, allergen, allogenic antigen, and pathogen antigen.Especially, immunomodulator includes but not limited to methotrexate, leflunomide, endoxan, Cytoxan, according to lily magnolia, cyclosporin A, Minocycline HCl, azathioprine, microbiotic (for example, FK506 (tacrolimus)), methylprednisolone (MP), glucocorticosteroid, steroid, the mycophenolic acid morpholine ethyl ester, rapamycin (sirolimus), mizoribine, deoxidation nitrile guanidine rhzomorph, brequinar, malononitriloamindes (for example leflunamide), the TXi Baoshouti conditioning agent, the B-cell receptor conditioning agent, the antigen presenting cell conditioning agent, the cytokine receptor conditioning agent, antigen and mastocyte conditioning agent.

The example of TXi Baoshouti conditioning agent includes but not limited to, anti-TXi Baoshouti antibody (for example, anti-CD 4 antibodies (for example, cM-T412 (Boeringer), IDEC-CE9.1 (IDEC and SKB), mAB4162W94, Orthoclone and OKTcdr4a (Janssen-Cilag)), anti-cd 3 antibodies (for example, Nuvion (Product Design Labs), OKT3 (Johnson﹠amp; Johnson), or Rituxan (IDEC)), anti-CD5 antibody (for example, the immunoconjugates that anti-CD5 ricin connects), anti-CD7 antibody (for example, CHH-380 (Novartis)), anti-CD8 antibody, anti-CD40 part mono-clonal body (for example, IDEC-131 (IDEC)), anti-CD 52 antibody is (for example, CAMPATH1H (Ilex)), anti-CD2 antibody (for example, MEDI-507 (MedImmune, Inc., international publication number WO 02/098370 and WO 02/069904), anti-CD1 a antibody (for example, Xanelim (Genentech)) and anti-B7 antibody (for example, IDEC-114) (IDEC)), the CTLA4-immunoglobulin (Ig), LFA-3TIP (Biogen, international publication number WO 93/08656 and U.S. Patent number 6,162,432), anti-CD28, anti-PD1, anti-BTLA, C type lectin antibody, cytokine (IL2 for example, IFN-γ, GM-CSF, TNF, IL15, IL7, IL17).

The example of B-cell receptor conditioning agent includes but not limited to, anti-IgM, anti-IgG, anti-IgD, anti-IgA, anti-IgE, anti-CD20, anti-CD20, anti-CD19, anti-CD21, anti-CD23, anti-CD30, anti-TLR9, anti-Fas, anti-Blys acceptor, anti-April acceptor, anti-BCMA acceptor, anti-Fc γ acceptor, anti-Blys (Baff), anti-April, anti-BCMA and anti-BTLA.

The example of antigen presenting cell receptor modulators includes but not limited to, anti-CD40, anti-TLRs, antibody (for example NKRP1f, OCILRP2) at C type agglutinin molecule, cytokine (for example GM-CSF, TNF, IL1, IL6, IL12, IL15, IL23, IL27) and at stimulating altogether or the antibody (for example CD80, CD86, PDL1, PDL2, B7-H1, B7-H3) of corepressor molecule.

The example of cytokine receptor conditioning agent includes but not limited to, soluble cytokine receptor (for example, TNF-α acceptor or its segmental extracellular domain, IL-1 beta receptor or its segmental extracellular domain, with IL-6 acceptor or its segmental extracellular domain), cytokine or its fragment (interleukin I L-2 for example, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-13, IL-15, IL-23, TNF-α, TNF-β, Interferon, rabbit (IFN)-α, IFN-β, IFN-7 and GM-CSF), the antibacterial agent receptor antibody (for example, anti-IFN receptor antibody, anti-IL-2 receptor antibody (for example, Zenapax (ProteinDesign Labs)), anti-IL-3 receptor antibody, anti-IL-4 receptor antibody, anti-IL-6 receptor antibody, anti-IL-10 receptor antibody, anti-IL-12 receptor antibody, the anti-il-13 receptor antibody, anti-IL-15 receptor antibody, with the anti-il-23 receptor antibody), anti-cytokine antibodies (for example anti-TNF, anti-IL2, anti-IL6).

In one embodiment, antigen is self or self antigen, allergen, external source or allogenic antigen or pathogen antigen.The example of self and allogenic antigen includes but not limited to, Regular Insulin, derived from the extract of insulin production β cell or cell, collagen, derived from synovial cell's extract or cell, myelin basic protein (MBP), glycoprotein, MHC-mispairing donorcells, tissue, extract or MHC mixture derived from neuronal tissue.

The example of allergen and pathogen antigen comprises derived from pollen, the dirt mite, pathogenic bacteria or virus (for example, mycobacterium tuberculosis (M.tuberculosis), HCV, HIV, herpes simplex (Herpes simplex), helicobacter pylori (Hellicobacter pylori), Listeria monocytogenes (Listeria monocytogeneses), streptococcus (streptococcus), influenza virus, avian influenza virus (H5N1), sars coronavirus, HCV, HIV, EBV, herpes simplex, helicobacter pylori, listeria (Listeria)) molecule or extract.

In one embodiment, the cytokine receptor conditioning agent is the mastocyte conditioning agent.The example of mastocyte conditioning agent includes but not limited to, inhibitor (for example for STEM CELL FACTOR (c-kit receptors ligand), mAb 7H6, mAb 8H7a, pAb 1337, FK506, CsA, dexamethasone and fluconcinonide), c-kit acceptor inhibitor (for example STI 571 (being called CGP 57148B in the past)), the mast cell protease 1 inhibitor (for example, GW-45, GW-58, wortmannin, LY 294002, calphostin C, cytochalasin D, gertistein, KT5926, staurosproine and lactoferrin), Relaxin (" RLX "), the IgE antagonist (for example, antibody rhuMAb-E25 horse pearl difficult to understand monoclonal antibody, HMK-12 and 6HD5, and mABHu-901), the IL-3 antagonist, the IL-4 antagonist, IL-10 antagonist and TGF β.

In combination therapy to treat, compound of the present invention and other drug reagent are applied to Mammals (for example, people, sex) by ordinary method.Reagent can or separate formulation and use with single formulation.The significant quantity of other treatment agent is that those skilled in the art are well-known.Yet the best significant quantity scope of determining the other treatment agent is fully in technician's scope.Another kind of therein therapeutical agent is applied in one embodiment of the invention of animal, and the significant quantity of compound of the present invention is less than the significant quantity of wherein not using the other treatment agent.In another embodiment, the significant quantity do not used less than compound of the present invention wherein of the significant quantity of conventional reagent.In this way, relevant with the high dosage of arbitrary reagent undesirable side effects can drop to minimum.Other potential advantages (including but not limited to the dosage regimen improved and/or the medicine cost of minimizing) will be conspicuous for those skilled in the art.

In various embodiments, therapy (for example, prevention or therapeutical agent) is used like this: be separated by less than 5 minutes, be separated by less than 30 minutes, be separated by 1 hour, with about 1 hour interval, with Yue-Yue 2 hours interval, with about 2 hours-Yue 3 hours interval, with about 3 hours-Yue 4 hours interval, with about 4 hours-Yue 5 hours interval, with about 5 hours-Yue 6 hours interval, with about 6 hours-Yue 7 hours interval, with about 7 hours-Yue 8 hours interval, with about 8 hours-Yue 9 hours interval, with about 9 hours-Yue 10 hours interval, with about 10 hours-Yue 11 hours interval, with about 11 hours-Yue 12 hours interval, interval with about 12 hours-18 hours, be separated by 18 hours-24 hours, be separated by 24 hours-36 hours, be separated by 36 hours-48 hours, be separated by 48 hours-52 hours, be separated by 52 hours-60 hours, be separated by 60 hours-72 hours, be separated by 72 hours-84 hours, be separated by 84 hours-96 hours, or be separated by 96 hours-120 hours.In preferred embodiments, 2 or more polytherapy in identical patient goes to a doctor, use.

In certain embodiments, one or more compounds of the present invention and one or more other therapies (for example, prevention or therapeutical agent) cyclical administration.The circulation therapy relates to (for example uses first kind of therapy, first kind is prevented or therapeutical agent) for some time, (for example use second kind of therapy subsequently, second kind is prevented or therapeutical agent) for some time, randomly, (for example use the third therapy subsequently, prevention or therapeutical agent) for some time or the like, and repeat thisly to use in turn, i.e. circulation is so that reduce development to the resistance of one of therapy, to avoid or to reduce the side effect of one of therapy and/or improve the effect of therapy.

In certain embodiments, can repeat using of same compound of the present invention, and use and to separate at least 1 day, 2 days, 3 days, 5 days, 10 days, 15 days, 30 days, 45 days, 2 months, 75 days, 3 months or at least 6 months.In other embodiments, can repeat except that compound of the present invention identical therapy (for example, prevention or therapeutical agent) use, and use and can separate at least 1 day, 2 days, 3 days, 5 days, 10 days, 15 days, 30 days, 45 days, 2 months, 75 days, 3 months or at least 6 months.

II. antibody

The invention provides isolated antibody.In preferred embodiments, the invention provides and isolated polypeptide specificity bonded monoclonal antibody, described isolated polypeptide comprises at least 5 amino-acid residues of c-Rel.These antibody find purposes in treatment described herein and research method.In certain embodiments, antibody is also used in research application, drug screening and treatment in the antibody of the factor that influences the c-Rel signal (for example at) and is found purposes.

At proteinic antibody of the present invention can be any mono-clonal or polyclonal antibody, as long as it can discern this protein.The present invention has further considered Fvs antibody, antiidiotypic antibody and the above-mentioned any epi-position binding fragment that intrabody, the antibody of reorganization generation, people's antibody, humanized antibody, chimeric antibody, synthetic antibody, strand Fvs antibody, single-chain antibody Fab fragment, F (ab ') fragment, disulphide connect.Antibody can the application of the invention protein produce according to conventional antibody or Antiserum Preparation process as antigen.

The present invention has considered the use of mono-clonal and polyclonal antibody.Any suitable method can be used for being created in the antibody that method and composition of the present invention uses, and includes but not limited to, disclosed herein those.For example, in order to prepare monoclonal antibody, protein is applied to animal (for example, Mammals) like this or together with suitable carriers or thinner under the condition that allows antibody producing.In order to strengthen the antibody producing ability, can use fully or incomplete Freund's adjuvant or other adjuvants (for example, mineral coagulant for example aluminium hydroxide, surfactant for example lysolecithin, general stream Buddhist nun restrain polyvalent alcohol, polyanion, peptide, oil emulsion, dinitrophenol(DNP) and other adjuvants for example bacille Calmette-Guerin vaccine and corynebacterium parvum vaccine).Usually, per 2 week-6 weeks of protein use 1 time, about altogether 2 times-Yue 10 times.The animal that is suitable for using in these class methods includes but not limited to primate, rabbit, dog, cavy, mouse, rat, sheep, goat etc.

Produce cell in order to prepare monoclonal antibody, select single animal that its antibody titers has been confirmed (for example, mouse), and after the immunization 2 days-5 days the last time, the spleen or lymphoglandula and the making antibody producing cells and the myeloma cell that wherein comprise that gather in the crops it are merged, and produce hybridoma to prepare required monoclonal antibody.The measurement of the antibody titers in the antiserum(antisera) is protein and antiserum(antisera) reaction, the activity of the labelled reagent of measurement and antibodies subsequently by making mark as described below for example.Cytogamy can be carried out according to currently known methods, for example, and the method for describing by Koehler and Milstein (Nature 256:495[1975]).As merging promotor, for example use polyoxyethylene glycol (PEG) or Sendai virus (HVJ), preferred PEG.

Myeloma cell's example comprises NS-1, P3U1, SP2/0, AP-1 etc.The ratio of antibody producing cells to be used (splenocyte) number and myeloma cell's number is preferably the about 20:1 of about 1:1-.PEG (preferred PEG 1000-PEG 6000) preferably adds with the concentration of about 10%-about 80%.Cytogamy can be by making 2 kinds of cells mixture at about 20 ℃-Yue 40 ℃, preferred about 30 ℃-Yue 37 ℃ of following incubations effectively carried out in about 1 minute-10 minutes.

The whole bag of tricks can be used for the hybridoma that antibody (for example, at c-Rel) is produced in screening.For example, directly the absorption or the solid phase of adsorbing with it together with carrier be (for example with it when the supernatant liquor of hybridoma adds antibody, microplate) in the time of in, add AIA then (if in cytogamy, use mouse cell, use anti-mouse immuning ball protein antibody so) or with the albumin A of radioactive substance or enzyme labelling, with detect at the proteinic monoclonal antibody of solid phase bonded.Alternatively, the supernatant liquor of hybridoma is added in the solid phase that AIA or albumin A adsorb with it, adds protein then with radioactive substance or enzyme labelling, with detect at the proteinic monoclonal antibody of solid phase bonded.

The selection of monoclonal antibody can be modified according to any currently known methods or its and be carried out.Usually, use to the substratum that is used for zooblast that wherein adds HAT (xanthoglobulin, aminopterin, thymidine).Hybridoma can use any selection and growth medium, as long as can be grown.For example, can use RPMI 1640 substratum that comprise 1%-20%, preferred 10%-20% foetal calf serum, comprise the GIT substratum of 1%-10% foetal calf serum, be used to cultivate the serum free medium (SFM-101, Nissui Seiyaku) of hybridoma etc.Usually, be incubated at 20 ℃-40 ℃, preferred 37 ℃ at about 5% CO ₂Carry out about 5 days-3 weeks under the gas, preferred 1 week-2 week.The antibody titers of the supernatant liquor of hybridoma culture can according to above with regard to the antibody titers of the anti-protein in the antiserum(antisera) same way as of description measure.

Monoclonal antibody (for example, at c-Rel) separation can be with purifying according to carrying out with those identical modes of conventional polyclonal antibody, the for example separation of immunoglobulin (Ig) and purifying, for example saltout, pure precipitation, isoelectric precipitation, electrophoresis, with ion-exchanger (for example, DEAE) absorption and desorb, super centrifugal, gel-filtration or specific purification process, wherein only with hypersober for example antigen collect antibody in conjunction with solid phase, albumin A or Protein G, and dissociate in conjunction with to obtain antibody.

Polyclonal antibody can be prepared by the modification of any currently known methods or these methods, comprises the antibody of acquisition from the patient.For example, the mixture of preparation immunogen (at proteinic antigen) and carrier protein, and according to passing through the mixture immune animal with the same way as of description with regard to Monoclonal Antibody above.From immune animal, reclaim the material that comprises at antibody, and separation and antibody purification.

About being ready to use in to the immunogen of animal immune inoculation and the mixture of carrier protein, can use the carrier and the haptens of any carrier protein and any blending ratio, as long as effectively produce at haptenic antibody, it is crosslinked and be used for immunization on carrier.For example, bovine serum albumin, Niu Huanqiu albumen, keyhole limpet hemocyanin etc. can with hapten conjugation, its weight ratio is about 0.1 part-Yue 20 parts, preferred about 1 part-Yue 5 parts/1 part haptens.

In addition, various condensing agents can be used to make haptens and carrier coupling.For example, glutaraldehyde, carbodiimide, maleimide Acibenzolar, the Acibenzolar reagent etc. that comprises sulfydryl or dithio pyridyl find purposes in the present invention.Condensation product is applied to the animal site that allows antibody producing like this or with suitable carriers or thinner.In order to strengthen the antibody producing ability, can use complete or incomplete freund's adjuvant.Usually, per 2 week-6 weeks of protein use 1 time, about altogether 3 times-Yue 10 times.

Polyclonal antibody recovery from the blood of the animal by the aforesaid method immunity, ascites etc.Antibody titers in the antiserum(antisera) can according to above with regard to the supernatant liquor that hybridoma is cultivated the sort of identical mode of description measure.The separation of antibody and purifying can carry out according to separating with purification process with the sort of identical immunoglobulin (Ig) of description with regard to monoclonal antibody above.

This paper is not limited to the immunogen of any particular type as immunogenic protein.For example, c-Rel protein (gene that further comprises the nucleotide sequence with part change) can be used as immunogen.In addition, can use proteinic fragment.Fragment can obtain by any method, and described method includes but not limited to the fragment of expressing gene, the processing of proteinic enzymatic, chemosynthesis etc.

In certain embodiments, antibody (for example, monoclonal antibody) carries out humanization.Humanized antibody changes, so that make it immunogenicity more be arranged to the people, for example, by making up wherein mouse antigen in conjunction with variable domains and people's constant domain link coupled chimeric antibody.Humanized antibody generally is wherein some CDR residue and people's antibody of may some FR residue being replaced by the residue from the similar site in the rodent antibody.It is well-known in the art being used to make antibody humanization's method, and includes but not limited to United States Patent (USP) 6,054,297,4,816,567,6,180,377,5,871,907,5, those that describe in 585,089 and 6,180,370, described patent is integrated with this paper separately by reference.

In other embodiments, the technology of describing for single-chain antibody production (referring to for example, the whole by reference United States Patent (USP) 4,946,778 of integrating with this paper) can be suitable for producing the c-Rel specific antibody.Other embodiments are utilized for the Fab expression library and are made up the technology of describing (the whole by reference people such as Huse that integrate with this paper, 1989, Science 246:1275).

The present invention has further considered people's antibody.People's antibody can obtain (the whole by reference people such as Cote that integrate with this paper by end user's hybridoma, 1983, PNAS 80:2026), by transform human B cell (people such as Cole in external use EBV virus, 1985 In:MonoclonalAntibodies and Cancer Therapy, Alan R.Liss, Inc., pp.77-96), or by immunity transform transgenic mice with the sort of alternative mouse Ig locus of personnel selection origin.In other embodiments, be used to produce technology (for example, people such as Morrison, 1984, the PNAS 81:6851 of chimeric antibody; People such as Neuberger, 1984, Nature 312:604; People such as Takeda, 1985, Nature 314:452, described reference separately by reference integral body integrate with this paper) by montage to the gene of the special mouse antibodies molecule of c-Rel together with gene from suitable bioactive human antibody molecules.

