KR20210105344A - Substances and methods for the treatment of cancer - Google Patents

Abstract

The present invention provides methods and materials related to the treatment of cancer. For example, chimeric antigen receptor T cells with reduced levels of GM-CSF are provided. Also provided is a method for preparing and using a chimeric antigen receptor T cell with a reduced level of GM-CSF.

Description

Substances and methods for the treatment of cancer

This application relates to methods and materials involved in the treatment of cancer. For example, provided herein is a reduced expression level of one or more cytokines (eg, GM-CSF) in adoptive cell therapy (eg, chimeric antigen receptor T cell therapy) to treat a mammal (eg, a human) with cancer. Methods and materials using chimeric antigen receptor T cells are provided.

With unprecedented results from a central trial evaluating the safety and efficacy of CD19-specific chimeric antigen receptor T cells (CART19), the FDA recently obtained CART19 (Tisagenlecleucel) for relapsed refractory acute lymphoblastic leukemia (ALL). A, CART19 (Axi-Cel) has been approved for diffuse large B-cell lymphoma (DLBCL). The use of CAR-T cell therapy is associated with toxicity leading to cytokine release syndrome (CRS) and neurotoxicity. In addition, the effectiveness of CAR-T cell therapy is limited to only 40% permanent remission in lymphoma and 50-60% permanent remission in acute leukemia.

Disclosed herein are methods and materials for constructing T cells (eg, chimeric antigen receptor (CAR) T cells (CART)) with reduced expression levels of one or more cytokine (eg, GM-CSF) polypeptides. to provide. For example, a T cell (eg, CART) can be engineered to decrease GM-CSF polypeptide expression (eg, for use in adoptive cell therapy). In some cases, the T cell (eg, CART) is engineered to knock out (KO) a nucleic acid encoding one or more cytokine polypeptides (eg, a GM-CSF polypeptide), such that the cytokine in the T cell reduce polypeptide (eg, GM-CSF polypeptide) expression. Also provided herein are methods and materials using a T cell (eg, CART) with reduced expression levels of one or more cytokines (eg, GM-CSF polypeptide). For example, T cells with reduced expression of the GM-CSF polypeptide (eg, CART) can be administered to a mammal with cancer (eg, in adoptive cell therapy) to treat the mammal.

In one aspect, the present invention, GM- CSF gene inactivation, GM- CSF gene knock-down or gene knock-out ( GM- CSF ^{k / o} CAR-T cells) comprising the step of administering to the subject CAR-T cells and wherein administration of CAR-T cells lowers or prevents immunotherapy-related toxicity.

In another aspect, the present invention, GM- CSF gene inactivation, GM- CSF gene knockdown or the gene knockout step of administering the CAR-T cells in the individual, including ^{(GM-CSF k / o CAR} -T cells) Provided is a method for lowering the level of a non-GM-CSF cytokine in a subject treated with immunotherapy, comprising:

In one aspect, the invention provides a method for performing GM- CSF gene inactivation, GM- CSF gene knockdown or GM- CSF knockout (KO) in a cell comprising targeted genome editing or GM-CSF gene silencing provides

In one aspect, the present invention provides a nucleic acid construct comprising the step of introducing a nucleic acid construct into an ex vivo T cell, wherein the nucleic acid construct comprises: a) a nucleic acid encoding a guide RNA, wherein the guide RNA is complementary to a GM-CSF messenger RNA; b) a nucleic acid encoding a Cas nuclease; and c) a method for producing a chimeric antigen receptor T cell with reduced levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide comprising a nucleic acid encoding the chimeric antigen receptor.

In another aspect, the present invention provides a method comprising: introducing a complex into an ex vivo T cell; and introducing a nucleic acid encoding a chimeric antigen receptor into the T cell ex vivo, wherein the complex comprises: a) a guide RNA complementary to the GM-CSF messenger RNA; and b) a method for producing a chimeric antigen receptor T cell with reduced levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide, comprising a Cas nuclease.

In one aspect, the present invention provides a nucleic acid construct comprising the step of introducing a nucleic acid construct into an ex vivo T cell, wherein the nucleic acid construct comprises: a) a nucleic acid encoding a guide RNA, wherein the guide RNA is complementary to a cytokine messenger RNA; Provided is a method for producing a chimeric antigen receptor T cell with reduced levels of a cytokine polypeptide comprising b) a nucleic acid encoding a Cas nuclease, and c) a nucleic acid encoding a chimeric antigen receptor.

In another aspect, the present invention provides a method comprising: introducing a complex into an ex vivo T cell; and introducing a nucleic acid encoding a chimeric antigen receptor into the T cell ex vivo, wherein the complex comprises: a) a guide RNA complementary to a cytokine messenger RNA; and b) a method for producing a chimeric antigen receptor T cell with a reduced level of a cytokine polypeptide, comprising a Cas nuclease.

In another aspect, the present invention provides a nucleic acid encoding a guide RNA, wherein the guide RNA is complementary to GM-CSF messenger RNA; b) a nucleic acid encoding a Cas nuclease; and c) introducing a nucleic acid construct comprising a nucleic acid encoding a chimeric antigen receptor into the T cell ex vivo.

In one aspect, the present invention, a) a guide RNA complementary to GM-CSF messenger RNA; and b) introducing a complex comprising a Cas nuclease into the T cell ex vivo; and introducing a nucleic acid encoding the chimeric antigen receptor into the T cell ex vivo.

As demonstrated herein, the GM-CSF KO CART produces reduced levels of GM-CSF in both in vitro and in vivo models and continues to function normally. In addition, as demonstrated herein, GM-CSF KO CART may have enhanced CAR-T cell function and anti-tumor activity. For example, enhanced CAR-T cell proliferation and anti-tumor activity can be observed after GM-CSF depletion. CART19 antigen-specific proliferation in the presence of monocytes may increase in vitro after GM-CSF depletion. In xenografts derived from patients with ALL, CART19 cells, when combined with lenzilumab, could achieve more sustained disease control, and GM-CSF ^{k /o CAR-T cells} would be more effective in controlling leukemia in NALM6 xenografts. can In some cases, GM-CSF KO CART can be incorporated into adoptive T cell therapy (eg, CAR-T cell therapy) to treat, for example, a mammal with cancer without inducing CRS and/or neurotoxicity. For example, GM-CSF KO CART can be incorporated into adoptive T cell therapy (eg, CAR-T cell therapy) to enhance therapeutic coverage following CAR-T cell therapy. In some cases, a single construct can be used to introduce a CAR into a cell (eg, a T cell) and reduce or knock out expression of one or more cytokine polypeptides in the same cell.

In another aspect, the present invention provides a method for treating a mammal with cancer comprising administering to the mammal a chimeric antigen receptor T cell with reduced levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide. provide a way

In another aspect, the present invention provides a method of treating a mammal having cancer, comprising administering to the mammal a chimeric antigen receptor T cell with reduced levels of a cytokine polypeptide.

In general, one aspect of the present application relates to a method of producing a CAR-T cell with a reduced level of a cytokine polypeptide. The method may comprise or consist essentially of introducing a nucleic acid construct into an ex vivo T cell, wherein the nucleic acid construct comprises a) a guide RNA (gRNA) that is complementary to a cytokine messenger RNA (mRNA). nucleic acids; b) a nucleic acid encoding a Cas nuclease, and c) a nucleic acid encoding a chimeric antigen receptor. The cytokine polypeptide may be a granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide, an interleukin 6 (IL-6) polypeptide, an IL-1 polypeptide, an M-CSF polypeptide and/or a MIP-1B polypeptide. may include. The cytokine polypeptide may be a GM-CSF polypeptide, and the gRNA may include the nucleic acid sequence set forth in SEQ ID NO: 1. The Cas nuclease may be a Cas9 nuclease. The nucleic acid encoding the CAR may comprise the nucleic acid sequence set forth in SEQ ID NO:2. The nucleic acid construct may be a viral vector (eg, a lentiviral vector). CARs can target tumor-associated antigens (eg, CD19). The introducing step may comprise transduction.

In another aspect, the present disclosure relates to a method of making a CAR-T cell with reduced levels of a cytokine polypeptide. The method comprises introducing the complex into an ex vivo T cell; and introducing a nucleic acid encoding the CAR into the T cell ex vivo, wherein the complex comprises a) a gRNA complementary to a cytokine mRNA; and b) a Cas nuclease. The cytokine polypeptide may include a GM-CSF polypeptide and/or an IL-6 polypeptide. The cytokine polypeptide may be a GM-CSF polypeptide, and the gRNA may include the nucleic acid sequence set forth in SEQ ID NO: 1. The Cas nuclease may be a Cas9 nuclease. The nucleic acid encoding the CAR may comprise the nucleic acid sequence set forth in SEQ ID NO:2. The complex may be a ribonucleic acid protein (RNP). CARs target tumor-associated antigens (eg, CD19). The introducing step may comprise electroporation.

In another aspect, the present disclosure relates to a method for producing a CAR-T cell with reduced levels of GM-CSF polypeptide. The method may comprise or consist essentially of introducing a nucleic acid construct into an ex vivo T cell, wherein the nucleic acid construct comprises: a) a nucleic acid encoding a gRNA complementary to GM-CSF mRNA; b) a nucleic acid encoding a Cas nuclease, and c) a nucleic acid encoding a CAR. The gRNA may include the nucleic acid sequence set forth in SEQ ID NO: 1. The Cas nuclease may be a Cas9 nuclease. The nucleic acid encoding the CAR may comprise the nucleic acid sequence set forth in SEQ ID NO:2. The nucleic acid construct may be a viral vector (eg, a lentiviral vector). CARs can target tumor-associated antigens (eg, CD19). The introducing step may comprise transduction.

In another aspect, the present disclosure relates to a method for producing a CAR T cell with reduced levels of GM-CSF polypeptide. The method comprises introducing the complex into an ex vivo T cell; and introducing a nucleic acid encoding the CAR into an ex vivo T cell, wherein the complex comprises: a) a gRNA complementary to GM-CSF mRNA; and b) a Cas nuclease. The gRNA may include the nucleic acid sequence set forth in SEQ ID NO: 1. The Cas nuclease may be a Cas9 nuclease. The nucleic acid encoding the CAR may comprise the nucleic acid sequence set forth in SEQ ID NO:2. The complex may be an RNP. CARs can target tumor-associated antigens (eg, CD19). The introducing step may comprise electroporation.

In another aspect, the present disclosure relates to a method of treating a mammal afflicted with cancer. The method may comprise or consist essentially of administering to a mammal suffering from cancer a CAR-T cell having a reduced level of a cytokine polypeptide. The cytokine polypeptide may include a GM-CSF polypeptide and/or an IL-6 polypeptide. The cytokine polypeptide may be a GM-CSF polypeptide, and the gRNA may include the nucleic acid sequence set forth in SEQ ID NO: 1. The mammal may be a human. The cancer may be a lymphoma (eg, DLBCL). The cancer may be a leukemia (eg, ALL). CARs can target tumor-associated antigens (eg, CD19).

In another aspect, the present disclosure relates to a method of treating a mammal afflicted with cancer. The method may comprise or consist essentially of administering to a mammal suffering from cancer a CAR T cell having a reduced level of the GM-CSF polypeptide. The mammal may be a human. The cancer may be a lymphoma (eg, DLBCL). The cancer may be a leukemia (eg, ALL). CARs can target tumor-associated antigens (eg, CD19).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although the present invention can be practiced using methods and materials similar or equivalent to those described herein, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the present disclosure, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description that follows. Other features, objects and advantages of the invention will become apparent from the description and drawings, from the claims.