III. drug screening

In certain embodiments, the invention provides drug screening assay method (for example, to screen anticancer or antiphlogiston).In certain embodiments, screening method of the present invention utilizes c-Rel.For example, in certain embodiments, the invention provides the method that screening changes the compound of (for example, reducing) c-Rel expression.In other embodiments, candidate compound is antisense, siRNA reagent (for example, oligonucleotide), fit or at the peptide of c-Rel.More further in the embodiment, candidate compound is to suppress active small molecules of c-Rel or natural compounds.The exemplary assay method that is used for screening candidate inhibitor for example hereinafter experimental section describe.

In some preferred embodiment, the drug screening assay method of hereinafter describing in the experimental section is used to assess candidate compound.For example, in certain embodiments, high throughput screening assay method based on fluorescence polarization (FP) is used for identifying destruction people's c-Rel homodimer and binding partners (for example, the CD28 response elemets in the promoter region of IL-2 gene (CD28RE) bonded small molecules.In certain embodiments, compounds identified uses electrophoretic migration determining displacement method further to screen in the fluorescence polarization determination method.Yet, the invention is not restricted to hereinafter disclosed method.The expection of other drug screening method within the scope of the invention.

In a kind of screening method, candidate compound is assessed with regard to its change (for example, reducing) active ability of c-Rel, by making compound and the cells contacting of expressing c-Rel, measures the influence of candidate compound to c-Rel function or expression then.In certain embodiments, candidate compound is measured by the c-Rel that electrophoretic migration determining displacement method or immunoblotting detect the minimizing level in the nuclear extract the active influence of c-Rel.In other embodiments, the effect of candidate compound is measured by the c-Rel biologically active level in the measuring and adjusting c-Rel downstream target gene (for example, cytokine, cyclin white matter, cell survival protein and other target genes described herein).C-Rel target gene mRNA expression levels can use any suitable method to measure, include but not limited to disclosed herein those, for example RNA trace, quantitative PCR, microarray or by monitoring phenotype (for example, the minimizing in cancer, inflammation or the autoimmune disease symptom).

In certain embodiments, external drug screening uses the wild-type or the subdomain of the purifying of c-Rel and binding partners thereof to carry out.Compound screens with regard to itself and c-Rel protein interaction and the interactional ability that suppresses c-Rel function or c-Rel and binding partners.In certain embodiments, binding partners is fixed, promoting one or both proteinic compound and separating of complex form not, and the automatization that adapts to assay method.Being combined in any container that is suitable for the contact reacts thing of test compounds and c-Rel or its binding partners (for example, DNA, p300/CBP, coactivator, medium, or other transcription factors comprise STAT3, STAT5, c-Jun, IRF) finished.The example of this type of container comprises microtiter plate, test tube and Eppendorf tube.In one embodiment, can provide the fusion rotein that adds one or both protein of permission and matrix bonded structural domain.For example, glutathione-S-transferase/AIP-6 fusion rotein or glutathione-S-transferase/target fusion rotein can be adsorbed on glutathione agarose pearl (Sigma Chemical; St.Louis, Mo.) or on the gsh deutero-microtiter plate, its subsequently with the combination of the protein of test compounds or test compounds and non-absorption, and mixture (for example, under the physiological condition about salt and pH) under the condition that helps mixture to form carries out incubation.Behind the incubation, pearl or micro titer plate well are washed removing any unconjugated component, and fixing matrix under the situation of pearl is directly or indirectly measured mixture.Alternately, mixture can dissociate with matrix, and protein bound or active level use standard technique to measure.

The other technologies that are used for proteinaceous solid is fixed on the matrix also can be used in screening assay method of the present invention.For example, and upstream c-Rel signal protein (for example, PI3K, PKC-θ, IKK) or known and c-Rel interacts or other protein of regulating the c-Rel signal can use puting together of vitamin H and Streptavidin to fix.Biotinylated protein uses technology well-known in the art (for example, biotinylation test kit, Pierce Chemicals; Rockford I11.) is prepared by vitamin H-NHS (N-hydroxy-succinamide), and is fixed in the 96 hole flat boards (Pierce Chemical) of Streptavidin bag quilt.Alternatively, with c-Rel signal protein reaction but interferencing protein and test compounds bonded antibody can not derived to the hole of flat board, and unconjugated protein is puted together by antibody and is captured in the hole.Except above describe for the GST-fixed complex those, the method that is used to detect this type of mixture comprises that the antibody mediated immunity that uses with the reaction of c-Rel signal protein detects mixture, and relies on the enzyme connection assay method that detects with the enzymatic activity of c-Rel signal correction.

In other embodiments, use the competition drug screening assay method that wherein can combine c-Rel with the competition of test compounds specificity in conjunction with the neutralizing antibody of c-Rel.In this way, antibody can be used to detect the existence of sharing any compound of one or more antigenic determinants with c-Rel.

More further in the embodiment, the transgenic animal with (for example, deactivation or cross and express) c-Rel gene of change are used in drug screening is used.For example, in certain embodiments, compound screens with regard to the transfer in its minimizing c-Rel transgenosis or the knock-out mice or the ability of inflammation.

Test compounds of the present invention can be used any acquisition the in numerous methods in the combinatorial library method known in the art, comprises biological library; (have the functional of peptide but have molecular library new, non-peptide main chain, it has resistibility but still retains biological activity to enzyme liberating to peptide library; Referring to, people such as Zuckennann for example, J.Med.Chem.37:2678-85[1994]); But the parallel solid phase of space addressing or liquid phase library; The synthetic library method that needs deconvolution; ' the single compound of single pearl ' library method; With the synthetic library method of using the affinity chromatography screening.Biological library and peptide library method are preferred for the purposes of using peptide library, and other 4 kinds of methods can be applicable to the small molecules library (Lam (1997) Anticancer Drug Des.12:145) of peptide, non-peptide oligomer or compound.

The example that is used for the method in synthetic molecules library can find in the art, for example in following reference: people such as DeWitt, Proc.Natl.Acad.Sci.U.S.A.90:6909[1993]; People such as Erb, Proc.Nad.Acad.Sci.USA 91:11422[1994]; People such as Zuckermann, J.Med.Chem.37:2678[1994]; People such as Cho, Science261:1303[1993]; People such as Carrell, Angew.Chem.Int.Ed.Engl.33.2059[1994]; People such as Carell, Angew.Chem.Int.Ed.Engl.33:2061[1994]; With people such as Gallop, J.Med.Chem.37:1233[1994].

The library of compound or peptide (for example can be presented on solution, Houghten, Biotechniques 13:412-421[1992]), or at pearl (Lam, Nature 354:82-84[1991]), chip (Fodor, Nature 364:555-556[1993]), bacterium or spore (U.S. Patent number 5,223,409; Integrate with this paper by reference), plasmid (people such as Cull, Proc.Nad.Acad.Sci.USA 89:18651869[1992]) is gone up or phage (Scott and Smith, Science 249:386-390[1990]; DevlinScience 249:404-406[1990]; People such as Cwirla, Proc.Natl.Acad.Sci.87:6378-6382[1990]; Felici, J.Mol.Biol.222:301[1991]) on.

In other embodiments, FRET (fluorescence resonance energy transfer) (FRET), calculating modeling based on the structural information that derives from X-ray crystallography, high throughput drug screening (GE-HTS) or co-immunoprecipitation (co-IP) based on the genetic expression overview can be used for identifying or assessing compound, described compound has the c-Rel function of inhibition or (for example disturbs c-Rel and binding partners, coactivator, corepressor, transcribe medium, signaling molecule and transcription factor comprise c-Rel, p50, p65, RelB, p52, STATs, IRFs, c-jun, c-fos, Foxp3 and NF-ATs) interactional ability.

IV. express or lack the transgenic animal of c-Rel

The present invention has considered to comprise the generation of the transgenic animal of exogenous c-Rel gene or its mutant and varient (for example, truncate, deletion, insertion, single nucleotide polymorphism or the allos c-Rel gene under the control of the promotor of crossing expressing gene).In other embodiments, the invention provides the transgenic animal that knock out with c-Rel gene.In preferred embodiments, compare the phenotype of transgenic animal display change (for example, cancer or inflammation or autoimmune disease symptom increase or that reduce) with the wild-type animal.Be used to analyze the existence of this type of phenotype or non-existent method include but not limited to disclosed herein those.

Transgenic animal of the present invention are found purposes in medicine (for example, cancer or inflammatory diseases) screening.In certain embodiments, test compounds (for example, suspecting for treatment cancer or the useful medicine of inflammatory diseases) and control compound (for example, placebo) are applied to transgenic animal and control animal, and the assessment effect.

In certain embodiments, the transgenic animal of describing in the experimental section hereinafter are used for drug screening and use.Yet, the invention is not restricted to transgenic animal disclosed herein.Other transgenic animal can make in all sorts of ways and produce, and described method includes but not limited to hereinafter those disclosed.

Transgenic animal can produce via the whole bag of tricks.In certain embodiments, be used to introduce transgenosis at the cells,primordial of each etap and be used to produce transgenic animal.Rely on the etap of cells,primordial, use different methods.Zygote is the best target that is used for microinjection.In mouse, masculonucleus reach the about 20 microns size of diameter, and this allows the reproduced injection of 1-2 skin liter (pl) dna solution.Zygote has major advantage as the purposes that is used for the target of transgenosis, because in most of the cases, the DNA that injects will mix in the host genome (people such as Brinster, Proc.Natl.Acad.Sci.USA 82:4438-4442[1985]) before the spilting of an egg first time.Therefore, all cells of transgenic nonhuman animal all will carry the transgenosis of mixing.Generally speaking, this also will be reflected in the offspring that transgenosis effectively passes to the founder, because 50% sexual cell will comprise transgenosis.U.S. Patent number 4,873,191 have described the method that is used for zygosporic microinjection; The disclosure integral body of this patent is integrated with this paper.

In other embodiments, retroviral infection is used for transgenosis is introduced in the non-human animal.In certain embodiments, retrovirus is used for transfection zygote (integrating with the U.S. Patent number 6,080,912 of this paper by reference) by retroviral vector being injected in the crack of zygosporic ovum week.In other embodiments, developmental non-human embryo can be in vitro culture to blastocyst stage.In this time course, blastomere can target be used for retroviral infection (Janenich, Proc.Natl.Acad.Sci.USA 73:1260[1976]).Effective infection of blastomere is removed the transparent acquisition (people such as Hogan, inManipulating the Mouse Embryo, Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, N.Y.[1986]) that brings by enzymically treat.Be used to introduce genetically modified virus vector and generally be and carry genetically modified replication defect type retrovirus (people such as Jahner, Proc.Natl.Acad Sci.USA 82:6927[1985]).Transfection is by making blastomere and cultivate easily and obtain effectively (Stewart waits the people, EMBOJ., 6:383[1987]) on the individual layer virus producing cell.Carry out during stage that alternatively, infection can be after more.Virus or virus producing cell can inject in the segmentation cavity (people such as Jahner, Nature 298:623[1982]).Most of founders will inlay for transgenosis, take place in the cell subclass that forms transgenic animal because only integrate.In addition, the founder can comprise the miscellaneous retroviruses of transgenosis on genomic different positions and insert, and this generally will separate in the offspring.In addition, embryo's intrauterine retroviral infection can be introduced transgenosis in kind of the system by second trimester of pregnancy, although efficient very low people such as (, the same [1982]) Jahner.Use retrovirus known in the art or retroviral vector relate to the other method that produces transgenic animal product retrovirus cell microinjection that retroviral particle or ametycin are handled to ovum week of zygote or body early embryo in the crack (PCT International Application No. WO 90/08832[1990]; and Haskell and Bowen; Mol.Reprod.Dev., 40:386[1995]).

In other embodiments, transgenosis is introduced in the embryonic stem cell, and the stem cell of transfection is used to form the embryo.The ES cell by external under appropriate condition, cultivate pre-implantation embryos obtain (people such as Evans, Nature 292:154[1981]; People such as Bradley, Nature 309:255[1984]; People such as Gossler, Proc.Acad.Sci.USA 83:9065[1986]; With people such as Robertson, Nature 322:445[1986]).Transgenosis can effectively be introduced in the ES cell by the DNA transfection by the whole bag of tricks known in the art, and described method comprises the transfection of coprecipitation of calcium phosphate, protoplastis or plastid fusion, fat transfection and the mediation of DEAE-dextran.Transgenosis can also be introduced in the ES cell by the transduction of retrovirus-mediated method or by microinjection.After in its introducing blastocyst stage embryo's segmentation cavity, the ES cell of this type of transfection can form the embryo thereafter, and facilitate the kind of resulting chimaeric animals to be (about summary, referring to Jaenisch, Science 240:1468[1988]).Before introducing transfection ES cell in the segmentation cavity, can implement various selection schemes to the ES cell of transfection, with the ES cell of enrichment integration transgenosis, suppose that transgenosis is provided for the method for this type of selection.Alternatively, polymerase chain reaction can be used to screen the ES cell of integration transgenosis.Before having avoided in transferring to segmentation cavity, this technology under suitable selection condition, cultivates the needs of the ES cell of transfection.

In other other embodiment, homologous recombination is used to knock out gene function or preparation deletion mutant (for example truncate mutant).The method that is used for homologous recombination is described in the U.S. Patent number 5,614,396 of integrating with this paper by reference.

Experiment

Following embodiment is provided for confirming and further illustrating some preferred embodiment of the present invention and aspect, and should not be construed as its scope that limits.

Embodiment 1

The c-Rel inhibitor

This embodiment has described the evaluation of the micromolecular inhibitor of c-Rel.In history, transcription factor has been considered to be difficult to by micromolecular inhibitor approaching, because the big interaction face of bonded of mediation transcription factor and DNA.Yet, there is the evidence that increases in the literature and according to the subjective effort of screening, the hint small molecules can be regulated the interaction of being responsible for DNA-protein and protein-protein complex formation.Because c-Rel mainly via form with or heterodimer and play a role in conjunction with its homologous dna site in the promoter region of target gene, be special inhibitor of wishing so can effectively destroy the small molecules that the kB site mixture of c-Rel dimer target forms.These compounds can directly work via the inhibition on protein-DNA-interface or dimerization interface, or via combining with the proteinic other structure of c-Rel site and inducing indirectly of conformational change worked.In order to identify this type of inhibitor, exploitation is based on the high throughput screening assay method of fluorescence polarization (FP), to identify the bonded small molecules (Fig. 1) of the CD28 response elemets (CD28RE) in the promoter region that destroys people's c-Rel homodimer and IL-2 gene.

FP measures the assessment that rotatablely moves based on sample molecule, and can be used to monitor 2 kinds of molecules and combining each other.FP can be considered as the competition between life-span of molecular motion in the solution and fluorophore.(Fig. 1, oval under the situation of c-Rel, FITC), will only excite those fluorophores that align with the plane of polarization so if linearly polarized photon (referring to Fig. 1) is used for fluorescence excitation group overall.There are 2 kinds of schemes that are used to launch.Condition is that the fluorescence lifetime of excited fluorescent probe is than its spin correlation time θ of bonded molecule much longer (θ describes the parameter how molecule in the solution rolls rapidly) with it, molecule will randomization in solution in emission process, and therefore, the light that fluorescent probe sends is with depolarized, and as shown in fig. 1, can easily be transformed into each other 2 kinds of mathematical descriptions---fluorescence anisotropy or fluorescence polarization are very low.If the fluorescence lifetime of fluorophore than the relative much shorter of spin correlation time θ (for example, θ significantly increases after CD28RE-FITC and c-Rel protein bound), excited molecule (c-Rel homodimer-CD28RE-FITC mixture) will keep alignment in emission process so, therefore, therefore emission will be polarized, and fluorescence anisotropy or fluorescence polarization are very high.

Fluorescence polarization measurement has been developed and has been used for various biochemical interactions, comprises g protein coupled receptor, actin binding protein matter, Tyrosylprotein kinase etc.Different with 2 kinds of mark kinds of needs based on reading of shifting of energy, FP has the advantage that only needs a kind of mark kind to be used to measure, and therefore FP has become the very welcome form of reading of the high throughput screening that is used for drug development, comprises the DNA bonded micromolecular inhibitor of identifying transcription factor such as B-ZIP.

Proteinic people's total length of the c-Rel that uses in the FP assay method or subdomain produce in Bacillus coli cells by following conventional scheme.In brief, people c-Rel gene is inserted in the expression vector and be transformed in the intestinal bacteria BL-21Lys (DE3).Cell is cultivated and is induced by IPTG.The recombinant protein that comprises the His mark on its C-terminal uses the nickel resin to carry out purifying according to the specification sheets (Qiaqen) of manufacturers by affinity chromatography.

In order to assess and confirm the proteinic functional equivalent of people c-Rel of purifying, carry out conventional electrophoretic migration determining displacement method (EMSA) with the interaction of the specificity between the kB site CD28RE that determines people c-Rel and its target (Fig. 2).In this EMSA experiment, ³²The concentration of the CD28RE dna probe of P mark keeps constant (1-100nM) in each swimming lane, and carries out titration with the c-Rel concentration that increases.The data best-fit is described the collaborative combination model of 2 subunits of assembling (Fig. 2, left figure, swimming lane 1-9 and right figure) in turn.In addition, cold competitive assay confirm unlabelled CD28RE when 300nM, can block fully the c-Rel homodimer- ³²Formation (Fig. 2 of the CD28RE mixture of P-ATP mark, swimming lane 11), but the unlabelled Oct1 of oligo on par is to dna binding activity unrestraint influence (Fig. 2 of people c-Rel in contrast, swimming lane 10), confirm that observed DNA-protein complex is because the specificity between the kB site CD28RE of people c-Rel and target thereof interacts.

For FP experiment, as follows from the sequence of the 20 aggressiveness kB sites of CD28 RE (underscore is arranged): 5 '-FITC-TCTGGAATTTCTTTAAACCC-3 ' (SEQ ID NO:37) (ordering and the HPLC purifying) by Biosource.

According to the EMSA data, the dna probe of the FITC mark that uses in the FP screening assay method and the proteinic concentration of c-Rel are carried out optimization.At first, fluorescently-labeled probe adds with different concns (5nM, 10nM, 100nM), and c-Rel protein concn (2000nM) is a constant, and reacts at room temperature incubation 15-30 minute, is transferred to the hole (20 μ l/ hole) of 384 hole flat boards then.The FP value is that (Perkin Elmer PE) measures FUSION Universal Microplate Analyzer.Data point out that the 10nM probe is the optimal selection that is used to produce the FP difference of c-Rel protein induce between independent dna probe and the DNA-protein complex.With the data consistent derived from EMSA, the proteinic titration of c-Rel that increases concentration with 10nM fluorescent DNA probe bonded causes 2 stages that increase FP, and wherein more precipitous increase under low concentration is that (Fig. 3 a) in increase more shallow under higher concentration subsequently.In most of the cases, have the increase among the FP, wherein the FP signal is saturated in the presence of 128nM c-Rel.Make the dissociation constant of calculating in this way (Kd) observed the sort of bigger than using EMSA.

For the possibility that the non-specific interaction of getting rid of c-Rel protein and dna molecular is facilitated the increase in the FP value, carry out cold competitive assay.As shown in Fig. 3 b, unlabelled CD28RE is titrated in the reaction of the c-Rel that comprises constant basis and fluorescent DNA probe and causes gradually reducing in the FP value, and the basal level of under the maximum concentration (128nM) of test, getting back to fluorescent probe.Yet, the contrast dna molecular, unlabelled Oct1 (20 aggressiveness) with the same terms that is applied to cold CD28RE probe under FP value do not have is influenced.Therefore, this assay method specificity and measure c-Rel protein quantitatively and CD28 RE between the interface in interaction.

Next study this place and whether can detect the active endogenous inhibitor of known c-Rel (IkB α).Previous structural research has confirmed that with after NF-κ B combines IkB α promotes the aminoterminal big integral body of NF-κ B subunit to move, and by inducing conformational change isomery ground inhibition NF-κ B DNA combination.The previous reorganization GST-IkB α (final concentration is 150nM) that produces adds in the association reaction of being made up of 10nM FITC-CD28RE and 100nM c-Rel.FP from protein-DNA interaction is suppressed (Fig. 3 c) fully.Therefore, this assay method detects by direct in conjunction with c-Rel protein and the specific inhibitor of inducing conformational change to work.In addition, consistent with the scattering data distribution shown in Fig. 3 d, also assess the z factor, a kind of assay method performance index.In the great majority 384 hole flat boards of test up to now, Z factor surpasses 0.5 (0.7-0.8), indicates statistically evident assay method.

Use above-described high throughput assay method, screen with regard to the interactional inhibition between the kB site CD28RE of c-Rel protein and target in micromolecular library.A library of 16,000 kinds of compounds of screening, generation make the FP signal suppressing surpass 100 kinds of compounds of 45%.These compounds are further tested in EMSA, and this identifies and significantly suppresses c-RelDNA in conjunction with active at least 19 kinds of compounds.Fig. 4 has presented sample and has hit.

Embodiment 2

Other optimization assay method

This embodiment has described and has been used to screen and the method for optimization c-Rel inhibitor.

Measure K _D(binding affinity)

In certain embodiments, measure K _DBinding affinity (for example, using biocore).DNA is fixed on the flat board, and protein is contacted with DNA, to measure the avidity (K relevant with hitting compound _D).Because non-specific competition nucleic acid for example poly-(dI:dC) excessive comprising in the high throughput assay method, be unlikely so hit that compound indistinguishably combines with dna structure.

The chemically modified of lead compound

In certain embodiments, carry out chemically modified to improve avidity and cell permeability.In certain embodiments, make functional group become related, relate to or do not relate to active functional group, and which part of evaluation molecule is crucial for activity and which partly can be used for handling to strengthen for example perviousness of other character with evaluation with EC50.Charged molecule can have the difficulty that enters cell.In certain embodiments, lead compound is modified to the uncharged molecules (prodrug) that after entering cell, can be transformed into active compound.For example, in certain embodiments, molecule is with deriving by the ester group of intracellular endogenous esterase activity cutting.The steric isomer of lead compound is also analyzed with regard to activity.Compound uses above-mentioned external and raji cell assay Raji to test to suppressing the active influence of c-Rel.Also measure lead compound in cell to suppressing active influence of c-Rel (report assay method, apoptosis assay method) and EC50 value.

Lead compound with optimization biological chemistry, physical chemistry and cellularity of meeting some standard (for example, than the original EC50 that hits low 5x or 10x) is carried out further optimization or adjustment.

Embodiment 3

The c-Rel blocking-up is to lymphadenomatous influence

This embodiment confirms that the c-Rel blocking-up weakens lymphadenomatous hyperplasia.

A. materials and methods

Mouse species

Pten (+/-) mouse Pten ^Flox/+Mouse (background strain C57/BL6) is provided by Dr.PandolfiPP (people such as Di Cristofano, 1999 Science 285:2122).In order to produce B cell-specific Pten deficient mice, make Pten ^Flox/+Mouse and CD19 ^Cre/+Transgenic mice (available from the Jackson laboratory) hybridization.At allelotrope (Pten ^Flox/floxCD19 ^Cre/+) and wild-type Pten gene (Pten ^{+ /+}CD 19 ^Cre/+) on carry CD19 ^Cre/+Be used for analyzing as homozygous mutation body, wild-type mice respectively with the offspring of floxed Pten sudden change.Mouse maintains under specified-pathogens free condition in the animal population of Weill medical college of Cornell University.Make Pten ^Flox/floxCD19 ^Cre/+Mouse and c-Rel deficient mice people such as (, 1998 Eur J Immunol 28:4299) Tumang hybridization is to produce double defect type mouse.

Propagation and survival assay method

For propidium iodide dyeing assay method, the B cell is cultivated in the anti-IgM of 10 μ g/ml or anti-CD40 of 10 μ g/ml or 10 μ g/ml LPS.On instruction time point, collecting cell and dye with the solution that comprises 50 μ g/ml propidium iodides, 20ng/ml RNA enzyme A, 0.1% TritonX-100 and 0.1% Trisodium Citrate.Bipartite sample uses Cell-Quest software to analyze subsequently on Becton-Dickinson FACS, and quantitatively apoptotic cell (＜2N dna content) or S and G2/M phase cell (〉 2N dna content) per-cent.For ³The H thymidine mixes assay method, and the B cell is with 1 x 10 ⁵Cells/well is at 96 hole U-shaped base plate middle berth flat boards, and comprising RPMI 1640,10% heat-inactivated FCS (DeWned; Hyclone, Logan, UT), 2mM L-glutaminate, 1mM non-essential amino acid, 100 μ g/ml penicillin/streptomycin and 5 x 10 ^-5M/L ^-1In the perfect medium of mercaptoethanol at 37 ℃ and 5% CO ₂Under cultivate.In when indication, cell stimulates with 10 μ g/ml goat anti-mouse IgMF (ab ') 2 (anti-IgM, Jackson ImmunoResearch Laboratories) or the anti-CD40 of 10 μ g/ml (mAb 1C 10) or 10 μ g/ml LPS.Put preceding 6 hours in instruction time, make culture, gather in the crops then on the Germania filter paper of living and reply to mix by thymidine to measure to breed with 0.5 μ Ci/ hole thymidine (Amersham) incubation.All assay methods are carried out in triplicate, and the SEM value is pointed out in each experiment.

For CFSE dyeing, 2 x 10 altogether ⁶The spleen B cell of purifying with 1ml 5mm CFSE (Molecular Probes) the blended 1ml perfect medium that is dissolved among the DMSO in cultivate, and in 37 ℃ of incubations 10 minutes.After perfect medium washing 2 times, make 2x 10 ⁵The B cell is cultivated in each hole of 96 hole flat boards, and as shown in Fig. 8 A, stimulates with the anti-IgM of 10mg/ml in the existence of various NF-kB inhibitors or not.On instruction time point, collecting cell and on FACS calibur machine, use CellQuest software (Becton Dickinson) to carry out cell cycle analysis.

The measurement of plastosome current potential

With the B cell cultures to 0.5-1.0 x 10 ⁶The density of cell/ml.As shown in Fig. 8 C, for every kind of condition, the 1ml cell is with the suitable time span of suitable agent treated.The plastosome current potential by use fluorescence potential measurement dyestuff JC-1 (iodate 5,5 ', 6,6 ' ,-tetrachloro-1,1 ', 3,3 '-tetraethyl-benzo imidazolyl carbocyanine, Molecular Probe) assess.JC-1 is the new positively charged ion carbonyl cyanine dye that gathers in plastosome.This dyestuff exists as monomer when lower concentration, and is similar to fluorescein generation green fluorescence.When higher concentration, this dyestuff forms the J-aggregation, and it is similar to that PE shows excitation spectrum widely and in the emission maximum at about 590nm place.These features make JC-1 become to be used for the sensitivity label of mitochondrial membrane potential.In brief, the 0.3ml cell is mixed with 0.3ml dyeing solution (perfect medium that comprises 0.5 μ g/ml JC-1).Cell is at 37 ℃ of incubator (5% CO ₂) middle dyeing 30 minutes.After the dyeing, cell is at room temperature collected, and washs 1 time in 1 X PBS.Subsequently cell mass is resuspended among the PBS (being preheated to 37 ℃), and on Becton-DickinsonFACS, uses Cell-Quest software analysis JC-1 fluorescence.

Electrophoretic migration determining displacement method

Cell is cultivated in the existence of anti-IgM of 10 μ g/ml or control medium or not.On instruction time point, harvested cell and at damping fluid C (20mM Hepes, pH 7.6,1.5mM MgCl ₂, 0.42M KCl, 25% glycerine, 0.1% NP-40,0.2mM EDTA, 1mM PMSF, 1mM DTT, 5 μ g/ml pepstatins, 5 μ g/ml leupeptins, 5 μ g/ml press down enzyme peptide, 4mM NaF and 4mM vanadic acid sodium) in cracking, and carry out supersound process with 20 subpulses in 4 ℃.Sample subsequently under 13,000 xg centrifugal 10 minutes so that crumb form becomes agglomerate, discard described agglomerate subsequently.Radiolabeled probe produces by the following strand Ig of 200ng κ B ring oligo sequence is annealed: 5 '-GAGAGGGGACTTTCCGATTAGCTTTCGGAAAGTCCCCTC-3 ' (SEQ ID NO:1).Probe is with 5 μ Ci[γ-32P] ATP carries out end mark.For association reaction, make every kind of nuclear extract sample of 20 μ g with following incubation on ice 20 minutes: at 10mMTris-HCl, among the pH 7.5 40,000cpm radiolabeled probe, 1mM DTT, 1mMEDTA, pH 7.5,5% glycerine, 0.1 μ g/ μ l poly-(dI-dC) are (BoehringerMannheim) and 0.5% NP-40.Damping fluid C is used for making molecular balance to the final concentration at 20 μ l cumulative volume 200mM KCl.For cold competition, adding ³²Before the Ig κ B probe of P mark, make excessive unlabelled Ig κ B of 10x or 50x and nuclear extract preincubation 10 minutes.Response sample was separating 3 hours at 160V in 0.25L Tris-borate-edta buffer liquid on 6% polyacrylamide gel, went up dryly at filter paper (Whatman), and was exposed to film and spent the night.

RT-PCR(EBI3)

The RT-PCR that expresses for the EBI3mRNA in pten defective type splenic lymphocyte and the lymphoma cell analyzes, use the specification sheets (TEL-TEST of STAT-60RNA separation agent according to manufacturers, Friendswood, TX), and become the laggard performing PCR amplification of article one chain cDNA at reverse transcription respectively from by separating total RNA in these cells with purifying the lymphadenomatous mouse or the wild-type B cell in contrast.The PCR condition is: 30 circulations, 94 ℃, 15s; 60 ℃, 15s; 72 ℃, 30s.The primer that is used for RT-PCR is: EBI3FP1 (19nt): GTG CAA TGC CAT GCT TCT C (SEQ ID NO:2) (position 316); EBI3 RP1 (19nt): TGC CAC CCT CAA GTA GAC G (SEQ ID NO:3) (position 945).For the expection PCR product from the EBI3 FP1/EBI3 RP1 of mouse cDNA is 648bp.The PCR product separates by 1% agarose gel electrophoresis, and manifests by the UV irradiation in bromination second pyridine dyeing back.

The B cell is cultivated in anti-IgM of 10 μ g/ml or the anti-CD40 of 10 μ g/ml.On instruction time point, collecting cell and dye with the solution that comprises 50 μ g/ml propidium iodides, 20ng/ml RNA enzyme A, 0.1% Triton X-100 and 0.1% Trisodium Citrate.Bipartite sample uses Cell-Quest software to analyze subsequently on Becton-Dickinson FACS, and quantitatively apoptotic cell (＜2N dna content) or S and G2/M phase cell (〉 2NDNA content) per-cent.

B. result

Pten mutant lymphoma and B cell show acceleration propagation

For hyperplasia, autoimmunization and the tumorigenesis character of studying the Pten mutant cell, use 3 kinds of Pten knock-out mice strains: 1), the Pten of heterozygosis (+/-) strain, 2), derived under the control of CD19 promotor with the Pten of Cre-transgenic mice mating ^F/F(orflox/flox) CD19 of mouse ^Cre/+Pten ^F/FStrain, 3), Pten (hypomorph).

Derived from Pten (+/-) and CD19 ^Crc/-Pten ^F/FThe B cell of mouse has replys the higher propagation of antigen signals.This trend becomes more remarkable in pancreas islet lymphadenomatous 6-9 month big Pten of development (+/-) mouse.Lymphoma B cell derived from Pten (+/-) mouse has response BCR and the CD40 proliferation index (Fig. 5 B) higher than normal lymph-node cell.Be also shown in the spontaneous propagation in the substratum and respond BCR and the cell cycle progress (Fig. 6 A and 6B) of CD40 signal acceleration from the splenocyte of these mouse and the B cell of purifying.Pten mutant B cell is also survived better (Fig. 6 B) under anti-IgM handles.Use CFSE monitoring cell fission, compare, respond the CD19 of the higher per-cent of anti-IgM with the sort of of normal B cell ^Cre/+Pten ^F/FThe B cell advances to 3 and 4 cell fission (70% pair 39%) (Fig. 6 C).In independent substratum, also has higher slightly spontaneous cell proliferation from the Pten of spleen (+/-) T cell.TCR/CD28 can keep the cell cycle of these cells.

The NF-κ B/Rel that continues in Pten mutant B cell activates

Because the hyperplasia character relevant with the Pten sudden change is not defined, so research is got in touch with NF-κ B/Rel activated.Nuclear extract derived from Pten mutant and contrast B cell is analyzed in conjunction with activity by using EMSA (electrophoretic migration determining displacement method) just to examine NF-κ B/Rel.Contrast B cell is presented at the instantaneous activation (Fig. 7 A) that stimulates back NF-κ B/Rel in the time of 1 and 2 hour with anti-IgM.By contrast, the early stage activation when Pten mutant B cell is disclosed in 0.5 hour, and 6 hours lasting from start to finish NF-κ B/Rel activity of time course.Stimulate the NF-κ B/Rel that continues to activate also in B cell by anti-CD40 and observe (Fig. 7 B) derived from the Pten mutant mouse (hy/-) of different strains.

In order to confirm that further NF-κ B/Rel activates the physiology result that its downstream target is regulated, one of research c-Rel target EBI3.Data point out and control tissue relatively, the EBI3 level is in derived from the spleen of Pten (+/-) mouse and lymphoma sample higher basically (Fig. 7 C).These results confirm that the Pten sudden change causes the NF-κ B/Rel nuclear translocation that continues, and cause the rise of the c-Rel target gene of responsible cell cycle and cell survival.

NF-κ B suppresses the blocking-up cell fission and induces Pten mutant B apoptosis

In order further to classify, use pharmacology NF-kB inhibitor Bayll and ten thousand jade-like stones by NF-κ B/Rel hyperplasia and tumorigenic contribution.The Pten mutant cell is experiencing strong cell fission with the BCR token stimulus after 3 days.The NF-kB inhibitor comprise the division (Fig. 8 A) of blocking the Pten mutant cell fully.This observation is confirmed (Fig. 8 B) by dna content analysis and propidium iodide dyeing.Except blocking-up cell cycle progress, Bayll handles and also causes significant apoptosis.

Not to be subjected to one of mechanism of apoptosis be to express by the survivin matter of inducing Bc1-2 family to NF-κ B/Rel by its protection cell, comprises Bc1-X, Bf1-1 and Mc1-1 (people such as Owyang, 2001 J Immunol 167:4948; People such as Tumang, 2002 Cell Immunol217:47).One of key function of being born by Bc1-2 family is the integrity of regulating mitochondrial membrane potential.Expection blocking-up NF-κ B/Rel activity will influence the expression of survivin matter, cause the release of mitochondrial depolarization and apoptosis medium.Use JC-1 dyeing evaluation line mitochondrial membrane potential, data are pointed out to handle 2 kinds of NF-kB inhibitor rapid induction mitochondrial depolarization (Fig. 8 C) in 12 hours at anti-IgM.

In a word, data suggest blocking-up NF-κ B/Rel suppresses to cause tumorigenic Pten mutant cell hyperplasia.

The c-Rel disappearance induces the apoptosis and the cell cycle of Pten mutant B cell to stop

Because it is widely-used by the tissue of all kinds that NF-κ is B (p50/p65 dimer),, expection is applied severe side effect comprise liver toxicity so the general NF-κ of target B member's strategy comprises INK inhibitor and 2 kinds of aforementioned NF-kB inhibitors.This enhancing obtains strong support (people such as Beg, 1995 Nature376:167 of the embryonic death rate and the hepatic necrosis of p65 and IKK β knock-out mice; People such as Li, 1999 J Exp Med 189:1839).Therefore the c-Rel specificity suppresses is safe strategy.The c-Rel function is limited to mature lymphocyte and medullary cell.In addition, the c-Rel knock-out mice is the same with normal mouse to be great-hearted on the physiology, (people such as Kontgen, 1995Genes ﹠amp except the immunity system that it is compromised slightly; Dev.9:1965; People such as Liou, 2003 Bioessays 25:767; People such as Liou, 1999 Int Immunol11:361).

C-Rel suppresses the influence that the pathology of Pten mediation is replied is tested by making Pten mutant mouse and the mating of c-Rel knock-out mice.The result points out that the c-Rel disappearance suppresses the apoptosis of hyperplasia and the increase of Pten mutant B cell, as (Fig. 9) that measures by 2 kinds of different assay methods.In a word, studies show that blocking-up c-Rel is enough to suppress the hyperplasia character of Pten mutant cell and make cell be easy to apoptosis.