1 includes a diagram of an exemplary method of engineering GM-CSF knockout (KO) cells using CRISPR. A guide RNA (GACCTGCCTACAGACCCGCC; SEQ ID NO: 1) targeting exon 3 of GM-CSF (also called colony-stimulating factor 2 (CSF2)) was synthesized and cloned into a lentivirus (LV) plasmid. 293T cells were transduced using this LV plasmid, and lentiviral particles were collected and concentrated after 24 hours. To construct GM-CSF knockout CAR-T cells, T cells were stimulated with CD3/CD28 beads on day 0. On day 1, T cells were transduced with CAR19 lentiviral particles and simultaneously transduced with GM-CSF knockout CRISPR/Cas9 lentiviral particles. T cells were recovered after amplification for 8 days.
2A-2B show CAR transduction and GM-CSF knockout efficiencies. 2A contains a graph showing that CRISPR/Cas9 lentivirus achieves a knockout efficiency of 24.1% with guide RNA targeting exon 3 of GM-CSF. At the end of amplification, CAR-T cells were recovered, DNA was isolated, and sequencing was requested for comparison with control sequences. A knockout efficiency of 24.1% was achieved. 2B includes flow cytometric analysis results showing that the CAR transduction efficiency is 73% after transduction with lentavirus. Flow cytometric analysis was performed on day 6 after lentiviral transduction.
3 shows that GM-CSF KO CART19 cells produced less GM-CSF compared to CAR-T cells, and GM-CSF knockout control T cells produced GM-CSF compared to untransduced control T cells (UTD). shows less production. CART19, GM-CSF KO CART19, UTD or GM-CSF KO UTD were co-cultured with the CD19 positive cell line NALM6 in a ratio of 1:5. After 4 hours, cells were recovered, permeabilized and fixed, and then intracellular cytokine staining was performed.
4 shows that GM-CSF KO CART19 cells are more actively amplified compared to CART19. After transduction of T cells with virus, amplification kinetics was followed. GM-CSF KO amplifies more actively compared to CART19 alone.
5 shows an example of a nucleic acid sequence encoding a CAR targeting CD19 (CAR19) (SEQ ID NO:2).
6A-6D show that GM-CSF neutralization enhances CAR-T cell proliferation in the presence of monocytes in vitro and does not impair CAR-T cell effector function. FIG. 6A shows GM produced by CAR-T cells in vitro compared to treatment with isotype control with Renzirumab, analyzed by multiplex after 3 days of culture of CART19 co-cultured with CART19 or NALM6 in medium alone. - Include graphs showing neutralizing CSF (experiment n=2, 2 sets per experiment, representative experiments are shown, ***p<0.001 between lenzilumab and isotype control treatment, T-test, mean±SEM ). 6B includes graphs showing that GM-CSF neutralizing antibody treatment does not inhibit the proliferative capacity of CAR-T cells, as measured by CSFE flow cytometric proliferation assay of CD3 live cells (experiment n=2, 2 sets per experiment, representative experiments at 3 day time points are shown, ns p>0.05, T-test, mean ± SEM between lenzilumab and isotype control treatment alone: CART19 in medium alone, MOLM13: CART19 + MOLM13, PMA alone /ION: CART19 + 5 ng/mL PMA/0.1 μg/mL ION, NALM6: CART19 + NALM6). 6C includes graphs showing that lenzilumab enhances proliferation of CART19 compared to CART19 treated isotype controls when co-cultured with monocytes (biological replicates n=3 at day 3, biological replicates). 2 sets per, **** p<0.0001, mean ± SEM). 6D includes graphs showing that lenzilumab treatment did not inhibit the cytotoxicity of CART19 or non-transduced T cells (UTDs) when incubated with NALM6 (experiment n=2, 2 sets per experiment, 48 Representative experiments of time points are shown, ns p>0.05 between lenzilumab and isotype control treatment, T-test, mean ± SEM).
7A-7E show that GM-CSF neutralization potentiates the anti-tumor activity of CAR-T cells in a xenograft model in vivo. 7A contains the experimental outline: NSG mice were injected with the CD19+ luciferase+ cell line NALM6 (1×10 ^{6 weeks of cells per mouse, IV).} After 4-6 days, mice were imaged, randomized and then administered 1-1.5x10 ⁶ CAR-T19 or the same number of control UTD cells with lenzilumab or control IgG in total number the next day (10 mg/kg). , IP administration daily for 10 days from the day of CAR-T injection). From day 7 after CAR-T cell injection, serial bioluminescence imaging was performed in mice to assess disease burden, and overall survival was followed. Blood was collected from the tail vein on days 7-8 after CAR-T cell injection. 7B includes graphs showing that lenzilumab neutralizes GM-CSF in serum produced by CAR-T in vivo compared to isotype control treatment as assayed by GM-CSF singleplex ( FIG. Experiment n=2, 7-8 mice/group, representative experiment, serum from day 8 after CAR-T cells/UTD injection, *** p<0.001 between treatment with lenzilumab and isotype control, T-test, mean ± SEM). 7C is a graph showing that lenzilumab treated CAR-T is equally effective in controlling tumor burden in vivo compared to isotype control treated CAR-T in a recurrent xenograft ALL model with high tumor burden. (7 days post CAR-T injection, experiment n=2, 7-8 mice/group, representative experiments are shown, *** p<0.001, * p<0.05, ns p>0.05, T-test , mean ± SEM). FIG. 7D includes an experimental outline depicting injection of blasts from ALL patients into NSG mice (1×10 ⁶ weeks of cells per mouse, IV). Mice were continuously bled, and when CD19+ cells reached >1/μL, mice were randomly assigned and administered 5×10 ⁶ CART19 (transduction efficiency about 50%) or UTD cells with lenzilumab or control IgG (10 mg/kg, IP administration daily for 10 days starting on the day of the CAR-T injection). To assess disease burden, starting from day 14 after CAR-T cell injection, mice were followed by serial tail vein bleeds and overall survival was followed. 7E shows that lenzilumab treatment with CAR-T therapy more consistently controls tumor burden over time in a primary acute lymphoblastic leukemia (ALL) xenograft model, compared to isotype control treatment with CAR-T therapy. (6 mice/group, **p<0.01, *p<0.05, ns p>0.05, T-test, mean ± SEM).
8 includes graphs showing that lenzilumab + CAR-T cell treated mice have comparable viability compared to isotype control + CAR-T cell treated mice in a recurrent ALL xenograft model with high tumor burden ( Experiment n=2, 7-8 mice/group, representative experiments are shown, **** p<0.0001, *** p<0.001, * p<0.05, log-rank).
9 includes graphs showing representative TIDE sequences for validating genomic modifications in GM-CSF CRISPR Cas9 knockout CAR-T cells (experiment n=2, depicting representative experiments).
Figure l0A-l0E is GM-CSF knockout CRISPR CAR-T cells are similar to the levels of key cytokines shows a decreased expression of GM-CSF, anti-tumor activity shows Strengthening. 10A shows that CRISPR Cas9 GMCSF ^{k /o} CAR-T exhibits reduced GM-CSF production compared to wild-type CART19, but production and degranulation of other cytokines are not inhibited by GM-CSF gene disruption. Include graphs (experiment n=3, 2 sets per experiment, GM-CSF k/o CAR-T vs. CAR-T *** p<0.001, * p<0.05, ns p>0.05, T-test, mean ± SEM). Figure l0B is a bar according to an analysis by the multiplex, the GM-CSF k / o CAR- T compared to the CAR-T process including a graph showing the decrease of serum levels of human GM-CSF (mouse 5-6 / Group (4-6 animals at blood sampling, 8 days after CART injection), **** p<0.0001, *** p<0.001, T- between GM-CSF k/o CAR-T cells and wild-type CAR-T cells test, mean ± SEM). 10C ^{includes graphs showing that GM-CSF k /o} CART19 enhances overall survival in vivo compared to wild-type CART19 in a recurrent xenograft ALL model with high tumor burden (5-6 mice/group, ** p<0.01, log-rank). 10D and 10E show that other than human GM-CSF, human ( FIG. 10D ) and mouse ( FIG. 10E ) cytokines according to a multiplex of serum, GM-CSF k/o CAR-T cells and wild-type CAR-T cells. Heat maps showing no statistical differences between cells are included, further suggesting that key T-cell cytokines are not adversely depleted by reduced GM-CSF expression (5-6 mice/group (4 at blood draw) -6 animals), **** p<0.0001, T-test).
11 includes graphs showing that GM-CSF knockout CAR-T cells somewhat enhance control of tumor burden compared to CAR-T in vivo in a recurrent xenograft ALL model with high tumor burden. The x-axis shows the number of days after CAR-T injection (5-6 mice/group (only 2 mice left on day 13 in the UTD group), representative experiments are shown, **** p<0.0001, * p<0.05, two-way ANOVA, mean ± SEM).
12A-12D depict patient-derived transplantation models for cytokine release syndrome and neurotoxicity. 12A includes an experimental outline showing the injection of ^{1-3x10 6} weeks of primary blast cells derived from peripheral blood from patients with primary ALL into mice. Mice were monitored for engraftment for 10-13 weeks via tail vein bleed. When the serum CD19+ cells reached 2:10 cells/μL, as indicated, mice were ^{administered CART19 (cells 2-5×10 6} weeks) and antibody therapy was initiated for a total of 10 days. Mice were weighed daily as a measure of well-being. Mice brain MRI was taken 5-6 days after CART19 injection, and blood was drawn from the tail vein 4-11 days after CART19 injection for cytokine and T cell analysis (two independent experiments). 12B includes graphs showing that the combination of GM-CSF neutralization and CART19 is equally effective as the combination of CART19 and an isotype control antibody in controlling CD19+ burden on ALL cells (representative experiment, 3 mice/group, CART19) 11 days post injection, *p<0.05 between GM-CSF neutralization + CART19 and isotype control + CART19, T-test, mean ± SEM). FIG. 12C includes photographs showing that T1 enhancement is observed in brain MRI with CART19 therapy, suggesting cerebral blood-brain barrier disruption and potential edema (3 mice/group, 5-post CART19 injection). Day 6, representative photo). 12D includes graphs showing human CD3 cell infiltration in the brain in a primary ALL xenograft model with high tumor burden treated with CART19 compared to an untreated PDX control (3 mice/group, representative photo).
13A-13D show that GM-CSF neutralization in vivo alleviates cytokine release syndrome following CART19 therapy in a xenograft model . 13A includes graphs showing that lenzilumab and anti-mouse GM-CSF antibody prevented CRS-induced weight loss compared to mice treated with CART19 and an isotype control antibody (3 mice/group, two-way ANOVA; mean ± SEM). 13B includes graphs showing neutralization of human GM-CSF in a patient-derived xenograft model treated with lenzilumab and mouse GM-CSF neutralizing antibody (3 mice/group, *** p<0.001, * p< 0.05, T-test, mean ± SEM). 13C includes a heat map showing that human cytokines (sera collected 11 days after CART19 injection) exhibit a typical cytokine increase in CRS after CART19 treatment. Upon GM-CSF neutralization, as indicated in the panel, several cytokines were significantly reduced (3 mice/group, CART19), including several bone marrow-associated cytokines, compared to mice treated with CART19 and an isotype control antibody, as indicated in the panel. *** p<0.001, ** p<0.01, * p<0.05, T- between isotype control-treated mice receiving CAR-T cell therapy and sera at day 11 post-injection, GM-CSF neutralizing antibody treated mice black). 13D includes a heat map showing that mouse cytokines (sera collected 11 days after CART19 injection) show an increase in mouse cytokines typical of CRS after CART19 treatment. GM-CSF neutralization significantly reduced several cytokines, including several myeloid differentiation cytokines, compared to CART19 treatment with control antibody as indicated in the panel (3 mice/group, day 11 post CART19 sera, GM- *p<0.05, T-test between CSF-neutralizing antibody-treated mice and isotype control-treated mice receiving CAR-T cell therapy).
14A-14D show that in vivo GM-CSF neutralization relieves neuroinflammation after CART19 therapy in a xenograft model. 14A and 14B show gadolinium-enhanced T1-high-intensity signal (cubic mm) MRI, wherein GM-CSF neutralization is useful in reducing brain inflammation, lowering blood-brain barrier disruption and possible edema compared to isotype control (A). ((A) Representative photos, (B) 3 mice/group, **p<0.01, *p<0.05, one-way ANOVA, mean±SD). 14C includes graphs showing the presence of human CD3 T cells in the brain after treatment with CART19 therapy. Upon GM-CSF neutralization, a trend was observed to decrease CD3 infiltration in the brain (3 mice/group, mean ± SEM), as analyzed by flow cytometry in the brain hemispheres. 14D shows that CD11b+ bright macrophages are reduced in the brain of mice receiving GM-CSF neutralization during CAR-T therapy compared to isotype controls on CAR-T therapy, as analyzed by flow cytometry in brain hemispheres. Graphs are included (3 mice/group, mean±SEM).
15 shows an example of the construction of GM-CSF ^{k / o CART19 cells.} The experimental design describes the outline ( FIG. 15A ), the gRNA sequence ( FIG. 15B ) and the primer sequence for constructing the GM-CSFk/o CART19 ( FIG. 15B ). To construct GM-CSF ^{k /o} CART19 cells, gRNA was cloned into a Cas9 lentiviral vector under the control of the U6 promoter and used for lentiviral production. T cells derived from normal donors were stimulated with CD3/CD28 beads and double transduced with CAR19 virus and CRISPR/Cas9 virus 24 hours later. CD3/CD28 magnetic beads were removed on day 6, and GM-CSF ^{k /o} CART19 cells or control CART19 cells were cryopreserved on day 8.
16 depicts a flowchart of the procedure used for RNA sequencing. Binary base call data were converted to fastq using Illumina bcl2fastq software. Adapter sequences were removed using Trimmomatic and qualitatively checked using FastQC. The latest human (GRCh38) and mouse (GRCm38) reference genomes were downloaded from NCBI. A genomic index file was generated with STAR30 and paired end reads were mapped to the genome for each condition. Expression values for each gene were calculated using HTSeq, and differential expression was calculated using DeSeq2. Gene ontology was evaluated using Enrichr.
Figures 17A-17B show that, as detailed in Example 4 , CD14+ cells make up a high proportion of the CNS cell population in stage 3 or higher stage neurotoxic human patients ( Figure 17A ), and anti-hGM-CF It is shown that the antibody, lenzilumab, reduces CNS infiltration by CD11b+ cells and CD14+ cells in the primary ALL mouse model used in NT experiments ( FIG. 17B ), respectively.