Embodiment 4

This embodiment has described siRNA and has suppressed the purposes that c-Rel expresses.

A. materials and methods

The structure of siRNA expression vector

The method that is used to make up the siRNA expression vector has obtained describing.In brief, mouse U6 promotor uses following oligos to increase from mouse gene group DNA by PCR: GGA AGATCTATCCGACGCCGCCATCTCTA (SEQ ID NO:4) and justice is arranged: antisense: 5 ' GTG GAATTCGTTAAC GAAGACCACAAACAAGGCTTTTCTCCAA (SEQ ID NO:5).In adopted oligo sequence was arranged, Bgl II target sequence had underscore.In antisense sequences, first has the sequence of underscore to represent that EcoR I restriction site and second are Bbs I sites.The PCR product cloning is arrived in the Bgl II and EcoR I site of pEGFP-C3 carrier (Clontech), to produce novel vector pEGFP-mU6-1.

The following design of s iRNA oligos about c-Rel: cochain: 5 ' TTTGGTGTGAAGGGCGATCAGCAGGTTCAAGAGACCTGCTGATCGCCCTTCACACT TTTTC (SEQ ID NO:6); Following chain: 5 ' AATTGAAAAAGTGTGAAGGGCGATCAGCAGGTCTCTTGAACCTGCTGATCGCCCTT CACAC (SEQ ID NO:7).Oligos is in 95 ℃ of heating 5 minutes, then in 37 ℃ of annealing 1 hour.The annealed sequence is connected in the Bbs I and EcoR I site of pEGFPmU6-1 carrier.Subsequently, the siRNA expression cassette cuts with Bgl II and HpaI, and subclone is interior to produce the MIGR1mU6-siRel carrier to the MIGR1 carrier.This carrier is with coexpression siRNA transcript and green fluorescent protein (GFP).

The mensuration of retroviral preparation and virus titer

Retroviral packing as described (people such as Houldsworth, (2004) .Blood.103 1862-8) carries out.In brief, MIGRlmU6-siRel plasmid or MIGRlmU6 control plasmid use the calcium phosphate method cotransfection in the 293T cell with pHIT123 and pCGP.After transfection 48 hours the time, results supernatant liquor and measure with regard to virus titer by on the NIH3T3 cell, infecting.The retrovirus supernatant liquor preserved in-80 ℃ be used for following the use.

The external silence of c-Rel

In order to test the retroviral reticent effect of expressing c-Rel siRNA, with 2 x 10 ⁵The NIH3T3 cell seeding is in the 6-cm ware.Cultivate after 24 hours, in the presence of polybrene (4 μ g/ml) with 100 μ l retrovirus (5 x 10 ⁶/ ml) add in the 3T3 cell.After the transfection 48 hours the time, harvested cell and monitor with regard to efficiency of infection by flow cytometry.C-Rel on protein level expresses by western blotting and uses the c-Rel specific polyclonal antibody to test.

The Wehi-231 cells in vitro infects

In order to test of the influence of c-Rel silence, with 2ml cell (2 x 10 to Wehi-231 cell survival and cell cycle progress ⁶/ ml) be planted in the 6 hole flat boards, and at retrovirus and contrast virus (0.3125,0.625,1.25 and 2.5 x 10 of the expression c-Rel siRNA of polybrene (4 μ g/ml) and various dosage ⁶) existence down with anti-CD40 (10 μ g/ml) cultivation 48 hours.Harvested cell and analyze with regard to cell survival and cell cycle progress by PI dyeing.

Former generation B cells in vitro infects

In order to test the influence of c-Rel silence to the B cell response, former generation B cell separates from mice spleen and stimulated 24 hours with anti-CD40 (10 μ g/ml) before adding retrovirus.Cell is gathered in the crops in the time of back 48 hours in infection, and monitors with regard to cell survival and cell cycle progress by propidium iodide (PI) staining analysis, or monitors with regard to cell proliferation by Ki-67 dyeing.

Express the generation of the marrow gomphosis mouse of siRNA

The generation of gomphosis mouse is as discussed previously to be carried out.In brief, (The Jackson Labs USA) injects with 5 FU 5 fluorouracil (5-FU, 250mg/kg weight)/animal donor mice (57BL/6, female, 8-10 week is big).After 4 days, medullary cell (BMCs) separates from the shin bone of mouse and femur, and with 2 x 10 in 2ml ⁶The concentration of/ml is cultivated with the cytokine mixture that comprises IL3 (6ng/ml), IL6 (10ng/ml) and SCF (100ng/ml) in 6 hole flat boards.After 24 hours, the retrovirus supernatant liquor is added in the BMCs, and they were cultivated other 4-6 days.Cell is collected subsequently and is subjected in the mouse (850Rad) of lethal exposure by the injection of tail vein.Bone marrow chimera shifts (BMT) back 4-8 at marrow and analyzes during week.Cell reconstitution in each immune organ is monitored with regard to the per-cent of GFP positive cell by flow cytometry.

The analysis that the KLH specificity is replied

For anti-KLH t cell response, mouse is used CFA via the injection of metapedes pad with the ratio of 1:1, and (CA) emulsive KLH (100 μ g) carries out immunity for Calbiochem, La Jolla.After 9 days, separating Morr. cell and respectively from the cell of lymphoglandula, and in the KLH of various concentration, be supplemented with in RPMI 1640 substratum of 10% FCS and cultivated 60 hours.Propagation by added in the end 12 hours [ ³H] thymidine measures.

Ki-67 dyeing

Ki-67 as discussed previously the carrying out of dyeing.In brief, 1 x 10 that from cell cultures, gathers in the crops ⁶Cell is with PBS washing 2 times, then 0.5ml fixedly damping fluid (eBioscience, SanDiego fix 20 minutes in CA).Cell at first washs with PBS, washs with infiltrationization (permiabilization) damping fluid then.Cell is used anti-Ki67 antibody staining 30 minutes then in 4 ℃ of incubations 10 minutes in the infiltrationization damping fluid.The Ki-67 express cell is undertaken quantitatively by flow cytometry.

B. result

The generation of the reticent retroviral construct body of c-Rel

In order to make up the reticent construct of c-Rel, will be to the U6 promotor downstream in 21 Nucleotide (nt) the sequence insertion pEGFP-mU6-1 carrier of c-Rel uniqueness.The siRNA expression cassette subsequently subclone in the Bgl II and Hpa I site of MIGR1 carrier, to produce the novel vector of called after MIGRI-mU6-siRel.The existence of IRES sequence allows the coexpression of c-RelsiRNA duplex and green fluorescent protein (GFP) in this carrier, and the latter is used to monitor transduction efficiency.

This carrier with cotransfection described in 2 kinds of packaging plasmids such as the materials and methods part in the 293T cell.Virus is by results in the cell culture supernatant and produce 5 x 10 ⁶The titre of/ml.

The silence of c-Rel

In order to test the silence influence that retrovirus is expressed c-Rel, because the constructive expression of c-Rel in this clone uses the NIH3T3 cell.Cell was cultivated before virus infection 24 hours.After infecting back 48 hours, harvested cell and just monitor by flow cytometry that (Figure 10 is a) by the efficiency of infection of GFP+ cell per-cent reflection.Prepare cell lysate subsequently and implement western blot analysis with regard to the c-Rel protein expression.Observe with the cell that infects with contrast and compare,, point out that retrovirus is effective in reticent c-Rel expresses with the minimizing (Figure 10 b) in the protein expression in the cell of the virus infection of expressing c-Rel siRNA.

Cell survival and cell cycle that reticent c-Rel causes reducing in the Wehi-231 cell make progress

It is (people such as Rosenwald, (2002) N Engl J Med.346, the 1937-47 of overacfivity that c-Rel has been reported in the various B cell lymphomas; People such as Houldsworth, (2004) Blood 103,1862-8; People such as Neat, (2001) Genes ChromosomesCancer.32,236-43; People such as Barth, (2003) Blood.101,3681-6).Therefore, the active inhibition of c-Rel is used for the treatment of such disease.B cell lymphoma clone (Wehi-231) stimulates with anti-CD40 in the presence of retrovirus of expressing c-Rel siRNA or contrast virus.Cell is gathered in the crops in the time of back 48 hours in infection, and analyzes with regard to cell survival and cell cycle progress by the PI staining analysis.In the reticent group of c-Rel, observe dose-dependently in cell survival and the cell cycle progress reduce (Figure 11 b, 11e).Yet, keep the cell cycle of steady state with the cell of control cells infection and make progress, although have higher efficiency of infection.

Reticent c-Rel causes the damaged cells survival and the propagation of mitogenesis or antigenic stimulation minimizing is replied in former generation B cell

Previous report c-Rel be B cell survival and cell cycle progress required (people such as Tumang, (1998) Eur J Immunol.28,4299-312).Therefore, reticent c-Rel makes the B cell more can not respond mitogenesis stimulates.In order to test this point, isolating former generation B cell stimulated 24 hours with anti-CD40 from mice spleen, infected with retrovirus of expressing c-Rel siRNA or contrast virus subsequently.As shown in Figure 12 a, can infect cell up to 11%.Cause the cell number (Figure 12 b) that reduces in the apoptotic cell of increase level and the cell cycle progress with the virus infection of expressing c-Rel siRNA, this can by with control group relatively, the Ki-67 dyeing that in the silence group, reduces be confirmed (Figure 12 c).

In order to confirm to result from the observation of external c-Rel silence, the reconstruct by the medullary cell of virus infection in the acceptor mouse produces c-Rel and knocks down gomphosis mouse (referring to materials and methods).After 2 months, put to death some gomphosis mouses, and all the other mouse are used for antigen immune inoculation (vide infra).Isolating B cell comprises that with different mitogens anti-IgM, anti-CD40 and LPS stimulated 48 hours from the gomphosis mouse spleen.Cell proliferation is mixed assay method by thymidine and is monitored.As among Figure 13 a as seen, with control group relatively, in the reticent group of c-Rel, observe the propagation that all mitogen is reduced and reply.Replying by the PI staining analysis of CD40 signal minimizing further confirmed, be presented at that more cell experience apoptosis and cell still less entered in the cell cycle in the reticent group of c-Rel, and dye by the Ki-67 that after the c-Rel silence, significantly reduces and to confirm (Figure 13 b).

In order to test the result of c-Rel silence under physiological conditions more, gomphosis mouse carries out immunity by the metapedes pad with KLH (100.0 μ g).After 9 days, lymphocyte separately separates from spleen and lymphoglandula, and cultivates with the KLH of different concns.After 48 hours, cell proliferation is mixed by thymidine and is monitored.The result show with control group in the sort of comparison, the lymphocyte from immune organ (spleen or lymphoglandula) in the reticent group of c-Rel shows the multiplication capacity (Figure 14) that significantly reduces.

Embodiment 5

This embodiment has described the other oligomer that is used for c-Rel RNAi

A. synthetic oligomer:

Oligomer 1:

Justice is arranged: 5 ' AATGTGAAGGGCGATCAGC 3 ' (SEQ ID NO:8)

Antisense: 5 ' GCTGATCGCCCTTCACATT 3 ' (SEQ ID NO:9)

siRNA seq：5′GCUGAUCGCCCUUCACAUU 3′(SEQ ID NO：10)

Oligomer 2:

Justice is arranged: 5 ' AATGTGAAGGGCGATCAGCAGGT 3 ' (SEQ ID NO:11)

Antisense: 5 ' ACCTGCTGATCGCCCTTCACATT 3 ' (SEQ ID NO:12)

siRNA seq：5′ACCUGCUGAUCGCCCUUCACAUU 3′(SEQ ID NO：13)

B. the oligomer of vector expression:

5′GTGTGAAGGGCGATCAGCAGG 3′(SEQ ID NO：14)

Have justice 5 '-CCGUGCUCCAAAUACUGCA-3 ' (SEQ ID NO:15)

Antisense 5 '-UGCAGUAUUUGGAGCACGG-3 ' (SEQ ID NO:16)

About the more s iRNA of c-Rel gene sequence

C. about the oligomer of people c-Rel RNAi

Si-Rel 1 (20nt) (position 256-275)

5′TGT GAA GGG CGA TCA GCA GG 3′(SEQ ID NO：17)

Si-Rel 2 (23nt) (position 309-330)

5′CCG AAC ATA CCC TTC TAT CCA GA 3′(SEQ ID NO：18)

Si-Rel 3 (22nt) (position 424-445)

5′GAC TGC AGA GAC GGC TAC TAT G 3′(SEQ ID NO：19)

Si-Rel 4 (23nt) (position 549-573)

5′GGC AGG AAT CAA TCC ATT CAA TG 3′(SEQ ID NO：20)

Si-Rel 5 (23nt) (position 601-623)

5′GAT TGT GAC CTC AAT GTG GTG AG 3′(SEQ ID NO：21)

Si-Rel 6 (22nt) (position 655-676)

5′CAT GGT AAT TTG ACG ACT GCT C 3′(SEQ ID NO：22)

Si-Rel 7 (22nt) (position 877-898)

5′GCT GAT GTA CAC CGT CAA GTA G 3′(SEQ ID NO：23)

Si-Rel 8 (23nt) (position 1327-1349)

5′GCA GAA TCC TAC TAT CCC TCA CC 3′(SEQ ID NO：24)

Si-Rel 9 (21nt) (position 1769-1789)

5′GAG ACT TGA GAC AGC TCC ATC 3′(SEQ ID NO：25)

Si-Rel 10 (22nt) (position 1957-1978)

5′GAT AGT CAG TAT TCA GGT ATT G 3′(SEQ ID NO：26)

D. about the oligomer of mouse c-Rel RNAi

Si-Rel 1 (21nt) (position 478-498)

5′GTG TGA AGG GCG ATC AGC AGG 3′(SEQ ID NO：27)

Si-Rel 2 (20nt) (position 619-638)

5′GCC TCA TCC TCA TGA TTT AG 3′(SEQ ID NO：28)

Si-Rel 3 (22nt) (position 671-693)

5′GCA GAA TTT GGA CCA GAA CGC AG 3′(SEQ ID NO：29)

Si-Rel 4 (21nt) (position 765-785)

5′GGA TTA GTG CAG GAA TCA ATC 3′(SEQ ID NO：30)

Si-Rel 5 (21nt) (position 824-844)

5′GAC TGC GAC CTC AAT GTG GTG 3′(SEQ ID NO：31)

Si-Rel 6 (22nt) (position 878-899)

5′GAT GGT AAC TTC ACA ACT GCT G 3′(SEQ ID NO：32)

Si-Rel 7 (20nt) (position 960-979)

5′GGA TCT TAG CCC GTG TGA AC 3′(SEQ ID NO：33)

Si-Rel 8 (22nt) (position 1103-1124)

5′GCT GAT GTA CAC CGC CAA GTA G 3′(SEQ ID NO：34)

Si-Rel 9 (22nt) (position 1157-1178)

5′GCT ATA CTG GAGCCT GTG ACA G 3′(SEQ ID NO：35)

Si-Rel 10 (23nt) (position 1463-1485)

5′GCT GAA CCT TAC TAT TCT TCA TG 3′(SEQ ID NO：36)

Embodiment 6

This embodiment describes other c-Rel micromolecular inhibitor.

The FP assay method of describing among the embodiment 1 is used to carry out large-scale high throughput screening, to identify the interactional small molecules between the kB site CD28RE that suppresses c-Rel protein and target.This screening relates to 16,000 kinds of compounds, and produces and the FP signal to be reduced surpass 45% about 100 (concentration that provides SCREENED COMPOUND to use) is provided.Hit independent test in the EMSA assay method subsequently.Behind the programmed screening, determine that 19 kinds of compounds have significant inhibition activity in destroying the formation of c-Rel DNA in conjunction with mixture.In programmed screening, show and suppress active molecule and be included in and be appointed as in I class and 2 of the II class different classifications (Figure 15) significantly.All mix aryl, point out that they have some rigidity and hydrophobic character.The no net charge of I compounds (IT-101 to IT-113).These molecules all comprise barbituric acid deutero-part in its structure.The II compounds is the derivative of naphthalene, quinolinone and chromone (chromone).

Figure 16 A shows that the DNA that uses the EMSA checking to hit compound suppresses active example.The inhibition of positive compound is renderd a service by the IC50 measurement and is undertaken further quantitatively.As shown in Figure 16 B, one of I compounds (solid black loop wire) has the IC50 value of 6 μ M, and control compound (the solid loop wire of purple) has seldom retarding effect under all conditions of test, points out that the I compounds is suitable for further optimization.

Embodiment 7

This embodiment describes further analysis and the optimized method that is used for lead compound.

Measure the compound bioavailability

In order to understand bioavailability better, the compound member of this classification synthesizes with cold labeling with the radiochemicals mark is synthetic, with assessment Premeabilisation of cells and intracellular metabolism (vide infra).Labelled with radioisotope can determine that inhibitor is in intracellular picked-up but do not allow to measure the metabotic change of compound.By contrast, the compound of cold labeling be used for accurate quantification in the amount of the medicine of cell unmodified form to determine cell concn.In puting together, these methods are used for determining cellular uptake and are transformed into the part that changes form by metabolism.

Synthetic 2- ¹³C or ¹⁴The I analog derivative of C mark pattern is used for Premeabilisation of cells research.Expection is few can to detect (the corresponding 2pmol limit of detection of the specific activity of 60mCi/mmol) by the radioactivity scintillation counting to 100pCi (200cpm).Mensuration derives from the 50mg cell of the circular culture plate of 15cm, and reduces to the concentration of 40nM in definite cell.The required levels of drugs (500nM-50 μ M) of biological effect that reaches in the cell is measured in this sensitivity expection.Independently will ¹³The compound of C mark adds the cell of drug treating as internal standard (being generally 100-1000pmol), and homogenize and fractionation mass spectroscopy (ESI and MALDI) after be used for determining the ratio of sample mark and non-labelled compound.Mark/unmarked ionic quality of determining is than the medication amount in the accurate quantification sample.Other work are with few concentration people 2005 such as (, Mol Cell 17:595) Sauve A of reducing to the 50nM niacinamide to the biological sample measurement of 50 μ L.In addition, various isotopic labeling molecules comprise ¹⁸O-NAD, ¹⁸O-niacinamide (people such as Suave, the same) and ¹⁸O-niacinamide nucleosides can be used for measuring the level of these meta-bolitess in culturing cell and biological tissue.General sensitivity is in the pmol-fmol scope.Caco2 and lymphoid cell line are used for the bioavailability experiment.

The inhibition that IL-2 in the T cell produces

The mark of c-Rel function is the adjusting of cytokine gene expression.In the T cell, many researchs have confirmed c-Rel play a crucial role in the IL-2 genetic expression (people such as Liou, 1999, Int Immunol 11:361 in the T cell; People such as Kontgen, 1995, Genes ﹠amp; Dev.9:1965).The IL-2 promotor comprises a plurality of transcription factor binding site points, and wherein CD28RE and NF-AT/Apl complex loci show on function and relate to IL-2 genetic expression (Chen and Rothenberg, 1993 Mol Cell Biol 13:228; People such as Jain, 1992 Nature356:801; People such as Rooney, 1994 Embo J 13:625; People such as Jain, 1993 JImmunol 151:837; People such as Ghosh, 1993 Proc.Natl.Acad.Sci.USA90:1696; People such as Harhaj, 1996 Mol Cell Biol 16:6736).By pharmacological inhibitor or with specific gene knock out blocking-up c-Rel, NF-AT or AP-1 activate cause impaired IL-2 production (people such as Jain, 1992, the same; People such as Jain, 1993, the same; People such as Rooney, the same).IL-2 in the T cell expresses and is used to verify that c-Rel suppresses the interior effect of cell of compound.As described IL-2 expresses by PCR in real time, measures (people such as Cheng, 2003 Oncogene 22:8472 with the cell inner dyeing of IL-2 specific antibody with by flow cytometry and ELISA; People such as Boffa, 2003 Cell Immunol222:105; People such as Tian, 2005 Cell Immunol 234:39; People such as Tian, 2005Cell Immunol 235:72).T clone for example Jurkat, D5h3 CD4+T is used for initial test.

Use former generation T cell.Figure 23 A is to use the interior IL-2 dyeing of cell to measure the example of c-Rel compound to the influence of IL-2 expression.C-Rel KO CD4+T cell is as positive control, and this confirms that the IL-2 that relatively reduces with c-Rel wild-type T cell expresses.One of c-Rel compound (C04) also part reduces the IL-2 expression, and control compound (C01) does not have retarding effect to the IL-2 in CD4+T cell production.

In a word, C04 confirms that IL-2 and the IFN-γ when IC50～9uM suppresses active, and C01 has weak activity (Figure 23 B, D, E).In addition, 2 kinds of other compounds confirm that IL-2 and IFN-γ suppress active, wherein IC50s (Figure 23 C) in the 5-10uM scope.In addition, these compounds do not have retarding effect to non-c-Rel target gene (for example, CD4, CD8).

The inhibition of the cytokine production in the T cell

In biochemical measurement method (EMSA), confirm reasonable IC50 (IT compound for example＜1uM) and derivative just on cell levels the effect in the blocking-up IL-2 expression test.Play a crucial role in the IL-2 genetic expression of c-Rel in the T cell, and IL-2 has become the treatment target of several existing immunosuppressive drugs.Therefore, the IL-2 in the T cell expresses and is used to verify that c-Rel suppresses the interior effect of cell of compound.IL-2mRNA level with the various time points of anti-CD3 token stimulus is measured by implementing PCR.The IL-2 protein level is by measuring with the cell inner dyeing of IL-2 specific antibody, and as discussed previouslyly analyzes by flow cytometry.Clone for example Jurkat, D5h3 CD4+T cell is used for initial test.Use former generation T cell subsequently.

Demonstration is further tested the compound of the retarding effect that IL-2 expresses, and whether also blocks other c-Rel target genes and comprises IFN-γ, IL-12, the expression of TNF-α in various immunocytes to watch them.In addition, the influence of IT compound other c-Rel downstream expression of target gene that this paper is listed is as the basis of assessment.

As negative control, also check and can't help the gene (for example, GAPDH, CDK2) that NF-κ B or c-Rel regulate, to determine that retarding effect is specific.Another kind of good contrast is the cell derived from the c-Rel knock-out mice.Expection c-Rel suppresses the compound regulatory gene and expresses overview and cell response, this and c-Rel knock-out mice the sort of same or similar.

The inhibition of B cell proliferation and survival

C-Rel plays an important role in regulating B cell proliferation and survival.The disappearance of c-Rel gene in mouse causes apoptosis in the mature B cell response B cell antigen receptor signal and cell cycle blocking-up (people such as Owyang, 2001 J Immunol 167:4948; People such as Cheng, 2003Oncogene 22:8472; People such as Hsia, 2002, Int Immunol 14:905).The specific target gene of c-Rel in the B cell comprise anti-apoptosis molecule for example Bc1-x and Cycle Regulation agent for example E2F3a (people such as Cheng, 2003, the same; People such as Hsai, 2002, the same).C-Rel has also shown for many B cell tumour clones and has given vigor.Therefore, these biological activitys of c-Rel can be used to assess the interior effect of cell that c-Rel suppresses compound.Apoptosis and cell cycle progress as discussed previously by propidium iodide dyeing and flow cytometry measure (Liou, 2001, the same; People such as Cheng, 2003, the same; People such as Hsai, 2002, the same).B clone for example WEHI231, Ramos (or Raji) is used for initial test.Use former generation B cell subsequently.

Synthetic method about the I compounds

Obtain multifarious synthesis strategy (Figure 16) in the I class for simple and reach quick structure diversity to be used for SAR research be attractive.The member of this classification is by synthesizing barbituric acid and aldehyde coupling under the condition that promotes condensation.This chemistry is very ancient and at least 1900 kinds of exemplary up to now, for example the report of the condensation of phenyl aldehyde and barbituric acid.These condensations take place fast in water or alcohol and carry out catalysis by acid or alkali condition.

Synthetic expection produces false symmetry or asymmetric compound.In other words, as by the property testing of Compound I-III, compound will comprise 1 or 2 barbituric acid part (Figure 16).In asymmetric classification, obtain and compound (I) and parent 3-methoxyl group (III)-4-alkoxyl group-5-Ben Yajiaji-pyrimidine-2,4 the many very simple compound that 6-triketone conjugate is relevant fast.Make 3-methoxybenzaldehyde, 3-methoxyl group-4 ethoxy-benzaldehyde and the 4-oxyethyl group aldehyde and the barbituric acid condensation that are obtained commercially, to form relevant barbituric acid Ben Yajiaji conjugate (Figure 17).In addition, easily make up three substitution compounds that comprise 3,4,5 substitute modes.Expect that 3 methoxyl groups-4 alkoxyl group is important for the interaction of molecules of Compound I and III.

In this compounds category, modification in addition comprises displacement and research alkoxyl group position the moving other ring positions that is increased on the aromatic ring.In addition, check that the displacement of alkoxyl group is to determine whether these groups can strengthen combination or biological activity.Obtain fast these structures by various aryl aldehyde synthetic simplicity and the permission of being obtained commercially property.These compounds are synthetic on the 200mg scale at first.Also synthetic as by the variation in these compounds in the illustrative diaryl series of the Compound I in the I class.This diaryl series reaches (Figure 18) via using the Ullman coupling to operate.

In certain embodiments; phenolic aldehyde is protected; and aryl bromide that is obtained commercially and iodine carry out coupling with the Ullman condition subsequently, wherein Cu salt and Cu part are added in the aryl component as coupling catalyst people such as (, 2004 Org Lett 6:913) Cristau.These are synthetic to transform expection and produces not on the same group the diaryl ether structure of mixing various combination, or with Compound I in those similar functional groups of finding.In addition, the aryl displacement changes or increases on second aromatic ring to identify optimization c-Rel wedding agent.

I class symmetry derivative

With similar false symmetrical derivative synthetic of Compound I I, whether serve as the c-Rel inhibitor to assess these compounds by dividing other dialdehyde member to carry out people such as (, 1966 Anal Biochem 16:359) Placer.Synthesize and have metathetical terephthalaldehyde and iso-phthalaldehyde derivative (Figure 19).These compounds are obtained commercially, and have the many modifications that allow the structure-activity relationship in this compound family of assessment.These derivatives are included in the locational F of other aryl, OH, OMe and COOH and modify.

Be used to assess the radio-labeling of bioavailability or synthesizing of isotope-labeled compound

In order to measure the bioavailability of the compound in the I class, need mix the general of radiochemicals or cold labeling and synthetic schemes fast.Have the directly synthetic of barbituric acid in the literature, wherein the reaction of Malonamide and diethyl carbonate with generation with the excessive barbituric acid of 55% output (people such as Shimo, 1959J.Org.Chem.24:19).By being obtained commercially ¹⁴C or ¹³(2-behind the diethyl malonic ester formation Malonamide of C mark ¹⁴C can use when 60mCi/mmol, and 2-13C 99% mixes), mix by this method ¹⁴C or ¹³C (Figure 20).It is direct that the barbituric acid of mark mixes in any required I analog derivative via the condensation with suitable aldehyde.Complete operation about this method is shown among Figure 20.

The II class is synthetic

In another approach, the II compounds is modified to determine whether about the needs of carboxylic moiety and these molecules variation in locational minute subconstiuent of its carboxylate salt can change the c-Rel antagonism in the molecule that presents modification on these parts.This method comprise esterification, reduction or alkylating synthetic order with assessment be used for bonded ketone, pure and mild uncharged carboxylate salt is functional.

Electric charge demand in the II compounds is assessed by the electric charge in 2 subclass (carboxylate salt and sulfonate) that systematically change compound.As shown in Figure 21, the optimum modification in the carboxylate salt of these molecules part can be synthesized acquisition and can is useful.In this series, use to comprise that esterification, ketone synthesize and the synthetic order of reductive.Consequent intermediate product is checked with regard to biological chemistry or biological activity separately.For example, determine whether esterification cancels chemical-biological activities but strengthen cell permeability.If like this, infer that so esterification represents the biological available prodrug form of molecule, it can penetration cell and can hydrolysis return carboxylate salt after the effect of cell esterase.

Sulfonic acid is not expected with any convenient permeation cell.In certain embodiments, utilization makes inhibitor be transformed into the modification (Figure 22) of neutral sulfone or White streptocide group.Compound is handled with the condition (PC15) that produces SULPHURYL CHLORIDE, handles with methyl Grinard or ammonia subsequently, and is synthetic to reach sulfone and acid amides respectively.These molecule expections are uncharged and can penetration cells.These molecules are assessed with regard to activity in biological chemistry and biological assay.

The SAR research of c-Rel inhibitor analogue series

Use above-described biological chemistry and raji cell assay Raji that above-described synthesis of derivatives is carried out SAR research, suppress effectiveness, selectivity and bioavailability to assess its biological chemistry and cell.Initial analysis will allow to identify for active crucial functional group or structural constituent, and can be used for processing with strengthen other character for example infiltrative those.

Computation model is used to mix experiment SAR data, and helps further SAR modification and improve functional property.Identified some standard that meets as the optimal drug material standed for have be suitable for further clinical before and the leading series of the character overview of clinical development.Established standards comprises activity, selectivity and suitable physico-chemical property, adds the ADME of use computational tool and the initial evaluation of some security property.

In certain embodiments, use the computational tool of describing among Figure 12.Other program is used to predict bioavailability and potential metabolism tendency or toxicity overview (for example, LD1.0, TOPKAT (people such as Enslein, 1994 Mutat Res 305:47; People such as Zheng, 2005 J ChemInf Model 45:856), be used to assess the BP neural network of carinogenicity, be used to predict the ZGENTOX of sudden change probability and be used to calculate molecular melting and hydrophobic program).Docking procedure is used to assess the potential binding pattern (for example, GAsDock (people such as Li, 2004Bioorg Med Chem Lett 14:4671)) of part and target.

The choice criteria that in biological chemistry and raji cell assay Raji, is used for analogue series

Estimate～30 kinds of I classes and～20 kinds of II compounds use EMSA just to analyze at the interactional IC50 of c-Rel-CD28RE as mentioned above.Next, these analogues are tested with selectivity and affine assay method, identify showing that the specificity at c-Rel rather than E2F1 suppresses active analogue, and show at c-Rel than p65 or p50 height those of the selectivity of 10x and avidity at least.By EMSA measure about biological chemistry render a service and optionally threshold value or standard be:

(c-Rel)EC50<1uM

(c-Rel) (p50 or p65 or E2F1) EC50 of EC50＜1/10

(c-Rel) K _D(p50 or p65 or E2F1) K of＜1/10 _D

The compound that meets above-mentioned standard is renderd a service with regard to bioavailability and cell and is further advanced, and confirms as the ability by the IL-2 production, B cell proliferation and the survival that suppress at least 50% control level.Meet the preclinical study that biological chemistry and cell are renderd a service and optionally analogue is used for future as lead compound.

Embodiment 8

This embodiment has described the PI3K-c-Rel/NF-kB pathway as being used for determining immunogenicity, immunological tolerance and autoimmune signal integration point (Figure 24).

A. experimental implementation

The generation of mouse species

Wild-type mice, c-Rel-/-mouse, c-Rel+ /+Bc1-xL Tg mouse and c-Rel-/-Bc1-xLTg mouse (all on the C57BL/6 background) generation as discussed previously (people such as Owyang, J Immunol 167:4948).C-Rel-/-JNK2-/-, c-Rel-/-E2F1-/-, c-Rel-/-p53-/-, c-Rel-/-the CD19cre/+PTENflox/flox mouse is by following generation: make c-Rel-/-mouse respectively with JNK2-/-mouse, E2F1-/-mouse, p53-/-mouse, CD19cre/+PTENflox/flox mouse mating, and interbreed subsequently to obtain dual knocking out.JNK2-/-mouse, E2F1-/-mouse, p53-/-mouse is available from Jackson Lab.In order to produce B cell-specific PTEN deficient mice, make PTENflox/+ mouse and same CD19Cre/+ transgenic mice hybridization available from Jackson Laboratories.The mouse gene type is as discussed previously to use afterbody DNA to carry out by PCR.In all experiments, use big mouse of 8-12 week.Mouse maintains the Weill medical college of Kang Naier university under specified-pathogens free condition.

Cell cultures

Ripe and immature B cell (〉 95%B220+) cracking by complement-mediated as discussed previously and Percoll gradient be from untreated mouse or separated by the mouse of sublethal exposure, and comprising 10% foetal calf serum (FCS) (Cellgro), cultivate in RPMI 1640 substratum of 1% penicillin, 1% Streptomycin sulphate (both is Life Sciences BRL) and 50uM b-mercaptoethanol (Sigma).For the caspase experiment, 2x106/ml B cell is paved plate in each hole of the flat flat board of 24 hole polystyrenes (Corning) with total volume of culture of 1000ul.In 37 ℃ following agent combination was added 12 hours or 24 hours: 10mg/ml goat anti-mouse IgM F (ab ') 2 (anti-IgM, JacksonImmunoResearch Laboratories), 50mM z-VAD-fmk, general caspase inhibitor or 50mMz-LEHD-fmk, specificity caspase 8 inhibitor or 50mMz-FA-fmk, cathepsin B inhibitors (Enzyme System Products).For the PI3K assay method, 5 x, 106 B cells are paved plate in each hole of the flat flat board of 24 hole polystyrenes (Corning) with the final volume of culture of 2ml, wherein 10mg/ml goat anti-mouse IgMF (ab ') 2 added 37 ℃ of instruction times.After the cultivation, the B cell places on ice immediately, with cold PBS washing 1X, carries out cracking by the damping fluid that hereinafter shows then.

Flow cytometry

Following antibody is used for facs analysis: with anti-CD24 (HSA), anti-CD21, anti-IgD, anti-IgM and the anti-B220 (RA3-6B2) of R phycoerythrin (PE), FITC or allophycocyanin (APC) mark, all available from Pharmigen.For all dyeing experiments, use the immunoglobulin (Ig) of isotropic substance coupling to contrast as unspecific staining.Cell dyeed 30-60 minute with surface markers in 4 ℃, washed and was resuspended among the 0.5ml PBS that contains 2% FCS in 1 X PBS subsequently.For propidium iodide dyeing assay method, 2 x 106/ml B cells are cultivated in the flat flat board in 24 holes with 10mg/ml goat anti-mouse IgMF (ab ') 2.On instruction time point, collecting cell and dye with the solution that comprises 50mg/ml propidium iodide, 20ng/ml RNA enzyme A, 0.1% Triton X-100 and 0.1% Trisodium Citrate.Bipartite sample uses Cell-Quest software to analyze by FACS (Becton-Dickinson) subsequently, and the per-cent of quantitative apoptotic cell (＜2N dna content) or S and G2/M phase cell (〉=2N dna content).For the PIP3 assay method, the PIP3 level is used at anti-PI-3, and 4,5-P3 (from Dr.Paul Neilsen, Echelon, Salt Lake City, the present of UT) and the biotin labeled antibody of FACS are measured according to disclosed scheme.

The measurement of mitochondrial membrane potential

Cell is cultivated with the density of 0.5-1.0 x 106 cells/ml.For every kind of condition, the 1ml cell is handled instruction time.Mitochondrial membrane potential use fluorescence potential measurement dyestuff JC-1 ( iodate 5,5 ', 6,6 ' ,-tetrachloro-1,1 ', 3,3 '-tetraethyl-benzo imidazolyl carbocyanine, from Molecular Probe) measure.JC-1 is the positively charged ion carbocyanine that gathers in membrane potential dependency mode in the plastosome gap.This dyestuff exists as monomer when lower concentration, and is similar to fluorescein generation green fluorescence.When higher concentration, this dyestuff is to be similar to phycoerythrin (PE) and to cause excitation spectrum widely and to assemble in the mode of the emission maximum at～590nm place.(these features make JC-1 become to be used for the sensitivity label of mitochondrial membrane potential.) in brief, the 0.3ml cell is mixed with 0.3ml dyeing solution (perfect medium that comprises 0.5 μ g/ml JC-1).Cell is at 37 ℃ of incubator (5% CO ₂) middle dyeing 30 minutes.After the dyeing, cell at room temperature washs in 1 X PBS.Subsequently cell mass is resuspended among the PBS, and by facs analysis JC-1 fluorescence.