Disclosed herein are methods for constructing T cells (eg, chimeric antigen receptor (CAR) T cells (CART)) with reduced expression levels of one or more cytokine polypeptides (eg, GM-CSF polypeptide) and provide material. In some cases, the T cell (eg, CART) inhibits GM-CSF polypeptide expression in the T cell (eg, as compared to a T cell that has not been engineered to KO a nucleic acid encoding the GM-CSF polypeptide). It can be engineered to knock out (KO) the nucleic acid encoding the GM-CSF polypeptide to reduce it. T cells engineered to KO a nucleic acid encoding a GM-CSF polypeptide may also be referred to herein as GM-CSF KO T cells. In some cases, the methods and materials provided herein can be used to modulate bone marrow cells. In some cases, the methods and materials provided herein can be used to deplete bone marrow cells. In some cases, the methods and materials provided herein can be used to enhance the efficacy of T cells (eg, CARTs).

T cells (eg, CARTs) provided herein can be designed to have reduced expression levels of any suitable cytokine polypeptide or combination of cytokine polypeptides. For example, a T cell (eg, CART) provided herein can be a GM-CSF polypeptide, interleukin 6 (IL-6) polypeptide, G-CSF, interferon γ (IFN-g) polypeptide, IL-1B Polypeptides, IL-10 polypeptides, monocyte chemoattractant protein 1 (MCP-1) polypeptides, monokines induced by γ (MIG) polypeptides, macrophage inflammatory protein (MIP) polypeptides (e.g., MIP-1β polypeptide), tumor necrosis factor α (TNF-α) polypeptide, IL-2 polypeptide, perforin polypeptide, or any combination thereof can be designed to decrease the expression level. For example, T cells can be designed to have reduced expression levels of both the GM-CSF and IL-6 polypeptides.

In one aspect, the present invention, GM - CSF gene for inactivation, GM- CSF gene administering the CAR-T cells in the individual, including gene knockdown or knockout (GM- CSF ^{k / o} CAR-T cells) A method for enhancing the anti-tumor effect of immunotherapy in a subject is provided, comprising: administering CAR-T cells lowers or prevents immunotherapy-related toxicity. In one embodiment of the methods provided herein, the method further comprises administering to the individual an anti-hGM-CSF antibody, wherein the anti-hGM-CSF antibody binds to and neutralizes human GM-CSF. hGM-CSF antibody. In certain embodiments, the method comprises administering to the subject an anti-hGM-CSF antibody. In other embodiments, the immunotherapy-related toxic CAR-T comprises cytokine release syndrome (CRS), neurotoxicity (NT), neuroinflammation, or a combination thereof.

In certain embodiments of the methods provided herein, a CAR-T cell comprising (i) GM- CSF gene inactivation, GM-CSF gene knockdown or gene knockout ( GM- CSF ^{k /o CAR-T cell)} , or (ii) CAR-T cells; and administration of the anti-hGM-CSF antibody reduces or prevents CD14+ bone marrow cell migration into the central nervous system (CNS) of the individual. In one embodiment, high levels of CD14+ bone marrow cells in the subject's central nervous system (CNS) are indicative of neurotoxicity. The level of CD14+ bone marrow cells in the CNS is determined by performing a lumbar puncture to take a cerebrospinal fluid (CSF) sample and then in the CSF, e.g., by flow cytometric analysis (flow cytometry), ELISA, anti-CD14-FITC monoclonal antibody or other suitable measurement. It is determined by measuring CD14+ cells by the technique.

In one embodiment of the methods provided herein, the objective response rate of a subject administered an anti-hGM-CSF antibody is improved as compared to a subject not administered an anti-hGM-CSF antibody. In certain embodiments, the objective response rate is a complete response rate or a partial response rate. In another embodiment, progression-free survival and/or survival of the individual is determined by anti-hGM-CSF antibody and/or GM - CSF gene inactivation, GM- CSF gene knockdown or gene knockout ( GM-CSF ^k/o CAR-T cells) compared to subjects not administered CAR-T cells. In a further embodiment, survival is the individual's overall survival. In another embodiment, the anti-hGM-CSF antibody is administered prior to administering CAR-T cells comprising GM- CSF gene inactivation, GM- CSF gene knockdown or GM- CSF ^{k /o CAR-T cells.} Administer to the subject during or after administration.

In certain embodiments of the methods provided herein, the immunotherapy comprises administration of chimeric antigen receptor-expressing T cells (CAR T-cells). In one embodiment, the CAR T-cell is a CART19 cell. In another embodiment of the method of claim 1 provided herein, the immunotherapy is a T-cell receptor (TCR) modified T-cell, a tumor-infiltrating lymphocyte (TIL), a chimeric antigen receptor (CAR)-modified natural killer cell. or adoptive cell transfer selected from the group consisting of administration of dendritic cells or any combination thereof. In some embodiments, immunotherapy comprises administration of monoclonal antibodies, cytokines, cancer vaccines, T cell engaging bispecific antibodies, or any combination thereof. In certain embodiments, the subject has cancer. In certain embodiments, the cancer is lymphoma or leukemia. In another embodiment, the lymphoma is diffuse large B-cell lymphoma (DLBCL). In another embodiment, the leukemia is acute lymphoblastic leukemia (ALL).

In another aspect, the present invention, GM- CSF gene inactivation, GM- CSF gene knockdown or the gene knockout ^{(GM-CSF k / o CAR} -T cells), the method comprising administering a CAR-T cells in the object containing the Provided is a method of lowering the level of a non-GM-CSF cytokine in a subject treated with immunotherapy, comprising: In certain embodiments of the methods provided herein, the method further comprises administering to the individual an anti-hGM-CSF antibody. In other embodiments, the non-GM-CSF cytokine is IP-10, IL-1a, IL-1b, IL-2, IL-3, IL-4, IL-5, IL-6, IL-1Ra, IL -9, IL-10, VEGF, TNF-a, FGF-2, IFN-γ, IL-12p40, IL-12p70, sCD40L, KC, MDC, MCP-1, MIP-1a, MIP-1b or a combination thereof am. In other embodiments of the methods provided herein, the immunotherapy-related toxic CAR-T comprises CRS, NT, neuroinflammation, or a combination thereof.

In one aspect, the present invention provides a method of achieving GM- CSF gene inactivation, GM- CSF gene knockdown or GM- CSF knockout (KO) in a cell comprising targeted genome editing or GM-CSF gene silencing do. In one embodiment of the methods provided herein, the method further comprises an endonuclease as a nucleic acid cleaving enzyme. In some embodiments, the endonuclease is a Fok1 restriction enzyme or flap endonuclease 1 (FEN-1). In certain embodiments, the endonuclease is Cas9 CRISPR related protein 9 (Cas9). In certain embodiments, GM- CSF gene inactivation by CRISPR/Cas9 targets and edits the GM-CSF gene in exon 1, exon 2, exon 3 or exon 4. In one embodiment, GM-CSF gene inactivation comprising CRISPR/Cas9 targets and edits the GM-CSF gene in exon 3. In another embodiment, GM- CSF gene inactivation including the CRISPR / Cas9 is targeting the GM-CSF gene in exon 1, and editing.

In another embodiment, the GM- CSF gene inactivation comprises a plurality of CRISPR/Cas9 enzymes, each Cas9 enzyme targeting multiple sequences of the GM-CSF gene in exon 1, exon 2, exon 3 or exon 4 and , edit In another embodiment, the GM- CSF gene inactivation comprises a bi-allelic CRISPR/Cas9 targeting and knocking out/inactivating the GM-CSF gene.

In certain embodiments of the methods provided herein, the method further comprises treating the primary T cells with valproic acid to enhance biallelic knockout/inactivation. In another embodiment, the targeted genome editing comprises a zinc finger (ZnF) protein. In certain embodiments, targeted genome editing comprises transcription activator-like effector nucleases (TALENS). In certain embodiments, targeted genome editing comprises a homing endonuclease, wherein the homing endonuclease is an ARC nuclease (ARCUS) or a meganuclease. In one embodiment, targeted genome editing comprises flap endonuclease (FEN-1).In certain embodiments, the cell is a CAR T cell.In certain embodiments, the CAR T cell is a CD19 CAR-T cell. In another embodiment, the CAR T cell is a BCMA CAR-T cell. In another embodiment, the GM-CSF gene silencing is RNA interference (RNAi), short interfering RNA (siRNA) and DNA-specific RNA interference ( ddRNAi).

In one aspect, the present invention provides a nucleic acid construct comprising the step of introducing a nucleic acid construct into an ex vivo T cell, wherein the nucleic acid construct comprises: a) a nucleic acid encoding a guide RNA, wherein the guide RNA is complementary to a GM-CSF messenger RNA; A chimeric antigen receptor T cell with reduced levels of a granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide comprising b) a nucleic acid encoding a Cas nuclease, and c) a nucleic acid encoding a chimeric antigen receptor. It provides a manufacturing method of In one embodiment of the methods provided herein, the guide RNA comprises the nucleic acid sequence set forth in SEQ ID NO:1. In other embodiments, the Cas nuclease is a Cas9 nuclease. In a further embodiment, the nucleic acid encoding the chimeric antigen receptor comprises the nucleic acid sequence set forth in SEQ ID NO:2. In another embodiment, the nucleic acid construct is a viral vector. In certain embodiments, the viral vector is a lentiviral vector. In a further embodiment, the chimeric antigen receptor targets a tumor-associated antigen. In another embodiment, the tumor-associated antigen is CD19. In a further embodiment, the step of introducing comprises transduction.

In another aspect, the present invention provides a method comprising: introducing a complex into an ex vivo T cell; and introducing a nucleic acid encoding the chimeric antigen receptor into the T cell ex vivo, wherein the complex comprises: a) a guide RNA complementary to the GM-CSF messenger RNA; and b) a method for producing a chimeric antigen receptor T cell with reduced levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide, comprising a Cas nuclease. In one embodiment of the methods provided herein, the guide RNA comprises the nucleic acid sequence set forth in SEQ ID NO:1. In other embodiments, the Cas nuclease is a Cas9 nuclease. In certain embodiments, the nucleic acid encoding the chimeric antigen receptor comprises the nucleic acid sequence set forth in SEQ ID NO:2. In another embodiment, the complex is a ribonucleic acid protein. In a further embodiment, the chimeric antigen receptor targets a tumor-associated antigen. In certain embodiments, the tumor-associated antigen is CD19. In another embodiment of the methods provided herein, the step of introducing comprises electroporation.