Immunoprecipitation and PI3K activation measurement

Scheme is made amendment by previous disclosed form.Cell carries out cracking in 4 ℃ in the ice-cold lysis buffer of 200 μ L (137mM NaCl, 2.7mM KCl, 1mM MgCl2,1mM CaCl2,1% NP40,10% glycerine, 1mg/mL BSA, 20mM Tris, 0.5mM sodium orthovanadate, 0.2mM PMSF, 10 μ gml-1 leupeptins, Pepstatin A and but enzyme peptide).By (1 μ g/ μ L clones 4G10 with the anti-Tyrosine O-phosphate of 2 μ L, UpstateBiotechnology, catalogue #16-125) and the albumin A sepharose 4B slurry of the PBS of 50 μ L (25 μ L fill pearl) washing add among the 500ul PBS in the Eppendorf tube and prepare sepharose 4B.Reaction mixture was shaken 1 hour gently in 4 ℃, undertaken centrifugally with the precipitation pearl by pulse gently, abandoning supernatant is washed 2X time with cold PBS, and is resuspended among the PBS of suitable volumes.Immunoprecipitation is followed and is shaken incubation gently and carried out in 1 hour by making 50-80 μ g cell lysate (being diluted to 450 μ L with PBS) and 50ul sepharose 4B one arise from 4 ℃.Pearl is subsequently with cold PBS washing 2X time, with kinase buffer liquid (10mM Tris, 10mM MgCl2) washing 1X.Kinase reaction is by carrying out in the 50 μ L kinase buffer liquid that the pearl that forms agglomerate are resuspended to comprise 10 μ g phosphatidylinositols (PI), 10uCi g-32P-ATP/50ul reaction, and incubation 30 minutes at room temperature.Lipid comprises that the catalytic synthetic product PIP of PI3K extracts from reaction mixture with 150 μ L chloroforms subsequently.The amount of PI by the PI3K phosphorylation uses CH3Cl:CH3OH:H2O=90:70:14.6 to analyze as developer by thin-layer chromatography (TLC).

The immunoblotting assay method

Cell presses down in enzyme peptide, 5 μ g/mL leupeptins, the 2.5mM trisodium phosphate at 50mM HEPES (pH 7.5), 150mM NaCl, 1mM EDTA, 2.5mM EGTA, 1mM DTT, 0.1% Tween-20,10% glycerine, 10mM b-glycerophosphate, 1mM Sodium Fluoride, 0.1mM Na3VO4,0.2mM PMSF, 5 μ g/mL and carries out cracking, and protein concn is measured by Bradford assay method (Bio-Rad).The full product of cell lysis of 30-40 μ g is loaded into SDS-PAGE to be gone up and transfers on the pvdf membrane (Millipore).Trace is surveyed with the following antibody in 1% skimming milk that is diluted in 10mM Tris (pH 7.4) salt solution (TBS-T) that comprise 0.05% Tween-20: anti-AKT, anti-phosphoric acid-AKT (Thr 308), anti-phosphoric acid-AKT (Ser 473), all from Cell signaling; Anti-PTEN, STAT6 (sc-981), the both is from Santa Cruz Biotechnology; Antihemagglutinin (anti-HA, 12CA5), from the present of Dr Martin Scott.Anti-rabbit secondary antibodies (NA934) that horseradish peroxidase is puted together and anti-mouse secondary antibodies (NA931) are available from Amersham.ECL adds chemiluminescence detection system and is used to manifest western blotting (RPN 2132, Amersham).In all experiments, identical protein carrying capacity is peeled off trace and is surveyed trace again with anti-CDK2 or anti-STAT6 (constant level protein) and control by as discussed previously, or in some cases by using non-specific band to be used for relatively verifying.The all proteins Blot experiment is repeatedly using cell lysate group separately to confirm in the experiment.The data represented independent experiment several times that in each figure, presents with analog result.

Has generation by the gomphosis mouse of the medullary cell of pca-AKT and pMIGR1 contrast retroviral infection

The cDNA (myr-AKT-HA) of AKT that coding is had the constitutively activate form of C-terminal HA mark inserts in the MIGR1 plasmid.The MIGR1 plasmid comprises the gene of MSV promotor and coding GFP.Therefore target gene and GFP mark by internal ribosome site (IRES) sequence separately allow every kind of protein to express (nonfused) independently.Use every kind of plasmid of 10mg for each transfection.The 293T cell uses calcium phosphate method with pHIT123 and pCGP cotransfection (the 293T cell was planted to be created in the maximum value of transfection fusion/flat board on the same day 70% in the day before yesterday).After transfection 48 hours the time, results supernatant liquor and measure with regard to virus titer by infecting in the NIH3T3 cell.The retrovirus supernatant liquor is preserved in-80 ℃ until use.Removing of marrow of female C57BL/6 mouse (8-10 week is big, available from Jackson Labs and maintain under the specified-pathogens free condition) such as previous report with 5 FU 5 fluorouracil (5-FU, 250mg/kg weight).Medullary cell (BMCs) separates from shin bone and femur, and is resuspended among the DMEM that contains 5% heat-inactivated fetal bovine serum (FCS).Red blood cell use as discussed previously ACK lysis buffer carries out depletion.BMCs cultivated 1 day in 6 hole flat boards with the mixture of following cytokine subsequently: and IL-3 (6ng/ml), IL-6 (10ng/ml) and STEM CELL FACTOR (SCF, 100ng/ml).The retrovirus supernatant liquor that will thaw adds in the BMCs, and cultivates other 4-6 days.Collecting cell and injection as discussed previously are subjected in the mouse (850rad) of lethal exposure.Immature B cell is gathered in the crops in the time of back 14 days in transplanting.

B. result

BCR inductive mitochondrial depolarization does not rely on caspase, E2F1, p53 and JNK2 in immature B cell

The immature B cell that uses in this research carries out enrichment and purifying according to the operation of being described by Monroe and colleague people such as (, Immunol Rev 176:86) King.Particularly, transitional immature B cell separates from mice spleen the 14th day the time after sublethal exposure and self reconstruct.Mainly form at the cell that irradiation is gathered in the crops after back 14 days, and can use to express and verify with regard to immature phenotype at the cell surface marker of IgM and IgD or CD24 and CD21 by immature B cell colony.Make in this way, obtain for immature B cell (IgMhi and the CD24hi) cell that 80-90% is pure.

BCR inductive mitochondrial depolarization is to be responsible for initial late period apoptosis program to comprise the early stage critical event of dna break.In order to identify the molecule of initial BCR inductive apoptosis, sensitive and reliably the JC-1 staining be used for the disintegrating of monitoring cable mitochondrial membrane potential people such as (, CellDeath Differ 10:709) Gottlieb.Use this assay method, confirm that anti-IgM antigen receptor is connected to produce mitochondrial depolarization (DYm) fast in the immature B cell.The genetically modified recovery mitochondrial membrane potential of inducing of Bc1-xL.

Shown that the BCR connection can cause caspase to activate and subsequently necrocytosis (Andjelic and Liou.1998.Eur J Immunol28:570, people such as Kovesdi, 2004.Cell Signal 16:881 in growth and sophisticated bone-marrow-derived lymphocyte; People such as Graves, Immunol Rev 197:129; People such as Katz, 2004.Blood 103:168).Whether caspase activates relevant still clear with the plastosome destruction in the former generation B cell.Caspase suppresses the influence of BCR inductive DYm forfeiture and dna break used and gathers caspase inhibitor z-VAD-fmk and check about the specific inhibitor z-LEHD-fmk of well-known initiator caspase (caspase 8).Two kinds of inhibitor all can not reverse the variation among the BCR inductive DY in the immature B cell.Specific tissue proteolytic enzyme B inhibitor z-FA-fmk can't suppress anti-IgM inductive apoptosis fully.Therefore caspase is not that start line plastochondria dependency apoptosis is required.

Previous research in the T cellular compartment has confirmed several signaling molecules and transcription factor involving in immunological tolerance.Especially, the thymocyte derived from JNK2, p53 and E2F1 knock-out mice has resistibility (people such as Villunger, 2003.Science302:1036 to the antigen receptor mediated Apoptosis; People such as Mihara, 2003.Mol Cell 11:577; People such as Lissy, 2000.Nature 407:642; People such as Field, 1996.Cell 85:549; People such as Zhu, Cell Growth Differ 10:829; People such as Sabapathy, 2001 J Exp Med193:317).In addition, these molecules directly or indirectly involve the activation of the dead approach of plastosome.Because between TCR and BCR signal, have strong similarity, so expect that in these molecule targets some or all work in the initial BCR inductive mitochondrial depolarization in immature B cell.In order to test this point, analyze E2F1-/-, p53-/-or JNK2-/-immature B cell.JNK2 disappearance can't be rescued the variation among the anti-IgM inductive DYm in the immature B cell, and the deactivation of pointing out JNK2 can't overcome the apoptotic signal from antigen receptor.Similarly, mitochondrial depolarization is not blocked in the forfeiture of p53 or E2F1.Although the therefore basic role in the necrocytosis of TCR inductive, not existing for early stage or BCR inductive necrocytosis in the late period incident in the immature B cell of these signals is dispensable.

The PTEN deactivation is blocked the forfeiture of BCR inductive plastosome integrity and is overcome the cell cycle and stops in immature B cell

Pten protein matter is by catalysis phosphatidylinositols-3,4, and 5-triphosphate PI (3,4,5) P3 (orPIP3) dephosphorylation becomes phosphatidylinositols-4, and 5-diphosphate PI (4,5) P2 (orPIP2) resists the active Phosphoric acid esterase of PI3K.PIP3 is important second messenger, and it activates the downstream effect thing and comprises the AKT kinases---have the effective growth stimulant of anti-apoptosis effect.Pten in the previous discovery hint deletion T cellular compartment causes the forfeiture of maincenter and periphery immunological tolerance.Therefore, the invalid mouse of Pten development autoimmune disease (people such as Di Cristofano, 1999.Science 285:2122; People such as Suzuki, 2001.Immunity 14:523; People such as Anzelon, 2003.Nat Immunol 4:287; People such as Suzuki, 2003.J Exp Med 197:657).Yet whether PTEN is that the necrocytosis of BCR mediation is required, or whether it participates in the initial of plastosome dependency apoptosis and still do not understand.

Because PTEN-/-complete biological disappearance be lethal, so use the CD19cre/+PTENflox/flox mouse (bPTEN is by PTENflox/+ mouse and CD19Cre/+ transgenic mice mating generation) of B cell-specific deletion.Behind sublethal exposure and self reconstructed operation, obtain the pure immature CD19cre/+PTENflox/flox B cell of 80-90%.Compare with unprovoked maturation and immature B cell, the anti-IgM of the immature B cell of wild-type (CD19cre/+PTEN+ /+) handles the acceleration forfeiture of inducing DYm, points out to hint that antigen receptor connects transmits than cell (carelessness is dead) stronger dead signal during single culture in substratum.The active forfeiture of PTEN seems to cancel BCR inductive dead signal and effectively hinders the mitochondrial membrane depolarize in the immature B cell.Propidium iodide dyeing further confirms disappearance not only blocking dna fracture in immature B cell of bPTEN, also significantly recovers the BCR inductive cell cycle and makes progress.

The average number of further observing the immature B cell of reconstruct in the bPTENflox/flox mouse significantly surpasses in the wild-type control mice.The result finds consistently with previous, and described discovery shows that the absolute number of immature B cell of transitional period, B1 and marginarium B cell in the bPTENflox/flox mouse increases and surpasses wild-type 2-3 times people such as (, the same) Suzuki.Therefore amplification is the result of the negative chosen process of destructive under the situation that does not have PTEN in the body of the IgMhi CD24hi cell in the bPTENflox/flox mouse.

Although therefore PTEN feminine gender selection for the antigen receptor mediation in immature B cell is crucial, E2F1, p53, JNK2 and caspase are not brought into play basic role, maybe may participate in compensating the molecular redundant mechanism of its forfeiture.

The active rising of PTEN is reticent PI3K/AKT survival approach in immature B cell

The PTEN disappearance effective anti-apoptosis effect in the immature B cell that BCR stimulates causes following research: after antigen receptor is crosslinked, maturation to immature B cell in the PTEN activity whether be that difference is regulated.Research hint is with its state of nature, PTEN be constitutively activate and regulate by several mechanism, comprise expression level people such as (, 2001.Mol Cell 8:317) Stambolic.Use the immunoblotting assay method, observe anti-IgM stimulation and cause obviously higher pten protein matter level in immature B cell, this continues up to back 480 minutes of stimulation, and sophisticated B cell shows less change in the PTEN level.BCR in the immature B cell connects the generation of the PTEN isotype of effectively and constantly inducing lower molecular weight, and it is instantaneous appearance in sophisticated B cell only.Although this proteinic clueless, the PTEN that increases in its appearance and the immature B cell active relevant (vide infra).

Because PIP3 is the main endogenous substrate about PTEN, so check next owing to high Pten activity, whether PIP3 production of BCR mediation is suppressed in immature B cell.Use the PIP3 specific antibody, the BCR that observes sophisticated B cell stimulate cause PIP3 gathers in the cell early stage (5 minutes) and late period (120 minutes) ripple.The PIP3 level that reduces was observed after 120 minutes, and is consistent with the transient expression of the PTEN isotype of lower molecular weight.By contrast, the antigen receptor of immature B cell stimulates and to cause the increase that can't detect basically in the PIP3 level in the cell.Because the PIP3 level is by being determined (promptly by the opposing reaction of PTEN and PI3K mediation, PTEN catalysis PIP3 to PIP2, the production of PI3K catalysis PIP3), so the low PIP3 level in the immature B cell may be because the active or low PI3K of high PTEN is active or both.In order to distinguish possibility, measure the PI3K activity in these cells.Use immunoprecipitation and based on the vitro kinase activity of TLC, finding that BCR dependency PI3K activates in former generation immature B cell reduces.By contrast, the BCR of sophisticated B cell stimulation causes early stage and persistent PI3K to activate.

PIP3 is important second messenger, and it is that membrane plasmapheresis transposition and the activation of many downstream signaling molecules are required, and described signaling molecule comprises Akt, PDK and PLC-g.Especially, Akt has been considered as one of most critical molecule in the PI3K approach, and it mediates growth-stimulating and anti-apoptosis function in the various cells.Therefore, low-level PIP3 can influence correct activation and the phosphorylation of AKT protein in immature B cell.Use the phosphoric acid specific antibody, observe the phosphorylation of BCR stimulation promotion downstream anti-apoptosis PIP3 dependency AKT signaling molecule in sophisticated B cell.Yet AKT phosphorylation and activation can't detect in immature B cell.

Because whether the PTEN that increases activity or the PI3K activity that reduces play remarkable effect in control PIP3 level and AKT activation not clear, so inspection knocks out or the maturation of wild-type mice and the AKT phosphorylation in the immature B cell derived from PTEN.The PTEN disappearance significantly strengthens the AKT phosphorylation in the immature B cell, although the weak PI3K activity in the cell.These results point out that the PTEN activity main BCR inductive AKT of being responsible in immature B cell that increases suppresses.The inhibition of generally speaking, observe in immature B cell that higher PTEN expresses, lower PI3K activity and PIP3 producing.Data suggest BCR signal comes selectivity to regulate the PIP3 level via the expression of active control of PI3K and pten protein matter, relies on the cytocerastic stage of B (being sophisticated to immature).Therefore, the PTEN activity of increase in immature B cell during the BCR signal decomposed P I3K/AKT survival approach, and the survival approach of cancellation AKT mediation is to promote necrocytosis.

The active recovery of AKT makes immature B cell avoid the necrocytosis of BCR inductive

Because PIP3 activates the protein except that AKT, comprise TEC family tyrosine kinase and AGC family Serine/Tyrosylprotein kinase for example BTK and PDK1, so may relating to these approach, the necrocytosis of BCR inductive do not rely on the deactivation that AKT suppresses.The relevant mitochondrial depolarization of PTEN does not influence the AKT activity in the report hint neuronal cell.These discoveries cause the active recovery of AKT whether to be enough to block BCR inductive Study of apoptosis separately.AKT of constitutively activate form (myr-AKT-HA) or control vector arrive in the immature B cell by reverse transcription virus gene transduction and bone marrow transplantation transfection.BCR is connected the per-cent from 12 hours (68%) to 48 hours (33%) that causes immature B cell alive in the MIGR1 control group significantly to be reduced, and reduces 35%.By contrast, the BCR of the immature B cell that infects with the AKT of constitutively activate stimulates and only causes the immature B cell of the living moderate reduction from 12 hours (76%) to 48 hours (69%).

These data are consistent with the discovery in the immature B cell of PTEN absence type, and point out being forced to express and recovering that AKT is active to suppress the immature B necrocytosis of BCR inductive of AKT by constitutively activate.The result confirms that composition AKT activates and can block spontaneous apoptosis fully, points out that PTEN plays selectively acting in the necrocytosis of initial BCR mediation rather than dead (death-by-neglect) signal of carelessness.

Immunological tolerance to specific antigen (or tissue) can reach by 3 kinds of main mechanism: disappearance, anergy and T regulate cell.It is relevant with these 3 kinds of immunological tolerance mechanism that c-Rel suppresses.Stimulate unresponsive anergy T cell and anergy B cell to have specific inhibition (Figure 25) in c-Rel and the NF-kB pathway to TCR/BCR.Has specific inhibition in its c-Rel/NF-κ B and the PI3K activated pathway about the research of the immature B cell of experience disappearance.On the contrary, the activation of PI3K-Rel/NF-kB pathway can cause immunological tolerance to be destroyed and the outbreak (Figure 26-28) of autoimmune disease in the tolerance cell.In addition, recent research has hinted by FoxP3 inhibition NF-κ B/Rel and NFAT it is that T regulates the potential mechanism of cell by its retarding effect T cell function.At last, there is the NF-κ that supports in the blocking-up dendritic cell

The B/Rel activity can stop the thin born of the same parents' maturation of dendron shape and this type of immature Dendritic Cells Induced T cell tolerance or T to regulate a large amount of evidences of cytodifferentiation.In a word, these researchs point out that the c-Rel/PI3K approach is to be used for determining that immunological tolerance is to autoimmune signal integration point.More specifically, the sustained activation of this approach causes autoimmune disease, and the inhibition inducing immune tolerance of this approach.

Embodiment 9

This embodiment has described and has expressed the purposes that microarray is identified the c-Rel target.

Materials and methods

Mouse, the purifying of muroid spleen B cell.C-rel+ /+and c-rel-/-mouse (all on the C57BL/6 background) (Owyang, 2001 is the same) as discussed previously generation.Experiment uses the big mouse of 8-12 week that maintains under the specified-pathogens free condition to carry out.B the cell (〉 95%B220+ of purifying) enrichment is carried out in the cracking by complement-mediated as discussed previously, and cultivates in the perfect medium that comprises RPMI 1640,10%FCS (Cellgro), 1% penicillin, 1% Streptomycin sulphate (both is Life Sciences BRL) and 50mM b-mercaptoethanol (Sigma).

Cell cultures.Wild-type and c-rel-/-the B cell uses that (the 10mg/mL antagonistic antibodies of F (ab) ' 2 goat anti-mouse m chain (from Jackson Immunotech) or anti-CD40 (hybridoma 1C10) stimulated 4 hours, used perfect medium in contrast at BCR.For the effect that makes the c-Rel treatment only limits to direct target, the 10mg/mL cycloheximide is used for blocking protein and synthesizes and stop secondary genetic transcription.

[ ³H] thymidine mixes.Propagation defective in order to verify that c-rel is relevant makes 1 x 10 ⁵The B cell was cultivated 42 hours with anti-BCR of 10mg/mL or the anti-CD40 of 10mg/mL in 96 hole U type base plates, used 0.5mCi[subsequently ³H] other 6 hours of thymidine pulse.Cell is gathered in the crops subsequently and DNA amount of just mixing [3H] by scintillometer as discussed previously is measured.

Microarray analysis.RNA sample (Owyang, 2001, the same) as discussed previously is prepared, and the oligonucleotide probe of biotinylated marked by streptavidin estimates that the scheme (Affymetrix) of manufacturers's suggestion produces.Sample uses Affymetrix U74A micro-array chip to measure with regard to the genetic expression overview subsequently, and statistical study (ANOVA) use Genespring v.6.0 software carry out.About 6000 kinds of knowns and 6000 kinds expressed sequence mark (EST) sequence are assessed on each micro-array chip.In order to determine the differential gene expression between the sample, 2 times of differences of bottom line are set at threshold criteria, and data are filtered to obtain the p value of p≤0.02.Experiment is carried out in duplicate or in triplicate to guarantee the reproducibility of results of height.Carry out stdn with average substratum control value from the data of each experiment.Gene carries out cluster by expression summary subsequently and screens with regard to known or unknown immunology cognation.

Immunoblotting.Cell presses down in enzyme peptide, 5mg/mL leupeptin, the 2.5mM trisodium phosphate at 50mM HEPES (pH 7.5), 150mM NaCl, 1mMEDTA, 2.5mM EGTA, 1mM dithiothreitol (DTT), 0.1% Tween-20,10% glycerine, 10mM b-glycerophosphate, 1mM Sodium Fluoride, 0.1mM Na3VO4,0.2mM PMSF, 5mg/mL and carries out cracking, and protein concn is measured by Bradford assay method (Bio-Rad).Be loaded into the full product of cell lysis of 30-40 microgram on the SDS-polyacrylamide gel and transfer on the pvdf membrane (Millipore).Trace is surveyed with the following antibody in 1% skimming milk that is diluted in the tris buffered saline solution (TBS-T) that comprises 0.05% Tween-20: from R﹠amp; The EBI3 of DSystems and amphiregulin.Anti-rabbit secondary antibodies (NA934) that horseradish peroxidase is puted together and anti-mouse secondary antibodies (NA931) are available from Amersham.ECL adds chemiluminescence detection system and is used to manifest western blotting (RPN2132) from Amersham.In all experiments, identical protein carrying capacity by as discussed previously peel off trace and with anti-CDK2 or in the B cell constructive expression's anti-STAT6 survey trace again and control, or in some cases by using non-specific band to be used for relatively verifying.The western blotting experiment is repeatedly using cell lysate group separately to confirm in the experiment.

RT-PCR。Spleen B cell is cultivated 4 hours time length in anti-BCR of 10mg/mL or the anti-CD40 of 10mg/mL.Total RNA preparation and reverse transcription carrying out as described.Gene uses the following mouse Auele Specific Primer at ebi3 to increase by PCR: forward 5 '-GTGCAATGCCATGCTTCTC-3 ', reverse 5 '-TGCCACCCTCAAGTAGACG-3 ', the expection size is 648bp.The PCR product separates on 2% agarose in tris-acetate-edta buffer liquid and manifests by bromination second pyridine dyeing.

The result

The statistical study of the B cell that anti-BCR and anti-CD40 stimulate.Wild-type and c-rel-/-the B cell is used at the antagonistic antibodies of BCR (anti-BCR) or CD40 (anti-CD40) to stimulate 4 hours, used substratum in contrast.For the effect that makes c-Rel only limits to directly transcribe target, cycloheximide is used for blocking protein and synthesizes and stop secondary genetic transcription.Experiment is carried out in duplicate or in triplicate to guarantee the reproducibility of results of height.Sample uses Affymetrix U74A micro-array chip to measure with regard to the genetic expression overview subsequently, and statistical study (ANOVA) use Genespring v.6.0 software carry out.About 6000 kinds of knowns and 6000 kinds expressed sequence mark (EST) sequence are assessed on each micro-array chip.In order to determine the differential gene expression between the sample, 2 times of differences of bottom line are set at threshold criteria, and data are filtered to obtain the p value of p≤0.02.Carry out stdn with average substratum control value from the data of each experiment.Gene carries out cluster by expression summary subsequently and screens with regard to known or unknown immunology cognation.

Relatively wild-type and c-rel-/-reply, find to show that the number gene that statistics goes up significant difference comprises the 134 kinds of genes (p≤0.01) handled about anti-BCR and 89 kinds of genes (p≤0.01) of handling about anti-CD40.In these 2 colonies, 66 kinds of genes handling about anti-BCR and 48 kinds of genes handling about anti-CD40 wild-type and c-rel-/-express at least 2 times of differences between the B cell.Only 5 kinds of genes are common for anti-BCR and anti-CD40 processing, comprise somatomedin, anti-apoptosis molecule and cytokine.Defective magnitude (vide infra) combination during these results and c-Rel dependent gene activate points out that the c-rel defective causes the forfeiture of unique genetic expression for every kind of stimulation.

Handle inductive genetic expression by anti-BCR and anti-CD40 and also in wild-type B cell, assess separately, to confirm of the influence of these 2 kinds of signaling molecules normal B cell-stimulating.Relatively to the normal response of substratum contrast, finds that 271 kinds of genes are handled by anti-BCR to induce (p≤0.005), and 671 kinds of genes are induced (p≤0.02) (table 3) by anti-CD40 processing.In these 2 colonies, 212 kinds of genes show that stimulating 〉=2 times inducing and 391 kinds of genes to show for anti-CD40 for anti-BCR handles 〉=2 times inducing.Confirm that about 52 kinds of genes are common for these 2 kinds of conditions, yet this value is expressed for the real number of replying jointly, because 2 times of threshold value differences of bottom line are eliminated many common inductive genes not enough.Yet, about 1/4th the gene that this data suggest is stimulated by anti-BCR with handle the inductive gene overlap by anti-CD40, comprise transcription factor, somatomedin, survival factors, surface receptor, endocellular signal molecule and various immunoloregulation function genes (table 3).Find that in addition many stimulation by anti-BCR and anti-CD40 in these collaborating geneses suppresses, and comprises transcription repressor and adaptor molecule.

Table 3

BCR and CD40 activated c-rel-/-the B cell bc1-xL survival genes that is beyond expression

Previous report anti-apoptotic genes expression bc1-xL is the BCR of mouse bone-marrow-derived lymphocyte and the direct target gene of the c-Rel between the CD40 stimulation period.Therefore express the genetically modified c-rel deficient mice of bc1-xL and comprise that at various primary cellular defects the BCR inductive apoptosis defective of just surviving proofreaies and correct.The dna microarray analysis confirm the c-rel-that anti-BCR and anti-CD40 handle/-this significant bc1-xL in the B cell expresses not enough.

Comparison wild-type and c-rel-/-the B cell, observe 13 times of forfeitures of bc1-xL inductive in the c-rel defective type B cell of anti-BCR and anti-CD40 processing.Therefore this discovery confirms the activation of early stage target gene immediately of this commercial measurement.

C-rel-/-somatomedin, cytokine and chemokine expression in the B cell.Control several important somatomedins and cytokine in expression in lymphocytes although infer c-Rel, only identified the minority gene up to now.Initial discovery shown c-rel-/-for example genetic expression is impaired to the T cell for IL-2, results from the shortage of the genetic transcription on the κ B response element in the IL-2 promotor.Therefore, observe the T cell proliferation of defective and reply, this can be restored after handling with exogenous IL-2.Combine with this discovery, known several other cytokines of expressing in the B cell have been accredited as the c-Rel target gene, comprise IL-6, IL-10 and LT-b.

IL-10 is pleiotropy t helper cell 2 (TH2) cytokine, and its most remarkable effect relates to the inhibition of inflammation and adaptive immune response.Studies show that IL-10 influences the B cell survival, and by microarray analysis c-rel-that anti-BCR and anti-CD40 handle/-cell in the forfeiture (both is 3 times) of observed IL-10 genetic expression point out the importance of this cytokine in the B cell-stimulating.The expression of crossing of IL-10 detects in numerous B cells are pernicious, comprises the muroid B cell lymphoma; Chronic lymphocytic leukemia; Diffuse large B cell lymphoma; Painless B cell lymphoma; EBV positive burkitt's lymphoma, cutaneous B-cell lymphoma, lymphoma primary effusion and classical He Jiejin lymphomas.Data acknowledgement described herein is crossed in several B cell cancers by the active imbalance of c-Rel IL-10 and is expressed.

Difference in IL-6 and the LT-b genetic expression is not being observed during at 4 hours under the situation that does not have c-Rel by microarray analysis, but because LT-b expresses mainly at the B of germinal center cell rather than does not activate in the primed lymphocyte, so in fact the forfeiture that expection LT-b expresses can take place on later time point, or alternatively LT-b is gene induced can induce by other complementary transcription factors.Similarly, to produce mainly B cell maturation late be to take place during the plasmocyte and therefore can reflect the difference in the B cell maturation stage or the redundancy of other transcription factors once more by the difference that can not feel in the microarray analysis IL-6 genetic expression to IL-6.Impaired IFNall genetic expression (4 times) is being found under anti-CD40 incentive condition under the situation that does not have c-rel, points out that c-Rel relates to the production of paracrine TH1 cytokine.

The minimizing of the ebi3 of subunit of IL-27 is expressed and is also detected in c-rel defective type B cell, in the cell that anti-BCR handles about 4 times and in the cell that anti-CD40 handles 8 times.The RT-PCR experiment confirms this minimizing on rna level independently, and confirms that by the further analysis of western blotting the EBI3 protein expression reduces under the situation that does not have c-rel.EBI3 is relevant with the p40 subunit of IL-12, and has shown homologue---the p28 different dimerization with the p53 subunit of IL-12, to form IL-27.Although in the B cell that EBV transforms, identify that EBI3 mainly expresses in monocyte and dendritic cell at first, and in Li-Si Er Shi (Reed-Sternberg) cell and He Jiejin lymphomas cell, detect.Report shows that EBI3 can also work in inflammatory bowel.Studies confirm that by described herein, show by other people to be similar to the IL-12 deficient mice that the ebi3 disappearance infringement TH1 in mouse replys, and consistent with the forfeiture of IFN-g production.Yet the forfeiture of ebi3 can also be produced and disturb natural killer cell (NK) to reply to influence TH2 and be replied by infringement IL-4.Data described herein are pointed out to induce ebi3 to represent the new mechanism of gene activation by c-Rel, and relate to that the relevant lymphoma of c-rel takes place and autoimmunization is passed through the method for its evolution.

The new target gene of identifying of detected another kind is the amphiregulin somatomedin in assay method, and amphiregulin is expressed 15 times of significantly downward modulations in the B cell of anti-BCR and anti-CD40 processing, more remarkable in the cell that anti-CD40 handles although difference seems.Western blot analysis disclose with wild-type cell relatively, amphiregulin c-rel-/-reduce in the B cell.Amphiregulin is that EGF regulates protein, and it has related to numerous cancers, comprises mammary cancer, prostate cancer, colorectal carcinoma, kidney, bladder cancer, squamous cell carcinoma, lung cancer, carcinoma of the pancreas, ovarian cancer and keratinocyte tumour.Although amphiregulin does not obtain report in expression in lymphocytes, analysis described herein shows that this gene significantly reduces in the c-rel defective type B cell that anti-CD40 stimulates.It points out that by inducing of BCR and CD40 signal this molecule works in activation of lymph sample and humoral immunization in the B cell.The imbalance of amphiregulin does not obtain in any lymph sample is pernicious yet identifying that supposition is because its dominant gene expression pattern in epithelium rather than hematopoietic cell.Therefore the production of amphiregulin by the B cell can facilitate epidermal derived cancer rather than lymph sample the pernicious of tumour that derive.

Gene by the BCR signal induction under the situation that does not have c-rel comprises interferon alpha acceptor (IFNaR) (3 times), egfbp1/kik22 (8 times) and IL-12Rb1 (9 times).These results point out that BCR stimulates the activation that suppresses these genes usually in c-Rel dependency mode.Because IFNa and IL-12 mainly act on the CD8+TH1 cell and EGFBP is that Urogastron is conjugated protein, so the inhibition of these genes reflection B cell can't respond these factors under normal operation.Simultaneously, anti-CD40 handles and causes inducing of under the situation that does not have c-rel serum amyloid A protein matter 2 (saa2) (3.4 times), guanine-nucleotide-binding protein 1 (gbpl) (13 times).These data point out that c-Rel also has the repressor activity except its transcriptional activation function.

C-rel-/-signaling molecule in the B cell expresses.Because c-Rel activates the multiple signal transduction pathway, thus next be evaluated at c-rel-/-the B cell in signaling molecule forfeiture or induce.Few relatively signaling molecule is subjected to the influence of the forfeiture of c-rel.After handling, anti-BCR detects the minimizing (2 times) among the proto-oncogene kinases piml.Piml is that it is by BCR and CD40 signal activation by the serine-threonine kinase of piml proto-oncogene coding.It is mainly expressed in hematopoietic lineage, and has been reported in growth, survival and the differentiation of B cell and works.Mouse tumor model confirms that the cross expression of piml in lymph sample compartment causes the imbalance of lymphoma generation and piml to seem also to relate to bovine leucosis.C-rel-/-the B cell in the forfeiture of observed piml genetic expression point out the importance of this factor in Rel dependency B cell-stimulating.

Another kind of gene phospholipase A γ 2 (plag2) have shown the signal induction by BCR, and this passes through not dependency mechanism mediation B cell proliferation of calcium.The plag2 level BCR activated c-rel-/-reduce 5 times in the B cell, and relevant with the forfeiture (6 times) of plag21br.

C-rel-that CD40 handles/-observe the forfeiture (2.5 times) that map21k/mekl/erkl expresses in the B cell, and handle induce (5 times) of the visible p38 kinases mapk13 in back at anti-BCR.These results point out that the member of map kinase signal pathway between B cell-stimulating and common stimulation period is also sharply regulated by c-Rel.

CD40 stimulate cause in the wild-type B cell than c-rel-/-the B cell in high 3 times ikk-i induce.Other NF κ B signal pathway molecules seem unaffected under the situation that does not have c-rel.The analysis of wild-type CD40 shows inducing of ikk-i, ikk-b, ikb-b and ikb-e.

Microarray analysis does not disclose the forfeiture that cell cycle gene is expressed in the c-rel mutant.Result and c-Rel dependent cell cycle defective only take place consistent after stimulating 12 hours, and in addition, and owing to comprise that in cultivation the secondary genetic expression incident that cycloheximide can't detect is relevant in experiment.

C-rel-/-non-immune response gene in the B cell expresses.The advantage of microarray analysis is that it provides the previous analysis that does not activate relevant extensive various gene with c-Rel.Use the evaluation of the new c-Rel target gene of this technology therefore to become possibility.Find that several " non-immunity " response factors shows the c-Rel dependency.These comprise estrogen receptor (ER) (2.1 times), g protein coupled receptor girkl (5.4 times), the G albumen γ gng4 of subunit (3.8 times), NKp46 associated receptor marl (11 times), nAChR chrnd (5.4 times), glaze originality stromatin becomes glaze albumen (ambn) (5.2 times), lysosome transportation GTP enzyme rab34 (9.9 times), synaptophysin syt9 (5.8 times), metabolic enzyme ester diphosphoglycerate mutase (bpgm) (2.2 times), Cathepsin H (ctsH) (2.1 times), with seminal vesicle protein F (svs5) (2 times).

The disappearance of c-rel causes following remarkable rise: B-adrenergic receptor adralb (6.6 times), Cannabined receptor cb2 (2.2 times), Ras sample gtp binding protein r-rad (2 times), multi-medicine resistance protein mrp6 (3.2 times), adhesion molecule madcaml (2.7 times), myoglobulin heavy chain myh3 (3.7 times), the conjugated protein mybpc3 of sarcomeric myosin heavy chain (3.9 times), synaptotagmin syt2 (2.1 times), eosinophilic granulocyte secondary granule rnase m-earl (4.1 times), with transcriptional regulatory agent hox8 (2.4 times), the inhibition that shows these genes responds BCR and CD40 usually to stimulate and takes place.

Transcription factor for example c-Rel is brought into play its function by regulating target gene.Therefore, identify that the further target that provides inflammation, autoimmune disease and tumour to take place is provided the c-Rel target gene.The dna microarray technology is used to identify the c-Rel target gene.The c-Rel knock-out mice provides specificity to identify the distinct advantages of c-Rel target gene.Knock out genetic expression between the cell by relatively c-Rel wild-type and c-Rel, demonstration can be identified the many new gene of being regulated by c-Rel.Figure 29 confirms that with Figure 30 c-Rel can regulate different and various gene sets, relies on the background of stimulation and cell type.In addition, the c-Rel target gene comprises new somatomedin, the solvable factor, signaling molecule, transcription factor, cell cycle and inhibitor of apoptosis protein matter, and this had not before obtained describing in the literature.These target genes are by serving as the function that the autocrine factor, paracrine factor, survivin matter provide stimulates inflammation and cancer, differentiation and transfer.