In another aspect, the present invention provides a method for treating a mammal with cancer comprising administering to the mammal a chimeric antigen receptor T cell with reduced levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide. provide a way In certain embodiments, the mammal is a human. In another embodiment, the cancer is lymphoma. In a further embodiment, the lymphoma is diffuse large B-cell lymphoma. In another embodiment, the cancer is leukemia. In another embodiment, the leukemia is acute lymphoblastic leukemia. In one embodiment, the chimeric antigen receptor targets a tumor-associated antigen. In certain embodiments, the tumor-associated antigen is CD19.

In one aspect, the present invention provides a nucleic acid construct comprising the step of introducing a nucleic acid construct into an ex vivo T cell, wherein the nucleic acid construct comprises: a) a nucleic acid encoding a guide RNA, wherein the guide RNA is complementary to a cytokine messenger RNA; Provided is a method for producing a chimeric antigen receptor T cell with reduced levels of a cytokine polypeptide comprising b) a nucleic acid encoding a Cas nuclease, and c) a nucleic acid encoding a chimeric antigen receptor. In certain embodiments of the methods provided herein, the cytokine polypeptide comprises a granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide and/or an interleukin 6 (IL-6) polypeptide. In certain embodiments, the cytokine polypeptide is a GM-CSF polypeptide and the guide RNA comprises the nucleic acid sequence set forth in SEQ ID NO: 1. In one embodiment, the Cas nuclease is a Cas9 nuclease. In another embodiment, the nucleic acid encoding the chimeric antigen receptor comprises the nucleic acid sequence set forth in SEQ ID NO:2. In a further embodiment, the nucleic acid construct is a viral vector. In certain embodiments, the viral vector is a lentiviral vector. In other embodiments, the chimeric antigen receptor targets a tumor-associated antigen. In various embodiments, the tumor-associated antigen is CD19. In another embodiment, the step of introducing comprises transduction.

In another aspect, the present invention provides a method comprising: introducing a complex into an ex vivo T cell; and introducing a nucleic acid encoding the chimeric antigen receptor into the T cell ex vivo, wherein the complex comprises: a) a guide RNA complementary to a cytokine messenger RNA; and b) a method for producing a chimeric antigen receptor T cell with a reduced level of a cytokine polypeptide, comprising a Cas nuclease. In one embodiment of the methods provided herein, the cytokine polypeptide comprises a granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide and/or an interleukin 6 (IL-6) polypeptide. In certain embodiments, the cytokine polypeptide is a GM-CSF polypeptide and the guide RNA comprises the nucleic acid sequence set forth in SEQ ID NO: 1. In other embodiments, the Cas nuclease is a Cas9 nuclease. In another embodiment, the nucleic acid encoding the chimeric antigen receptor comprises the nucleic acid sequence set forth in SEQ ID NO:2. In a further embodiment, the complex is a ribonucleic acid protein. In another embodiment, the chimeric antigen receptor targets a tumor-associated antigen. In certain embodiments, the tumor-associated antigen is CD19. In another embodiment, the step of introducing comprises electroporation.

In another aspect, the present invention provides a method of treating a mammal with cancer comprising administering to the mammal a chimeric antigen receptor T cell with reduced levels of a cytokine polypeptide. In one embodiment of the methods provided herein, the cytokine polypeptide comprises a granulocyte-macrophage colony-stimulating factor (GM-CSF) polypeptide and/or an interleukin 6 (IL-6) polypeptide. In another embodiment, the cytokine polypeptide is a GM-CSF polypeptide and the guide RNA comprises the nucleic acid sequence set forth in SEQ ID NO: 1. In a further embodiment, the mammal is a human. In another embodiment, the cancer is lymphoma. In another embodiment, the lymphoma is diffuse large B-cell lymphoma. In another embodiment, the cancer is leukemia. In a further embodiment, the leukemia is acute lymphoblastic leukemia. In one embodiment, the chimeric antigen receptor targets a tumor-associated antigen. In certain embodiments, the tumor-associated antigen is CD19.

In one aspect, the present invention provides a nucleic acid construct comprising the step of introducing a nucleic acid construct into an ex vivo T cell, wherein the nucleic acid construct comprises: a) a nucleic acid encoding a guide RNA, wherein the guide RNA is complementary to a GM-CSF messenger RNA; A method of improving T cell effector function of a chimeric antigen receptor T cell is provided comprising b) a nucleic acid encoding a Cas nuclease, and c) a nucleic acid encoding a chimeric antigen receptor.

In another aspect, the present invention provides a method comprising: introducing a complex into an ex vivo T cell; and introducing a nucleic acid encoding the chimeric antigen receptor into the T cell ex vivo, wherein the complex comprises: a) a guide RNA complementary to the GM-CSF messenger RNA; and b) a Cas nuclease.

As used herein, the term "decreased" with respect to the expression level of a cytokine (eg GM-CSF) means any level that is lower than a reference expression level of a cytokine (eg GM-CSF) do. As used herein, the term “reference level” in the context of a cytokine (eg, GM-CSF), as described herein, refers to a decrease in the expression level of a cytokine (eg, GM-CSF polypeptide). refers to the level of a cytokine (eg, GM-CSF) typically observed in one or more mammalian (eg, human) samples (eg, control samples) that have not been manipulated as much as possible. A control sample can include, but is not limited to, T cells that are wild-type T cells (eg, T cells that are not GM-CSF KO T cells). In some cases, a decrease in the expression level of a cytokine polypeptide (eg, GM-CSF polypeptide) may be a detectable level of a cytokine (eg, GM-CSF). In some cases, lowering the expression level of a GM-CSF polypeptide may be a loss of the level of GM-CSF.

In some cases, T cells with reduced (eg, engineered to lower) expression levels of one or more cytokine polypeptides (eg, cytokines, as described herein), such as GM-CSF KO T cells, are can maintain normal T cell functions such as T cell degranulation and cytokine release (compared to CART not engineered to have reduced expression levels of eg GM-CSF polypeptide).

In some cases, T cells with reduced (eg, engineered to be lowered) levels of GM-CSF polypeptide (eg, GM-CSF KO T cells) are (eg, GM-CSF KO T cells, as described herein) CART functions such as anti-tumor activity, proliferation, apoptosis, cytokine production, exhaustion susceptibility, antigen-specific effector function, persistence and differentiation compared to non-engineered CART can be strengthened

In some cases, T cells with reduced (eg, engineered to be lowered) levels of a GM-CSF polypeptide (eg, GM-CSF KO T cells) are (eg, as described herein, GM-CSF KO T cells) T cell amplification may be enhanced (compared to CART not engineered to have reduced levels of CSF polypeptide).

A T cell with reduced (eg, engineered to be lowered) expression levels of one or more cytokines (eg, a GM-CSF polypeptide), such as a GM-CSF KO T cell, may be any suitable T cell. The T cell may be a naive T cell. As described herein, examples of T cells that can be designed to have reduced expression levels of one or more cytokines include, but are not limited to, cytotoxic T cells (eg, CD4+ CTLs and/or CD8+ CTLs). include For example, a T cell that can be engineered to lower the level of a GM-CSF polypeptide as described herein may be a CART. In some cases, the one or more T cells can be obtained from a mammal (eg, a mammal with cancer). For example, T cells can be obtained from a mammal to be treated with the materials and methods described herein.

T cells with reduced (eg, engineered to decrease) expression levels of one or more cytokine polypeptides (eg, GM-CSF polypeptides), such as GM-CSF KO T cells, can be constructed using any suitable method. can In some cases, a T cell (eg, CART) can be engineered to KO the GM-CSF polypeptide to reduce expression of the GM-CSF polypeptide in the T cell.

In some cases, when a T cell (eg, CART) is engineered to KO a nucleic acid encoding a cytokine (eg, a GM-CSF polypeptide) to decrease expression of the cytokine polypeptide in the T cell, Any suitable method can be used to KO a nucleic acid encoding a cytokine. Examples of techniques that can be used to knock out a nucleic acid sequence encoding a cytokine polypeptide (eg, a GM-CSF polypeptide) include, but are not limited to, gene editing, homologous recombination, non-homologous ends. Includes non-homologous end joining and microhomology end joining. For example, gene editing (eg, using an engineered nuclease) may be used to KO a nucleic acid encoding a GM-CSF polypeptide. Nucleases available for genome editing include, but are not limited to, CRISPR-attached (Cas) nucleases, zinc finger nucleases (ZFNs), transcriptional activator-like effector (TALE) nucleases and homing endos. nucleases (HE; also called meganucleases).

In some cases, using the clustered regularly interspaced short palindromic repeat (CRISPR) / Cas system (eg, can be introduced into one or more T cells), cytokine polypeptides (eg, GM-CSF polypeptides) Encoding nucleic acids can be KOed (see, eg, FIG. 1 and Example 1). The CRISPR/Cas system used to KO a nucleic acid encoding a cytokine polypeptide (eg, a GM-CSF polypeptide) may include any suitable guide RNA (gRNA). In some cases, the gRNA may be complementary to a nucleic acid encoding a GM-CSF polypeptide (eg, GM-CSF mRNA). Examples of gRNAs specific for a nucleic acid encoding a GM-CSF polypeptide include, but are not limited to, GACCTGCCTACAGACCCGCC (SEQ ID NO: 1), GCAGTGCTGCTTGTAGTGGC, TCAGGAGACGCCGGGCCTCC (SEQ ID NO: 3), CAGCAGCAGTGTCTCTACTC (SEQ ID NO: 4), CTCAGAAATGTTTGACCTCCAGAAATGTTTGACCTCC 5) and GGCCGGTCTCACTCCTGGAC (SEQ ID NO: 6). In some cases, the gRNA component of a CRISPR/Cas system designed to KO a nucleic acid encoding a GM-CSF polypeptide may comprise the nucleic acid sequence set forth in SEQ ID NO:1.

The CRISPR/Cas system used to KO a nucleic acid encoding a cytokine polypeptide (eg, a GM-CSF polypeptide) may include any suitable Cas nuclease. Examples of Cas nucleases include, but are not limited to, Cas1, Cas2, Cas3, Cas9, Cas10 and Cpf1. In some cases, the Cas component of a CRISPR/Cas system designed to KO a nucleic acid encoding a cytokine polypeptide (eg, a GM-CSF polypeptide) may be a Cas9 nuclease. For example, the Cas9 nuclease of the CRISPR/Cas9 system described herein may be lentiCRISPRv2 (e.g., Shalem et al., 2014 Science 343:84-87; and Sanjana et al., 2014 Nature methods 11) :783-784, each of which is incorporated herein by reference in its entirety).

The components of the CRISPR/Cas system used to KO a nucleic acid encoding a cytokine polypeptide (eg, a GM-CSF polypeptide) (eg, gRNA and Cas nuclease) may be in any suitable form can be introduced into one or more T cells (eg, CART). In some cases, a component of the CRISPR/Cas system can be introduced into one or more T cells as a nucleic acid encoding a gRNA and/or a nucleic acid encoding a Cas nuclease. For example, a nucleic acid encoding one or more gRNAs (eg, a gRNA sequence specific for a nucleic acid encoding a GM-CSF polypeptide) and one or more Cas nucleases (eg, Cas9 nucleases) encoding nucleic acid may be introduced into one or more T cells. In some cases, components of the CRISPR/Cas system may be introduced into one or more T cells as gRNAs and/or as Cas nucleases. For example, introducing one or more gRNAs (eg, gRNAs specific for a nucleic acid encoding a GM-CSF polypeptide) and one or more Cas nucleases (eg, Cas9 nucleases) into one or more T cells. can do.

In some cases, a component of the CRISPR/Cas system (eg, a gRNA and a Cas nuclease) encodes a component (eg, a nucleic acid encoding a gRNA and a nucleic acid encoding a Cas nuclease) When introduced into one or more T cells as a nucleic acid, the nucleic acid may be in any suitable form. For example, the nucleic acid can be a construct (eg, an expression construct). The nucleic acid encoding the one or more gRNAs and the nucleic acid encoding the one or more Cas nucleases may be present on separate nucleic acid constructs or on the same nucleic acid construct. In some cases, a nucleic acid encoding one or more gRNAs and a nucleic acid encoding one or more Cas nucleases may be present on a single nucleic acid construct. The nucleic acid construct may be any suitable type of nucleic acid construct. Examples of nucleic acid constructs that can be used to express one or more gRNAs and/or one or more Cas nucleases include, but are not limited to, expression plasmids and viral vectors (eg, lentiviral vectors), and the like. When the nucleic acid encoding one or more gRNAs and the nucleic acid encoding one or more Cas nucleases are present on separate nucleic acid constructs, the nucleic acid constructs may be of the same type of construct or different types of constructs. In some cases, a nucleic acid encoding one or more gRNAs specific for a nucleic acid encoding a cytokine polypeptide (eg, a GM-CSF polypeptide) and a nucleic acid encoding one or more Cas nucleases are combined in a single lentiviral vector may be present on the one or more gRNA sequences specific for a nucleic acid encoding a cytokine polypeptide (eg, a GM-CSF polypeptide), and one or more Lentiviral vectors encoding Cas9 nucleases can be used to engineer T cells ex vivo such that expression levels of cytokines (eg, GM-CSF polypeptides) are reduced.