All publications and the patent above mentioned in the specification sheets are integrated with this paper by reference.The various modifications of described method and system of the present invention and variation will be conspicuous for those skilled in the art, need not to deviate from the spirit and scope of the present invention.Although the present invention is described in conjunction with concrete preferred embodiment, be to be understood that as claimed the present invention should not be limited to this type of specific embodiments undeservedly.In fact, the conspicuous various modifications that are used to carry out described method of the present invention are expected in the scope of following claim for various equivalent modifications.

Claims (59)

1. suppress the active method of c-Rel, it comprises makes the eukaryotic cell of expressing the c-Rel gene contact with the c-Rel activity inhibitor.

2. the process of claim 1 wherein that described c-Rel activity inhibitor is an antisense oligonucleotide.

3. the process of claim 1 wherein that described c-Rel activity inhibitor is siRNA.

4. the method for claim 3, wherein said siRNA has the nucleotide sequence of SEQ ID NO:6.

5. the method for claim 3, wherein said siRNA has and is selected from SEQ ID NOs:10,13,16 and the nucleotide sequence of 17-26.

6. the process of claim 1 wherein that described c-Rel activity inhibitor is natural compounds or small molecules.

7. the method for claim 6, wherein said small molecules has the following structures of being selected from:

Formula 1 formula 2

a)

R wherein ₁, R ₂, R ₅And R ₆Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, CN, NO ₂, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₂, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R wherein ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl;

b)

R wherein ₁And R ₂Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl; R ₃And R ₄Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₃And R ₄Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl; With

c)

Wherein X and Y are independently selected from NH, NR ₄, O and S; R ₁, R ₂And R ₄Be independently selected from hydrogen, aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁And R ₂Can connect to form ring, described ring can be heterocycle, substituted heterocycle, cyclophane base, substituted cycloalkyl; R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, COR ₁₁, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.

8. the method for claim 7, wherein said small molecules is selected from 1,3-dimethyl-5-{3-[2-(4-nitrophenoxy) oxyethyl group] Ben Yajiaji }-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, 1,3-dimethyl-5-[3-(2-phenoxy group oxyethyl group) Ben Yajiaji]-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, [3-[(tetrahydrochysene-1-methyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl] phenoxy group]-acetate, 4-[(tetrahydrochysene-1-methyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl]-phenylformic acid, 5-[3-bromo-4-(dimethylamino) Ben Yajiaji]-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5-[[4-(dimethylamino)-3-nitrophenyl] methylene radical]-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5-[(5-chloro-2-p-methoxy-phenyl) methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, the 5-[[2-[(2-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-pyrimidine trione, the 5-[[3-[(2-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, the 5-[[2-[(4-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5,5 '-(1,4-phenylene two methynes) two-(9CI) or barbituric acid, 5,5 '-(p-phenylene two methynes) two-(8CI); 5,5 '-two (barbituric acid) benzonitriles of p-Xylol two subunits, 2-[2-methoxyl group-4-[(tetrahydrochysene-1,3-dimethyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl] phenoxy group]-5-nitro-(9CI) 2,4,6 (1H, 3H, 5H)-and pyrimidine trione and 5-[[3-chloro-5-methoxyl group-4-[2-(4-methylphenoxy) oxyethyl group] phenyl] methylene radical]-(9CI).

9. the method for claim 6, wherein said small molecules is selected from 1H-pyrazoles-1-butyric acid, 3-(4-bromophenyl)-5-(1,2-dihydro-7-methyl-2-oxo-3-quinolyl)-4,5-dihydro-g-oxo-(9CI) 1, the 5-naphthalene disulfonic acid, 3-(4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)-1, the 3-naphthalene disulfonic acid, 7-(3-methyl-5-oxo-2-pyrroline-1-yl)-(8CI) Succinic Acid and [5-[(4-hydroxy 3-methoxybenzene base) methylene radical]-4-oxo-2-sulfo--3-thiazolidyl].

10. the method for claim 6, wherein said small molecules is selected from 4-hydroxyl-2-oxo-1,2-dihydroquinoline-3-carboxylic acid N-(4-hydroxy phenyl) acid amides and 7-(diethylin)-3-[5-(2,5-dimethoxy benzene amido)-1,3,4-thiadiazoles-2-yl]-2H-chomene-2-ketone.

11. the process of claim 1 wherein that described c-Re1 inhibitor is selected from fit, antibody, peptide and plan peptide.

12. the process of claim 1 wherein that described cell is people's cell.

13. the process of claim 1 wherein that described cell is a cancer cells.

14. the process of claim 1 wherein that described cell is biological.

15. the method for claim 14, wherein said biology is the people.

16. the method for claim 15, wherein said people shows the symptom that is selected from following cancer: B cell lymphoma, burkitt's lymphoma, chronic lymphocytic leukemia, multiple myeloma, have the Pten sudden change lymphoma, have the Pten sudden change leukemia, examine tumour, prostate cancer, mammary cancer, metastatic tumo(u)r hepatocellular carcinoma, colorectal carcinoma and the gastrointestinal cancer of stepping on Cotard, having the Pten sudden change.

17. the method for claim 15, wherein said people shows the symptom that is selected from following inflammatory diseases: acute respiratory distress, Sepsis, hepatitis, colitis, inflammatory bowel, ischemia reperfusion injury and atherosclerosis.

18. the method for claim 15, wherein said people shows autoimmune disease or hypersensitive symptom, and wherein said autoimmune disease is selected from lympahadenism, systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, ankylosing spondylitis, bone loss, Crohn disease, Graves' disease, psoriatic and sjogren's disease.

19. the method for claim 15, wherein said people has experienced organ transplantation.

20. the method for claim 14, wherein said biology are inhuman Mammalss.

21. the process of claim 1 wherein that described cell is selected from bone-marrow-derived lymphocyte, T lymphocyte, antigen presenting cell and inflammatory cell.

22. the process of claim 1 wherein that the inhibition of described c-Rel causes being selected from that the cell growth stops, the phenotype of apoptosis, immunosuppression and tolerance induction.

23. the process of claim 1 wherein that described inhibition c-Rel activity comprises combining of the c-Rel recognition site that reduces on c-Rel and the c-Rel target gene.

24. the process of claim 1 wherein that described inhibition c-Rel activity comprises blocking-up c-Rel and is selected from c-Rel transcriptional coactivator, c-Rel and transcribes the interaction of the reagent of medium and transcription factor.

25. the process of claim 1 wherein that described inhibition c-Rel activity comprises prevention and modifies via the c-Rel that is selected from stream signal molecule, coactivator, transcribes the reagent of medium and enzyme.

26. the process of claim 1 wherein that described inhibition c-Rel activity comprises makes c-Rel structure conformational change become inactivated state.

27. suppress the method for c-Rel expression of target gene, it comprises makes the eukaryotic cell of expressing the c-Rel gene contact with the c-Rel activity inhibitor.

28. the method for claim 27, wherein said c-Rel target gene is selected from the solvable factor, cytokine, Cycle Regulation agent and cell survival protein.

29. the method for claim 27, wherein said c-Rel target gene are selected from interleukin-11 0, amphiregulin, Epstein-Barr virus inductive gene 3 (EBI3) and interleukin-22 7.

30. the method for claim 27, the inhibition of wherein said c-Rel cause being selected from, and the cell growth stops, the phenotype of apoptosis, immunosuppression and tolerance induction.

31. method, it comprises that the eukaryotic cell that makes the display abnormality signal effect contacts under such condition with the c-Rel activity inhibitor, makes described abnormal signal effect elimination, wherein said abnormal signal effect cause the c-Rel activity that changes.

32. the method for claim 31, the c-Rel activity of wherein said change is selected from the activity of increase and the activity of minimizing.

33. be used to modify the method for extracellular signal to eukaryotic influence, wherein said extracellular signal induction c-Rel activity, described method comprises makes described cell contact under such condition with the c-Rel activity inhibitor, makes described abnormal signal effect reduce.

34. treat the method for the disease that is caused by excessive c-Rel activity, it comprises to the experimenter who shows described disease symptoms uses the c-Rel activity inhibitor.

35. the method for claim 34, wherein said disease is selected from inflammatory diseases, autoimmune disease, bone loss, organ-graft refection and cancer.

36. the method for claim 35, wherein said inflammation is selected from acute respiratory distress, Sepsis, hepatitis, colitis, inflammatory bowel, ischemia reperfusion injury and atherosclerosis.

37. the method for claim 35, wherein said autoimmune disease is selected from lympahadenism, systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, ankylosing spondylitis, Crohn disease, Graves' disease, psoriatic and sjogren's disease.

38. the method for claim 35, wherein said bone loss are selected from derived from arthritic bone loss, derived from the bone loss of inflammation with derived from the bone loss of autoimmune disease.

39. the method for claim 35, wherein said organ-graft refection is selected from graft versus host disease (GVH disease) and marrow graft rejection.

40. the method for claim 35, wherein said cancer be selected from B cell lymphoma, burkitt's lymphoma, chronic lymphocytic leukemia, multiple myeloma, have the Pten sudden change lymphoma, have the Pten sudden change leukemia, examine tumour, prostate cancer, mammary cancer, metastatic tumo(u)r hepatocellular carcinoma, colorectal carcinoma and the gastrointestinal cancer of stepping on Cotard, having the Pten sudden change.

41. by the method for immunotherapy treatment autoimmune disease or transplant rejection, wherein said immunotherapy comprises that the experimenter to the symptom that shows autoimmune disease or transplant rejection uses the c-Rel inhibitor.

42. the method for the disease that treatment is caused by the unconventionality expression of c-Rel target gene, it comprises to the experimenter who shows described disease symptoms uses the c-Rel activity inhibitor.

43. test kit, it is included in the c-Rel activity inhibitor in the pharmaceutically acceptable carrier.

44. the test kit of claim 43, wherein said c-Rel activity inhibitor is an antisense oligonucleotide.

45. the test kit of claim 43, wherein said c-Rel activity inhibitor is siRNA.

46. the test kit of claim 45, wherein said siRNA has the nucleotide sequence of SEQ ID NO:6.

47. having, the test kit of claim 45, wherein said siRNA be selected from SEQ ID NOs:10,13,16 and the nucleotide sequence of 17-26.

48. the test kit of claim 43, wherein said c-Rel activity inhibitor is natural compounds or small molecules.

49. the test kit of claim 48, wherein said small molecules has the following structures of being selected from:

a)

Formula 1 formula 2

R wherein ₁, R ₂, R ₅And R ₆Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, CN, NO ₂, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R wherein ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl;

b)

R wherein ₁And R ₂Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl; R ₃And R ₄Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₃And R ₄Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl; With

c)

Wherein X and Y are independently selected from NH, NR ₄, O and S; R ₁, R ₂And R ₄Be independently selected from hydrogen, aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁And R ₂Can connect to form ring, described ring can be heterocycle, substituted heterocycle, cyclophane base, substituted cycloalkyl; R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, COR ₁₁, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.

50. the test kit of claim 49, wherein said small molecules is selected from 1,3-dimethyl-5-{3-[2-(4-nitrophenoxy) oxyethyl group] Ben Yajiaji }-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, 1,3-dimethyl-5-[3-(2-phenoxy group oxyethyl group) Ben Yajiaji]-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, [3-[(tetrahydrochysene-1-methyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl] phenoxy group]-acetate, 4-[(tetrahydrochysene-1-methyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl]-phenylformic acid, 5-[3-bromo-4-(dimethylamino) Ben Yajiaji]-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5-[[4-(dimethylamino)-3-nitrophenyl] methylene radical]-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5-[(5-chloro-2-p-methoxy-phenyl) methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, the 5-[[2-[(2-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-pyrimidine trione, the 5-[[3-[(2-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, the 5-[[2-[(4-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5,5 '-(1,4-phenylene two methynes) two-(9CI) or barbituric acid, 5,5 '-(p-phenylene two methynes) two-(8CI); 5,5 '-two (barbituric acid) benzonitriles of p-Xylol two subunits, 2-[2-methoxyl group-4-[(tetrahydrochysene-1,3-dimethyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl] phenoxy group]-5-nitro-(9CI) 2,4,6 (1H, 3H, 5H)-and pyrimidine trione and 5-[[3-chloro-5-methoxyl group-4-[2-(4-methylphenoxy) oxyethyl group] phenyl] methylene radical]-(9CI).

51. the test kit of claim 48, wherein said small molecules is selected from 1H-pyrazoles-1-butyric acid, 3-(4-bromophenyl)-5-(1,2-dihydro-7-methyl-2-oxo-3-quinolyl)-4,5-dihydro-g-oxo-(9CI) 1, the 5-naphthalene disulfonic acid, 3-(4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)-1, the 3-naphthalene disulfonic acid, 7-(3-methyl-5-oxo-2-pyrroline-1-yl)-(8CI) Succinic Acid and [5-[(4-hydroxy 3-methoxybenzene base) methylene radical]-4-oxo-2-sulfo--3-thiazolidyl].

52. the test kit of claim 48, wherein said small molecules is selected from 4-hydroxyl-2-oxo-1,2-dihydroquinoline-3-carboxylic acid N-(4-hydroxy phenyl) acid amides and 7-(diethylin)-3-[5-(2,5-dimethoxy benzene amido)-1,3,4-thiadiazoles-2-yl]-2H-chomene-2-ketone.

53. that the test kit of claim 43, wherein said c-Rel inhibitor are selected from is fit, antibody, peptide and plan peptide.

54. comprise micromolecular composition, wherein said small molecules has the following structures of being selected from:

a)

Formula 1 formula 2

R wherein ₁, R ₂, R ₅And R ₆Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, CN, NO ₂, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R wherein ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl;

b)

R wherein ₁And R ₂Be independently selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl; R ₃And R ₄Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₃And R ₄Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl; With

c)

Wherein X and Y are independently selected from NH, NR ₄, O and S; R ₁, R ₂And R ₄Be independently selected from hydrogen, aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁And R ₂Can connect to form ring, described ring can be heterocycle, substituted heterocycle, cyclophane base, substituted cycloalkyl; R ₃Be selected from hydrogen, aryl, substituted aryl, alkyl, substituted alkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl, halogen, COR ₁₁, OH, OR ₁₁, SH, SR ₁₁, NO ₂, CN, SO ₂R ₁₁, NR ₁₁R ₁₂, NR ₁₂(CO) OR ₁₁, NH (CO) NR ₁₁R ₁₂, NR ₁₂(CO) R ₁₁, O (CO) R ₁₁, O (CO) OR ₁₁, O (CS) R ₁₁, NR ₁₂(CS) R ₁₁, NH (CS) NR ₁₁R ₁₂, NR ₁₂(CS) OR ₁₁R ₁₁And R ₁₂Be independently selected from hydrogen, aryl, aralkyl, substituted aralkyl, alkyl, substituted alkyl, thiazolinyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, haloalkenyl group, halo alkynyl, arylalkyl, aryl alkenyl, aromatic yl polysulfide yl, heteroaromatic or non-aromatic, substituted heterocycle aromatic series or non-aromatic, cycloalkyl, substituted cycloalkyl; R ₁₁And R ₁₂Can connect forming ring, described ring can be heteroaromatic or non-aromatic, substituted heterocycle aromatic series, cyclophane base, substituted cycloalkyl.

55. the composition of claim 54, wherein said small molecules is selected from 1,3-dimethyl-5-{3-[2-(4-nitrophenoxy) oxyethyl group] Ben Yajiaji }-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, 1,3-dimethyl-5-[3-(2-phenoxy group oxyethyl group) Ben Yajiaji]-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, [3-[(tetrahydrochysene-1-methyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl] phenoxy group]-acetate, 4-[(tetrahydrochysene-1-methyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl]-phenylformic acid, 5-[3-bromo-4-(dimethylamino) Ben Yajiaji]-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5-[[4-(dimethylamino)-3-nitrophenyl] methylene radical]-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5-[(5-chloro-2-p-methoxy-phenyl) methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, the 5-[[2-[(2-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-pyrimidine trione, the 5-[[3-[(2-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-and pyrimidine trione, the 5-[[2-[(4-chloro-phenyl-) methoxyl group] phenyl] methylene radical]-1,3-dimethyl-2,4,6 (1H, 3H, 5H)-pyrimidine trione, 2,4,6 (1H, 3H, 5H)-pyrimidine trione, 5,5 '-(1,4-phenylene two methynes) two-(9CI) or barbituric acid, 5,5 '-(p-phenylene two methynes) two-(8CI); 5,5 '-two (barbituric acid) benzonitriles of p-Xylol two subunits, 2-[2-methoxyl group-4-[(tetrahydrochysene-1,3-dimethyl-2,4,6-trioxy--5 (2H)-pyrimidyl subunit) methyl] phenoxy group]-5-nitro-(9CI) 2,4,6 (1H, 3H, 5H)-and pyrimidine trione and 5-[[3-chloro-5-methoxyl group-4-[2-(4-methylphenoxy) oxyethyl group] phenyl] methylene radical]-(9CI).

56. composition, it comprises and is selected from following small molecules: 1H-pyrazoles-1-butyric acid, 3-(4-bromophenyl)-5-(1,2-dihydro-7-methyl-2-oxo-3-quinolyl)-4,5-dihydro-g-oxo-(9CI) 1, the 5-naphthalene disulfonic acid, 3-(4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)-1, the 3-naphthalene disulfonic acid, 7-(3-methyl-5-oxo-2-pyrroline-1-yl)-(8CI) Succinic Acid and [5-[(4-hydroxy 3-methoxybenzene base) methylene radical]-4-oxo-2-sulfo--3-thiazolidyl].

57. composition, it comprises and is selected from following small molecules: 4-hydroxyl-2-oxo-1,2-dihydroquinoline-3-carboxylic acid N-(4-hydroxy phenyl) acid amides and 7-(diethylin)-3-[5-(2,5-dimethoxy benzene amido)-1,3,4-thiadiazoles-2-yl]-2H-chomene-2-ketone.

58. comprise the composition of siRNA, wherein said siRNA has the nucleotide sequence of SEQ ID NO:6.

59. comprise the composition of siRNA, wherein said siRNA has and is selected from SEQ ID NOs:10,13,16 and the nucleotide sequence of 17-26.

Images