In some cases, components of the CRISPR/Cas system (eg, gRNAs and Cas nucleases) can be introduced directly into one or more T cells (eg, as gRNAs and/or as Cas nucleases). . When gRNA and Cas nuclease are introduced together into one or more T cells, the gRNA and Cas nuclease may be in the form of a complex. When the gRNA and Cas nuclease are in the form of a complex, the gRNA and Cas nuclease may bind covalently or non-covalently. In some cases, a complex comprising a gRNA and a Cas nuclease may also include one or more additional components. Examples of complexes that may include components of the CRISPR/Cas system (eg, gRNA and Cas nucleases) include, but are not limited to, ribonucleic acid protein (RNP) and effector complexes (eg, CRISPR). RNA (crRNA) containing Cas nucleases). For example, one or more gRNAs and one or more Cas nucleases may be included in the RNP. In some cases, the RNP binds gRNA and Cas nuclease from about 1:1 to about 10:1 (eg, from about 1:1 to about 10:1, from about 2:1 to about 10:1, about 3: 1 to about 10:1, about 5:1 to about 10:1, about 8:1 to about 10:1, about 1:1 to about 9:1, about 1:1 to about 7:1, about 1: 1 to about 5:1, about 1:1 to about 4:1, about 1:1 to about 3:1, about 1:1 to about 2:1, about 2:1 to about 8:1, about 3: 1 to about 6:1, about 4:1 to about 5:1, or about 5:1 to about 7:1). For example, the RNP may comprise gRNA and Cas nuclease in a ratio of about 1:1. For example, the RNP may comprise gRNA and Cas nuclease in a ratio of about 2:1. In some cases, one or more gRNAs specific for a nucleic acid encoding a GM-CSF polypeptide (e.g., encoding one or more gRNAs, including the sequence set forth in SEQ ID NO: 1) and one or more Cas9 nucleases The level of GM-CSF polypeptide can be lowered by using RNPs that are used for ex vivo manipulation of T cells.

The components of the CRISPR/Cas system used to KO a nucleic acid encoding a cytokine polypeptide (eg, a GM-CSF polypeptide) (eg, gRNA and Cas nuclease) can be prepared by any suitable method. can be introduced into one or more T cells (eg, CART). A method for introducing a component of the CRISPR/Cas system into a T cell may be a physical method. A method for introducing a component of the CRISPR/Cas system into T cells may be a chemical method. A method for introducing a component of the CRISPR/Cas system into a T cell may be a particle-based method. Examples of methods that can be used to introduce components of the CRISPR/Cas system into one or more T cells include, but are not limited to, electroporation, transfection (eg, lipofection), transduction (eg, viral vector mediated transduction), microinjection and nucleofection. In some cases, when a component of the CRISPR/Cas system is introduced into one or more T cells as a nucleic acid encoding the component, one or more T cells may be transduced with the nucleic acid encoding the component. For example, one or more gRNA sequences specific for a nucleic acid encoding a GM-CSF polypeptide (eg, encoding one or more gRNAs, including the sequence set forth in SEQ ID NO: 1) and one or more Cas9 nucleases The encoding lentiviral vector can be introduced into a T cell (eg, an ex vivo T cell). In some cases, when a component of a CRISPR/Cas system is introduced directly into one or more T cells, the component can be introduced into the one or more T cells by electroporation. For example, one or more gRNA sequences specific for a nucleic acid encoding a GM-CSF polypeptide (e.g., comprising the sequence set forth in SEQ ID NO: 1, encoding one or more gRNAs) and one or more Cas9 nucleases The containing RNPs can be introduced into T cells (eg, T cells ex vivo) by electroporation. In some cases, a component of the CRISPR/Cas system can be introduced into one or more T cells ex vivo. For example, ex vivo engineering of T cells with reduced levels of GM-CSF polypeptide may comprise transducing the isolated T cells with a lentiviral vector encoding a component of the CRISPR/Cas system. For example, ex vivo manipulation of T cells with reduced levels of GM-CSF polypeptide can include electroporation introduction of complexes comprising components of the CRISPR/Cas system into the isolated T cells. When T cells are engineered ex vivo to lower the level of the GM-CSF polypeptide, the T cells can be obtained from an appropriate source (eg, a mammal or cell line, such as the mammal being treated or a donor mammal).

In some cases, the T cell (eg, CART) is a GM-CSF (eg, compared to a T cell that has not been treated with one or more inhibitors of GM-CSF polypeptide expression or GM-CSF polypeptide activity). Treatment with one or more inhibitors of polypeptide expression or GM-CSF polypeptide activity may reduce GM-CSF polypeptide expression in T cells. The inhibitor for GM-CSF polypeptide expression or GM-CSF polypeptide activity may be any suitable inhibitor. Examples of inhibitors of GM-CSF polypeptide expression or GM-CSF polypeptide activity include, but are not limited to, nucleic acid molecules designed to introduce RNA interference (eg, siRNA molecules or shRNA molecules), antisense molecules, miRNAs, receptor blockades and antibodies (eg, antagonistic and neutralizing antibodies).

T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to decrease) expression levels of one or more cytokines may express (eg, to express) any suitable antigen receptor. can be manipulated). In some cases, the antigen receptor may be a heterologous antigen receptor. In some cases, the antigen receptor may be a CAR. In some cases, the antigen receptor may be a tumor antigen (eg, tumor-specific antigen) receptor. For example, a T cell can be engineered to express a tumor-specific antigen receptor that targets a tumor-specific antigen (eg, a cell surface tumor-specific antigen) expressed by a cancer cell in a mammal with cancer. Examples of antigens recognizable by antigen receptors expressed on T cells with reduced expression of cytokine polypeptides (eg, GM-CSF polypeptides) as described herein include, but are not limited to, CD19 (cluster of differentiation 19), mucin 1 (MUC-1), human epidermal growth factor receptor 2 (HER-2), estrogen receptor (ER), epidermal growth factor receptor (EGFR), alpha fetoprotein (AFP), oncogenic antigen ( CEA), CA-125, epithelial tumor antigen (ETA), melanoma-associated antigen (MAGE), CD33, CD123, CLL-1, E-cadherin, folate receptor α, folate receptor β, IL13R, EGFRviii, CD22, CD20, κ light chain, λ light chain, desmopressin, CD44v, CD45, CD30, CD5, CD7, CD2, CD38, BCMA, CD138, FAP, CS-1 and C-met. For example, T cells with reduced levels of the GM-CSF polypeptide can be designed to express an antigen receptor targeting CD19. An exemplary nucleic acid sequence encoding a CAR targeting CD19 (CAR19) is shown in FIG. 5 .

T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to decrease) expression levels of one or more cytokine polypeptides (eg, GM-CSF polypeptides) using any suitable method antigen receptors can be expressed on the For example, a nucleic acid encoding an antigen receptor can be introduced into one or more T cells. In some cases, viral transduction can be used to introduce nucleic acids encoding antigen receptors into non-dividing cells. Nucleic acids encoding antigen receptors can be introduced into T cells using any suitable method. In some cases, a nucleic acid encoding an antigen receptor can be introduced into a T cell by transduction (eg, viral transduction using a retroviral vector such as a lentiviral vector) or transfection. In some cases, a nucleic acid encoding an antigen receptor can be introduced ex vivo into one or more T cells. For example, ex vivo engineering of a T cell expressing an antigen receptor may comprise transducing the isolated T cell with a lentiviral vector encoding the antigen receptor. When T cells are engineered ex vivo to express antigen receptors, the T cells can be obtained from any suitable source (eg, a mammal or cell line, such as the mammal or donor mammal being treated).

In some cases, T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to decrease) expression levels of one or more cytokine polypeptides (eg, GM-CSF polypeptide) are antigen receptor also express (eg, engineered to express), the T cell can be engineered to decrease the expression level of a cytokine and to express an antigen receptor using any suitable method. In some cases, the T cell may first be engineered to lower the expression level of a cytokine polypeptide (eg, a GM-CSF polypeptide) and then engineered to express an antigen receptor, or vice versa. In some cases, the T cell can be simultaneously engineered to lower the expression level of one or more cytokine polypeptides (eg, a GM-CSF polypeptide) and to express an antigen receptor. For example, one or more nucleic acids used to lower the expression of a cytokine polypeptide such as a GM-CSF polypeptide (e.g., one or more gRNAs specific for a nucleic acid encoding a cytokine and one or more Cas9 nucleases One or more nucleic acids encoding one or more oligonucleotides complementary to the mRNA of a lentiviral vector encoding a cytokine) and one or more nucleic acids encoding an antigen receptor (eg, CAR) may be simultaneously introduced into one or more T cells. One or more nucleic acids used to reduce the expression of a cytokine polypeptide (eg, a GM-CSF polypeptide) and one or more nucleic acids encoding an antigen receptor are directed to one or more T cells on separate nucleic acid constructs or on a single nucleic acid construct. can be introduced. In some cases, one or more nucleic acids used to reduce expression of a cytokine polypeptide (eg, a GM-CSF polypeptide) and one or more nucleic acids encoding an antigen receptor are directed to one or more T cells on a single nucleic acid construct. can be introduced. In some cases, one or more nucleic acids used to reduce expression of a cytokine polypeptide (eg, a GM-CSF polypeptide) and one or more nucleic acids encoding an antigen receptor can be introduced ex vivo into one or more T cells. have. For ex vivo engineering of T cells to reduce the expression level of one or more cytokine polypeptides (eg, GM-CSF polypeptides) and to express antigen receptors, the T cells can be obtained from any suitable source (eg, mammals or cell lines, such as the mammal to be treated or the donor mammal).

In some cases, T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to be lowered) expression levels of one or more cytokine polypeptides (eg, GM-CSF polypeptide) are treated with stimulation can be T cells may be subjected to stimulation treatment simultaneously with or independently of engineering to lower the level of one or more cytokine polypeptides. For example, one or more T cells with reduced levels of GM-CSF polypeptide used in adoptive cell therapy may first be stimulated and then engineered to lower the expression level of GM-CSF polypeptide, and vice versa. is also possible In some cases, one or more T cells with reduced levels of a cytokine polypeptide (eg, GM-CSF polypeptide) used in adoptive cell therapy are first stimulated and then engineered to lower the expression level of the cytokine polypeptide. can do. T cells may be stimulated by any suitable method. For example, T cells can be stimulated by contacting them with one or more CD polypeptides. Examples of CD polypeptides that can be used to stimulate T cells include, but are not limited to, CD3, CD28, inducible T cell co-stimulatory factor (ICOS), CD137, CD2, OX40 and CD27. In some cases, components of the CRISPR/Cas system (eg, gRNAs and/or Cas nucleases) are introduced into T cells to release one or more cytokine polypeptides (eg, GM-CSF polypeptides). Prior to KOing the encoding nucleic acid, T cells can be stimulated with CD3 and CD28.

Also provided herein are methods and materials involved in the treatment of cancer. For example, one or more T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to decrease) the expression level of a cytokine polypeptide (eg, adoptive cells such as CART therapy) in therapy) to a mammal (eg, a human) afflicted with cancer to treat the mammal. In some cases, as described herein, a method of treating a mammal with cancer can reduce the number of cancer cells (eg, cancer cells expressing a tumor antigen) in the mammal. In some cases, as described herein, a method of treating a mammal with cancer can reduce the size of one or more tumors (eg, tumors expressing tumor antigens) in the mammal.

In some cases, upon administration of T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to decrease) expression levels of cytokine polypeptides to a mammal, CRS does not occur. For example, upon administration of T cells with reduced levels of GM-CSF polypeptide to a mammal, the release of cytokines associated with CRS (eg, the major cytokine of CRS) does not occur. Examples of cytokines associated with CRS include, but are not limited to, IL-6, G-CSF, IFN-g, IL-1B, IL-10, MCP-1, MIG, MIP, MIP lb, TNF-a, IL -2 and perforin.

In some cases, administration of T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to decrease) expression levels of cytokine polypeptides to a mammal does not result in neurotoxicity. For example, upon administration of T cells with reduced levels of GM-CSF polypeptide to a mammal, differentiation and/or activation of leukocytes, differentiation and/or activation associated with neurotoxicity does not occur. Examples of differentiated and/or activated leukocyte cells associated with neurotoxicity include, but are not limited to, monocytes, macrophages, T-cells, dendritic cells, microglia, astrocytes and neutrophils.

Any suitable mammal (eg, a human) afflicted with cancer can be treated as described herein. Examples of mammals treatable as described herein include, but are not limited to, humans, primates (eg, monkeys), dogs, cats, horses, cattle, pigs, sheep, mice, and rats. For example, a human afflicted with cancer has one or more T cells (eg, a GM-CSF polypeptide) with reduced (eg, engineered to decrease) expression levels of a cytokine polypeptide, eg, as described herein Adoptive T cell therapy, such as CAR-T cell therapy, using the methods and materials described above can be treated.

As described herein, when treating a mammal (eg, a human) with cancer, the cancer can be any suitable cancer. In some cases, the cancer treated as described herein may be a solid tumor. In some cases, the cancer treated as described herein may be a hematologic cancer. In some cases, the cancer treated as described herein may be a primary cancer. In some cases, the cancer treated as described herein may be a metastatic cancer. In some cases, the cancer treated as described herein may be a refractory cancer. In some cases, the cancer treated as described herein may be a recurrent cancer. In some cases, the cancer treated as described herein can express a tumor-associated antigen (eg, an antigenic substance produced by a cancer cell). Examples of cancers treatable as described herein include, but are not limited to, B cell cancers (eg, diffuse large B cell lymphoma (DLBCL) and B cell leukemia), acute lymphoblastic leukemia (ALL), Chronic lymphocytic leukemia (CLL), follicular lymphoma, mantle cell lymphoma, non-Hodgkin's lymphoma, Hodgkin's lymphoma, acute myelogenous leukemia (AML), multiple myeloma, head and neck cancer, sarcoma, breast cancer, malignant gastrointestinal cancer, bladder cancer, urothelial cancer, kidney cancer, lung cancer, prostate cancer, ovarian cancer, cervical cancer, genital cancer (eg, male genital cancer and female genital cancer) and bone cancer. For example, one or more T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to be lowered) levels of the GM-CSF polypeptide can be used to treat a mammal with DLBCL. For example, T cells with reduced levels (eg, engineered to be lowered) of one or more GM-CSF polypeptides (eg, GM-CSF KO T cells) can be used to treat mammals with ALL.

Any suitable method can be used to identify a mammal with cancer. For example, imaging and biopsy techniques can be used to identify mammals (eg, humans) with cancer.

The mammal, upon being identified as having cancer (eg, DLBCL or ALL), has one or more T cells (eg, engineered to decrease) the expression level of a cytokine polypeptide described herein (eg, GM-CSF KO T cells) may be administered.

For example, one or more T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to decrease) the expression level of a cytokine polypeptide can be adopted to treat a mammal with cancer. It can be used in T cell therapy (eg, CAR-T cell therapy). For example, T cells with reduced levels of one or more GM-CSF polypeptides can be treated with adoptive T cell therapy (eg, CAR-T) targeting any suitable antigen in a mammal (eg, a mammal with cancer). cell therapy). In some cases, the antigen may be a tumor-associated antigen (eg, an antigenic substance produced by a cancer cell). Examples of tumor-associated antigens that can be targeted by adoptive T cell therapies provided herein include, but are not limited to, CD19 (associated with DLBCL, ALL and CLL), AFP (associated with gonocytes and/or hepatocellular carcinoma), CEA (associated with intestinal cancer, Lung and/or breast cancer related), CA-125 (ovarian cancer related), MUC-1 (breast cancer related), ETA (breast cancer related), MAGE (malignant melanoma related), CD33 (AML related), CD123 (AML related) , CLL-1 (associated with AML), E-cadherin (associated with epithelial tumors), folate receptor α (associated with ovarian cancer), folate receptor β (associated with ovarian cancer and AML), IL13R (associated with brain cancer), EGFRviii (associated with brain cancer) associated), CD22 (B cell cancer associated), CD20 (B cell cancer associated), κ light chain (B cell cancer associated), λ light chain (B cell cancer associated), CD44v (AML associated), CD45 (hematologic cancer associated), CD30 (associated with Hodgkin's lymphoma and T-cell lymphoma), CD5 (associated with T-cell lymphoma), CD7 (associated with T-cell lymphoma), CD2 (associated with T-cell lymphoma), CD38 (associated with multiple myeloma and AML), BCMA (associated with multiple myeloma) ), CD138 (associated with multiple myeloma and AML), FAP (associated with solid tumors), CS-1 (associated with multiple myeloma) and c-Met (associated with breast cancer). For example, T cells with reduced levels of one or more GM-CSF polypeptides may be used in CAR-T cell therapy targeting CD19 (eg, CART19 cell therapy) to treat cancer as described herein. can

In some cases, one or more T cells (eg, GM-CSF KO T cells) with reduced (eg, engineered to decrease) expression levels of cytokine polypeptides are administered with adoptive T cell therapy (eg, CAR- T cell therapy) to treat mammals with diseases or disorders other than cancer. For example, one or more T cells with reduced levels of the GM-CSF polypeptide target any appropriate disease-associated antigen (eg, an antigenic substance produced by a cell affected by a particular disease) in the mammal. for adoptive T cell therapy (eg, CAR-T cell therapy). Examples of disease-associated antigens targetable by adoptive T cell therapy provided herein include, but are not limited to, desmopressin (associated with autoimmune skin diseases). In other embodiments, examples of disease-associated antigens targetable by adoptive T cell therapy provided herein include, but are not limited to, the DSG3 antigen, the B cell receptor (BCR) or antigen MuSK that binds to DSG3 in pemphigus vulgaris. includes In further embodiments, examples of disease-associated antigens targetable by adoptive T cell therapy provided herein include, but are not limited to, MuSK BCR to MuSK in myasthenia gravis.

In some cases, one or more T cells (e.g., GM) with reduced (e.g., engineered to be lowered) expression levels of a cytokine polypeptide used in adoptive T cell therapy (e.g., CAR-T cell therapy) -CSF KO T cells) may be administered to a mammal suffering from cancer as a combination therapy with one or more additional substances used to treat the cancer. For example, T cells with reduced levels of one or more GM-CSF polypeptides used in adoptive cell therapy can be treated with one or more anti-cancer treatments (eg, surgery, radiation therapy, chemotherapy (eg, busulfan ), targeted therapy (eg, GM-CSF inhibitors such as lenzilumab), hormone therapy, angiogenesis inhibitors, immunosuppressants (eg, interleukin-6 inhibitors such as tocilizumab) ) and/or one or more CRS therapeutics (eg, ruxolitinib and ibrutinib). When T cells with reduced levels of one or more GM-CSF polypeptides used in adoptive cell therapy are used together with an additional agent to treat cancer, the one or more additional agents may be administered simultaneously or independently. In some cases, T cells with reduced levels of one or more GM-CSF polypeptides used in adoptive cell therapy may be administered first, followed by administration of one or more additional agents, or vice versa.

U.S. Patent 8,168,183, and 9017, and referenced 674 in renjil rumaep (Humanigen, Burlingame, CA) hGM-CSF neutralizing antibody according to the embodiments described herein, ^® new first Humaneered to neutralize human GM-CSF monoclonal antibodies class, each of which is incorporated herein by reference in its entirety.

The invention will be further illustrated in the following examples, which do not limit the scope of the invention described in the claims.

Example

Example One

To increase the therapeutic index of CAR-T cell therapy defect Cytokine construction into CAR-T cells

This example describes the development of GM-CSF knockout (GM-CSF KO) CART19 cells, and shows that the prepared GM-CSF KO CART19 cells function normally and have enhanced amplification.

Experimental Design:

CAR19 was used in a B cell leukemia xenograft model. Plasmids were used for packing and lentiviral production as described herein. As mouse models, two models were used:

One. Xenograft model: NSG mice were subcutaneously inoculated with CD19-positive, luciferase-positive cell line NALM6. Engraftment was verified by bioluminescence imaging. Mice were treated intravenously with human PBMCs and intratumoral injections of lentiviral particles. Construction of CAR-T cells was confirmed by flow cytometry. Migration of CART to the tumor site was analyzed and anti-tumor response was measured via bioluminescence imaging as a measure of disease burden.

2. Humanized Immune System (HIS) mice from Jackson Laboratory: Human hematopoiesis was developed after injection of fetal CD34+ cells into mice as newborns. These mice were engrafted with the CD19+ cell line NALM6 as previously used. Likewise, CART19 was generated in vivo by intratumoral injection of lentiviral particles. The NALM6 scavenging activity of CART19 cells was then measured and compared to CART19 cells transduced with ex vivo-produced lentivirus (currently clinically used).

Materials and Methods:

CAR plasmid construction:

Anti-CD19 clone FMC63 was newly synthesized using 41BB and CD3 zeta from the CAR backbone, and then cloned into the 3rd generation lentiviral backbone.

To construct control CART19 cells, normal donor T cells were negatively selected using the pan T cell kit and expanded ex vivo using anti-CD3/CD28 Dynabeads (Invitrogen, added on the first day of culture). T cells were transduced with lentiviral supernatants at a multiplicity of infection (MOI) of 3 the day after stimulation. On day 6 anti-CD3/CD28 Dynabeads were removed and T cells were cultured in T cell medium (X-vivo 15 medium, 5% human serum, penicillin, streptomycin and glutamine) for up to 15 days, then frozen for future experiments. preserved. T cells were thawed prior to use in all experiments and recovered overnight at 37°C.

GM- CSF knockout Construction of CAR-T cells:

GM-CSF knockout CAR-T cells were constructed using the CRISR-Cas9 system in two ways:

1. A gRNA was constructed and cloned into a lentivirus, and constructed to encode Cas9 and gRNA. During T cell amplification, lentivirus was transduced into T cells on day 1, and CAR19 lentiviral particles were transduced simultaneously on the same day. After the cells were amplified for 8 days, T cells were recovered, DNA was isolated, and the knockout efficiency was investigated by sequencing. These cells were cryopreserved and used for future in vitro or in vivo experiments. The nucleic acid sequence encoding it is shown in FIG. 5 .

2. mRNA was prepared from gRNA and used to knock out GM-CSF. To this end, gRNA was mixed with RNP in a 1:1 ratio and then introduced into T cells by electroporation 3 days after stimulation with CD3/CD28 beads. Cells were amplified for 8 days to recover T cells, and DNA was isolated and sequenced to examine knockout efficiency. These cells were cryopreserved and used for future in vitro or in vivo experiments.

cell

NALM6 cells were obtained from ATCC and maintained in R10 medium (RPMI medium, 10% fetal bovine serum, penicillin and streptomycin). NALM6 cells transduced with luciferase-GFP under the control of the EFla promoter were used as indicated in some experiments. Non-identified primary human ALL biopsies were obtained from the Mayo Clinic Biobank. All samples were obtained with informed written consent. In all functional experiments, cells were thawed at least 12 hours prior to analysis and allowed to recover overnight at 37°C.

flow cell measurement analysis

Anti-human antibodies were purchased from BioLegend, eBioscience or BD Biosciences. Cells were isolated from in vitro culture or animals, washed once in PBS supplemented with 2% fetal bovine serum, and stained at 4°C after blocking the Fc receptor. To measure the number of cells, Countbright beads (Invitrogen) were used according to the manufacturer's instructions (Invitrogen). In all assays, subject populations were gated based on forward scatter versus side scatter characteristics followed by singlet gating, and live cells were gated using Live Dead Aqua (Invitrogen). Surface expression of anti-CD19 CAR was detected by staining with Alexa Fluor 647-conjugated goat anti-mouse F(ab')2 antibody from Jackson Immunoresearch.

T cell function analysis:

T cell degranulation and intracellular cytokine analysis:

Briefly, T cells were incubated with target cells in a 1:5 ratio. After staining for CAR expression, CD107a, CD28, CD49d and monensin were added during incubation. After 4 hours, cells were harvested and stained for CAR expression, CD3 and Live Dead staining (Invitrogen). Cells were fixed and permeabilized (FIX & PERM® Cell Fixation & Cell Permeabilization Kit, Life technologies), followed by intracellular cytokine staining.

Proliferation Assay:

T cells were rinsed, suspended in 100 μl of PBS at 1×10 ⁷ /ml, and labeled with 100 μl of CFSE 2.5 μM (Life Technologies) at 37° C. for 5 minutes. The reaction was then quenched with cold R10 and the cells washed 3 times. The target was irradiated with 100 Gy. T cells were incubated with irradiation-treated target cells at a 1:1 ratio for 120 hours. Then, the cells were harvested and stained with CD3, CAR and Live Dead aqua (Invitrogen), and flow cytometry analysis was performed after adding Countbright beads (Invitrogen).

Cytotoxicity assay:

Cytotoxicity assays were performed with NALM6-Luc cells or CFSE (Invitrogen) labeled primary ALL samples. Briefly, targets were incubated with effector T cells at the indicated rates for 4, 16, 24, 48 and/or 72 hours. Killing was calculated by bioluminescence imaging or flow cytometry on a Xenogen IVIS-200 spectral camera. In the latter case, cells are harvested; Countbright beads and 7-AAD (Invitrogen) were added and then analyzed.

The remaining target cells were CFSE+ 7-AAD-.

Measuring released cytokines:

Effector cells and target cells were incubated in T cell medium at a 1:1 ratio for 24 or 72 hours as indicated. The supernatant was recovered and analyzed by a 30-plex Luminex array according to the manufacturer's protocol (Invitrogen).

result

GM-CSF KO CAR-T cells were constructed using the CRISR-Cas9 system. During T cell amplification, T cells were transduced (day 1) with a lentivirus encoding gRNA and Cas9 and a lentivirus encoding CAR19. Cells were expanded for 8 days. After 8 days, T cells were recovered and DNA was isolated, and the isolated DNA was sequenced to evaluate knockout efficiency. See, for example, FIG. 1 . The knockout efficiency of T cells was 24.1% ( FIG. 2A ), and the CAR transduction efficiency was 73% ( FIG. 2B ).

To investigate the cell effector function of GM-CSF KO CAR-T cells, CART19, GM-CSF KO CART19, UTD or GM-CSF KO UTD were co-cultured with the CD19 positive cell line NALM6 at a ratio of 1:5. After 4 hours, cells were recovered, permeabilized and fixed, and then stained with cytokines ( FIG. 3 ).

To evaluate the proliferation of GM-CSF KO CAR-T cells, the amplification kinetics were followed after transduction into T cells. GM-CSF KO CAR-T cells were more actively amplified compared to cells transduced with CART19 alone ( FIG. 4 ).

These results show that GM-CSF knockout CART can enhance CAR-T cell function and anti-tumor activity. These results also show that blockade of GM-CSF in combination with CART19 does not affect CAR-T cell effector function.

Example 2

GM- during CART therapy CSF Depletion may reduce cytokine release syndrome and neurotoxicity, and enhance CAR-T cell function.

This example investigated the depletion of granulocyte macrophage colony-stimulating factor (GM-CSF) and bone marrow cells as a possible strategy to address CAR-T cell related toxicity. GM-CSF blockade with neutralizing antibodies was found not to inhibit CART function in vitro or in vivo. CAR-T cell proliferation was enhanced in vitro, and CAR-T cells were shown to more effectively control leukemia in patient-derived xenografts after GM-CSF depletion. In addition, in the primary acute lymphoblastic leukemia xenograft model of CRS and NT, GM-CSF blockade showed decreased bone marrow cell loss and decreased brain T cell infiltration, and improved CRS and NT development. Finally, GM-CSF knockout CAR-T cells were constructed through GM-CSF disruption by CRISPR/cas9 upon CAR-T cell manipulation. GM-CSF ^{k /O} CAR-T cells continued to function normally and enhanced in vivo anti-tumor activity. This demonstrates that GM-CSF neutralization can neutralize neurotoxicity and CRS, and can also enhance CAR-T cell function.

Materials and Methods

Cell Lines and Primary Cells

NALM6 and MOLM13 were obtained from ATCC (Manassas, VA, USA), transduced with luciferase-ZsGreen lentivirus (addgene), and sorted at 100% purity. Cell lines were cultured in R10 (RPMI, 10% FCS v/v, 1% pen strep v/v). Primary cells were obtained from patients with acute leukemia at the Mayo Clinic Biobank according to protocols approved by the Bioethics Committee. The use of recombinant DNA in the laboratory has been approved by the International Biosafety Committee (IBC).

Primary T cells and CAR-T cells

Peripheral blood mononuclear cells (PBMC) were isolated from non-identified donor blood apheresis cones using the Ficoll protocol (see, eg, Dietz et al., 2006 Transfusion 46:2083-2089, which is incorporated herein by reference in its entirety). included in). T cells were isolated using negative selection magnetic beads (Stemcell technologies), and monocytes were positively selected using CD14+ magnetic beads (Stemcell technologies). Primary cells were cultured in X-Vivo 15 medium supplemented with 5% human serum, penicillin, streptomycin and glutamax. As described below, CD19-specific CAR-T cells were constructed by transduction of lentivirus into normal donor T cells. A second-generation CAR19 construct was newly synthesized (IDT) and cloned into a third-generation lentivirus under the control of the EF-la promoter. The CD19 specific single chain variable fragment was obtained from clone FMC63. A second generation 41BB co-stimulated (FMC63-41BBz) CAR construct was synthesized and used in these experiments. 293T virus producing cells were transiently transfected with the plasmid in the presence of Lipofectamine 3000, VSV-G and packing plasmid to generate lentiviral particles. T cells isolated from normal donors were stimulated at a 1:3 ratio with CD3/CD28 stimulation beads (StemCell) and then transduced with lentiviral particles at a multiplicity of infection of 3.0 24 hours after stimulation. On day 6, magnetic beads were removed, CAR-T cells were harvested, and on day 8, cryopreserved for future experiments. CAR-T cells were thawed prior to use in experiments and recovered in T cell medium for 12 hours.

GM- CSF ^{k /o} CAR-T cell construction:

Guide RNA (gRNA) targeting exon 3 of human GM-CSF was selected through gRNA screening previously reported to have high efficiency for human GM-CSF. This gRNA was ordered as a CAS9 third generation lentiviral construct (lentiCRISPRv2) controlled under the U6 promoter (GenScript, Township, NJ, USA). Lentiviral particles encoding this construct were prepared as described above. After stimulation of T cells with CD3/CD28 beads, T cells were double transduced with CAR19 and GM-CSFgRNA-lentiCRISPRv2 lentivirus 24 hours later. Then, CAR-T cell amplification was performed as above. To analyze GM-CSF targeting efficiency, genomic DNA was extracted from GM-CSFk/o CART19 cells using the PureLink Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, USA). The target DNA was amplified by PCR using Choice Taq Blue Mastermix (Thomas Scientific, Minneapolis, MN, USA) and gel extracted using the QIAquick gel extraction kit (Qiagen, Germantown, MD, USA) to confirm editing. PCR amplification products were subjected to Eurofins sequencing (Louisville, KY, USA), and allele modification frequencies were calculated using TIDE (Tracking of Indels by Decomposition) software available at tide.nki.nl. 15 depicts the scheme, primer sequence and gRNA sequence for constructing the GM-CSFk/o CART 19 construct.

GM- CSF neutralizing antibodies and Lee So-hyung control

Renzilumab (Humanigen, Brisbane, CA) is a humanized antibody that neutralizes human GM-CSF as described in US Pat. Nos. 8,168,183 and 9,017, 674, each of which is incorporated herein by reference in its entirety. 10 μg/mL of lenzilumab or isotype control was used in in vitro experiments. In the in vivo experiment, 10 mg/kg of lenzilumab or isotype control was injected, and the schedule, route and frequency are indicated in each experimental design. In some experiments, anti-mouse GM-CSF neutralizing antibody (10 mg/kg) was also used as indicated in the experimental design.

T cell function experiment

Cytokine analysis was performed 24 hours and 72 hours after CAR-T cells were co-cultured with the target in a 1:1 ratio as indicated. Human GM-CSF singleplex (Millipore), 30-plex human multiplex (Millipore) or 30-plex mouse multiplex (Millipore) were performed on supernatants collected from these experiments as indicated. This was analyzed using flow cytometry beads or Luminex, and CAR-T cells and targets were incubated in a ratio of 1:5 at 37°C for 4 hours under monensin, hCD49d and hCD28, followed by intracellular cytokine analysis and T cells. Degranulation analysis was performed. After 4 hours, the cells were recovered and stained on the cell surface, and then intracellular staining was performed by fixation and permeabilization (FIX & PERM Cell Fixation & Cell Permeabilization Kit, Life Technologies). To assay proliferation, CFSE (Life Technologies) labeled effector cells (CART19) and irradiated target cells were co-cultured at a 1:1 ratio. In some experiments, CD14+ monocytes were added to the co-cultures in a 1:1:1 ratio as indicated. Cells were co-cultured for 3-5 days as indicated in specific experiments, then cells were harvested and surface stained with anti-hCD3 and live/dead aqua. In certain experiments, different concentrations of PMA/ionomycin were used as positive non-specific stimulators of T cells as indicated. In the killing assay, CD19+ luciferase+ALL cell line NALM6 or CD19 ^- luciferase ⁺ control MOLM13 cells were co-incubated with effector T cells at the indicated ratios for 24 or 48 hours as listed in specific experiments. Death was calculated by taking bioluminescence images on a Xenogen IVIS-200 spectral camera (PerkinElmer, Hopkinton, MA, USA) as a measure of remaining viable cells. 10 minutes before imaging, samples were treated with D-luciferin (30 μg/mL) at 1 μl per 100 μl sample volume.

multi-parameter flow cell measurement

Anti-human antibodies were purchased from Biolegend, eBioscience or BD Biosciences. Cells were isolated (after ACK cell lysis) from either in vitro cultures or animal peripheral blood, rinsed twice in phosphate-buffered saline supplemented with 2% fetal bovine serum and stained at 4°C. To measure the cell number, Countbright beads (Invitrogen) were used according to the manufacturer's instructions (Invitrogen). In the full analysis, subject populations were gated based on forward scattering versus side scattering characteristics followed by singlet gating, and live cells were gated using Live Dead Aqua (Invitrogen). Surface expression of CAR was detected by staining with goat anti-mouse F(ab')2 antibody. Flow cytometry was performed on a 4-laser Canto II analyzer (BD Biosciences). All analyzes were performed using a FlowJo X10.0.7r2.

Heterogeneous mouse model

Male and female NOD-SCID-IL2ry-/- (NSG) mice aged 8-12 weeks were bred and managed in the Department of Comparative Medicine of the Mayo Clinic according to breeding protocols approved by the Animal Care and Use Committee (IACUC). Mice were maintained in an animal barrier space approved by the Biosafety Committee for BSL2+ level experiments.

NALM6 cell line xenograft

ALL xenografts were established using the CD19+ luciferase+ ALL NALM6 cell line. These xenograft experiments were approved by several IACAC protocols. Accordingly, 1x10 ⁶ weeks of cells were injected intravenously via tail vein injection. Animals were bioluminescent images taken with a Xenogen IVIS-200 spectral camera on day 6 after injection to verify engraftment. D Luciferin (15 mg/ml) was injected intraperitoneally at 10 μl/g, and then images were taken. Mice were then randomly classified based on bioluminescence images and subjected to various treatments as outlined in specific experiments. ^{Typically, 1-2 x 10 6} weeks of CAR-T cells or UTD cells were injected, and the actual dose was described in the specific experimental description. Weekly pictures were taken to analyze and track disease burden. CAR-T cells were injected and blood drawn via tail vein on days 7-10, analyzed for T cell expansion and followed as needed. Mouse peripheral blood was lysed with ACK lysis buffer (Thermofisher) and then used for flow cytometry experiments. Bioluminescence images were acquired with a Xenogen IVIS-200 spectral camera (PerkinElmer, Hopkinton, MA, USA) and analyzed with Living Image version 4.4 (Caliper LifeSciences, PerkinElmer). For antibody-treated mice, antibody therapy (10 mg/kg lenzilumab or isotype control) was initiated IP for a total of 10 days.

ALL xenografts from primary patients

To establish primary ALL xenografts, NSG mice were first administered IP with 30 mg/kg busulfan. The next day, mice were injected with ^{2x10 6} weeks of primary blast cells derived from the peripheral blood of patients with relapsed incurable ALL. Engraftment was monitored in mice for 4-6 weeks, and if CD19+ cells were observed at a constant level (>1 cell/μl) in the blood, they were randomized and treated for a total of 10 days, starting from the day of administration of CAR-T cell therapy. ^{Multiple CART19 or UTD (cell 1×10 6} weeks) treatments were performed with or without antibody therapy (10 mg/kg lenzilumab or isotype control IP). Mice were periodically monitored for leukemia burden through tail vein bleeds.

Primary patient-derived ALL xenografts for CRS/NT

As in the above experiments, mice were injected with 30 mg/kg of busulfan by IP. The next day, mice were injected with ^{1-2x10 6} weeks of primary blast cells derived from peripheral blood of patients with relapsed incurable ALL. Engraftment was monitored in mice for 4-6 weeks, and if high levels of CD19+ cells were observed in the blood (≥10 cells/μL), mice were ^{administered CART19 (cells 2-5×10 6} weeks), detailed in individual experiments. As described above, antibody therapy was initiated for a total of 10 days. Mice were weighed daily as a measure of well-being. MRI of mice was taken 5-6 days after CART injection, and blood was collected through tail vein on 4-11 days after CART injection. Brain MRI images were analyzed with Azalyze.

MRI acquisition

Images were acquired to assess central nervous system (CNS) vascular permeability using a Bruker Avance II 7 Tesla vertical bore small animal MRI system (Bruker Biospin). Inhalation anesthesia was induced and maintained with 3-4% isoflurane. Respiratory rate was monitored during the acquisition period using an MRI compatible vital sign monitoring system (Model 1030; SA Instruments, Stony Brook, NY). Mice were injected IP with gadolinium at a dose of 100 mg/kg according to body weight, followed by a standard delay of 15 minutes, followed by volume acquisition T1-weighted spin echo sequence (repetition time = 150 ms, echo time = 8 ms, region of interest: 32 mm x 19.2 mm x 19.2 mm, matrix: 160 x 96 x 96; average number of times = 1), T1-weighted pictures were obtained. Gadolinium-enhanced MRI changes imply blood-brain-barrier disruption. Volumetric analysis was performed using analysis software developed by the Biomedical Imaging Resource of the Mayo Clinic.

RNA-to mouse brain tissue Seq

RNA was isolated using the miRNeasy micro kit (Qiagen, Gaithersburg, MD, USA) and treated with an RNase-Free DNase Set (Qiagen, Gaithersburg, MD, USA). RNA-seq was performed with an Illumina HTSeq 4000 (Illumina, San Diego, CA, USA) at the Mayo Clinic's Genome Analysis Core. Binary base call data was converted to fastq using Illumina bcl2fastq software. Adapter sequences were removed using Trimmomatic and qualitatively checked with FastQC. The latest human (GRCh38) and mouse (GRCm38) reference genomes were downloaded from NCBI. A genomic index file was generated using STAR, and paired end reads were mapped to the genome in each condition. Expression values for each gene were calculated using HTSeq3 l, and differential expression was calculated using DeSeq2. Genomic ontology was analyzed using Enrichr. 16 summarizes the steps described above. RNA sequencing data is available from the Gene Expression Omnibus under accession number GSE121591.

statistics

Data were analyzed using Prism Graph Pad and Microsoft Excel. High cytokine concentrations were normalized to “1” and low concentrations were normalized to “0” in the heat map using Prism. Statistical tests are described in the figure description.

result

in vitro GM- CSF Neutralization of monocytes in existence Enhances CAR-T cell proliferation and does not impair CAR-T cell effector function.

If GM-CSF neutralization after CAR-T cell therapy is to be used as a strategy to prevent CRS and NT, CAR-T cells should not be inhibited. Therefore, in the initial experiment of the present invention, the effect of GM-CSF neutralizing on CAR-T cell effector function was investigated. Accordingly, CART19 cells were co-cultured in the presence of lenzilumab (GM-CSF neutralizing antibody) or isotype control (IgG) with or without the addition of CD19+ALL cell line NALM6. It was confirmed that lenzilumab was able to completely neutralize the actual GM-CSF whereas the IgG control antibody did not ( FIG. 6A ) and did not inhibit CAR-T cell antigen-specific proliferation ( FIG. 6B ). When CART19 cells were co-cultured with the CD19+ cell line NALM6 in the presence of monocytes, lenzilumab in combination with CART19 exponentially increased antigen-specific CART19 proliferation compared to CART19 + isotype control IgG (P<0.0001, Figure 6C). ). To investigate CAR-T specific cytotoxicity, CART19 or control UTD T cells were incubated with luciferase+CD19+NALM6 cell lines and treated with isotype control antibody or GM-CSF neutralizing antibody ( FIG. 1D ). NALM6 target cell killing ability of CAR-T cells was not inhibited upon treatment with GM-CSF neutralizing antibody ( FIG. 6D ). In summary, these results show that lenzilumab does not inhibit CAR-T cell function in vitro and enhances CART19 cell proliferation in the presence of monocytes, suggesting that GM-CSF neutralization can ameliorate CAR-T cell-mediated effects. it suggests

in vivo GM- CSF Neutralization potentiates anti-tumor activity of CAR-T cells in xenograft models.

To verify that GM-CSF depletion does not inhibit CART19 effector function, the neutralizing effect of GM-CSF on CART19 anti-tumor activity in a xenograft model was investigated using lenzilumab. First, we used a relapse model designed to clearly investigate whether the anti-tumor activity of CART19 cells is affected by GM-CSF neutralization. ^{NSG mice were injected with 1x10 6} weeks of luciferase+NALM6 cells and pictures were taken 6 days later, allowing sufficient time for the mice to reach a very high tumor burden. Mice were randomized and injected with one injection of CART19 or UTD cells, followed by an injection of isotype control antibody or lenzilumab for 10 days ( FIG. 7A ). GM-CSF analysis of sera collected 8 days after CART19 injection revealed that lenzilumab successfully neutralized GM-CSF in CART19 therapy ( FIG. 7B ). In bioluminescence photographs at one week after CART19 injection, it was confirmed that CART19 effectively controlled leukemia in a relapse model with high tumor burden in combination with lenzilumab and was more significant compared to control UTD cells ( FIG. 7C ). Treatment of CART19, in combination with lenzilumab, exerted potent anti-tumor activity, similar to CART19 and the control antibody, despite neutralizing GM-CSF levels, and was shown to improve overall survival, which This means that CSF does not impair CAR-T cell activity in vivo ( FIG. 8 ). Second, these experiments were performed in the presence of human PBMC in a more relevant xenograft model, a primary ALL patient-derived xenograft model. After conditioning mice with busulfan chemotherapy, engraftment was monitored by serial bleeds via tail vein for several weeks, and when blood CD19+ blast cells reached ≥ 1 μl, mice were randomly assigned to combine CART19 or UTD treatment with PBMCs. and administered together with lenzilumab + anti-mouse GM-CSF neutralizing antibody or isotype control IgG antibody, starting on the day of CART19 injection for a total of 10 days ( FIG. 7D ). In this primary ALL xenograft model, GM-CSF neutralization, in combination with CART19 therapy, showed significant improvement in controlling leukemia disease compared to CART19 + isotype controls for longer than 35 days after CART19 administration ( FIG. 7E ). This suggests that GM-CSF neutralization may play a role in reducing relapse and enhancing sustained complete response after CART19 cell therapy.

GM- CSF CRISPR knockout CAR-T cells reduce the expression of GM-CSF as well as the levels of key cytokines and potentiate anti-tumor activity.

To definitively rule out any role of important GM-CSF in CAR-T cells, the GM-CSF gene was disrupted using gRNA, which has been reported to be highly efficient in CAR-T cell construction and cloned into the CRISPR lentiviral backbone. With this gRNA, a knockout efficiency of about 60% was achieved in CART19 cells ( FIG. 9 ). When CAR-T cells were stimulated with the CD19+ cell line NALM6, GM-CSF ^{k /o} CAR-T cells were statistically significant for GM-CSF compared to CART19 with the wild-type GM-CSF locus (“wild-type CART19 cells”). produced very little. Upon GM-CSF knockout in CAR-T cells, production of other key T cell cytokines such as IFN-γ, IL-2 or CAR-T cell antigen-specific degranulation (CD107a) was not impaired ( FIG. 10A ). , the expression of GM-CSF was reduced ( FIG. 10B ). To validate whether GM-CSF ^{k /o} CAR-T cells continue to function normally, in vivo efficiency was investigated in a recurrent ALL xenograft model with high tumor burden (as described in FIG. 7A ). In this xenograft model, when GM-CSF ^{k /o} CART19 was used instead of wild-type CART19, the serum level of human GM-CSF was significantly reduced 7 days after CART19 treatment ( FIG. 10B ). Bioluminescence image data suggest that GM-CSF ^{k /o} CART19 cells exhibit enhanced leukemia control compared to CART19 in this model ( FIG. 11 ). Importantly, GM-CSF ^{k /o} CART19 cells significantly improved overall viability compared to wild-type CART19 cells ( FIG. 10C ). Except for GM-CSF, no statistically significant changes were detected in human ( FIG. 10D ) or control ( FIG. 10E ) cytokines. In summary, these results validated the results of Figures 6 and 7 and show that GM-CSF depletion does not impair cytokines important for CAR-T efficacious function. In addition, the results of FIG. 10 suggest that GM-CSFk/o CART may be a therapeutic option for "built-in" the GM-CSF control as a modification in CAR-T preparation.

Patient-derived xenograft model for neurotoxicity and cytokine release syndrome

In this model, conditioned NSG mice were engrafted with primary ALL blasts and monitored for several weeks until disease burden reached high levels ( FIG. 12A ). When CD19+ blast levels in peripheral blood reached ≧10/μL, mice were randomly assigned to receive various treatments as indicated ( FIG. 12A ). Upon CART19 treatment (in combination with control IgG antibody or GM-CSF neutralizing antibody), the disease resolved successfully ( FIG. 12B ). Within 4-6 days after CART19 treatment, ataxia, crooked body and gradual weight loss in mice; Symptoms corresponding to CRS and NT began to appear. This was associated with elevations of major cytokines in serum at 4-11 days post CART10 injection (human GM-CSF, TNF-a, IFN-y, IL), as observed in human CRS following CAR-T cell therapy. -10, IL-12, IL-13, IL-2, IL-3, IP-10, MDC, MCP-1, MIP-la, MIP-1, and mouse IL-6, GM-CSF, IL-4 , IL-9, IP-10, MCP-1 and MIG). In these CART19-treated mice, also brain MRI analysis ( FIG. 12D ) where abnormal T1 enrichment was observed, indicative of brain-barrier disruption and potentially brain edema, and flow cytometry of the brain where infiltration of human CART19 cells was observed. As confirmed in the analysis ( FIG. 12E ), NTs occurred. In addition, as a result of RNA-seq analysis of brain fragments recovered from mice exhibiting these NT signs, genes regulating T cell receptor, cytokine receptor, T cell immune activation, T cell migration, and differentiation of T cells and bone marrow cells were identified. Significant upregulation was confirmed ( Table 1 ).

Table 1. Modified standard pathways in the brain obtained from a patient-derived xenograft model after CART19 cell treatment.

standard path Adjusted P-Value gene Modulation of immune response (G0:0050776) 9.45E-14 IFITM1, ITGB2, TRAC, ICAM3, CD3G, PTPN22, CD3E, ITGAL, SAMHD1, SLA2, CD3D, ITGB7, SLAMF6, B2M, NPDC1, CD96, BTN3A1, ITGA4, SH2D1A, HLA-B, HLA-C, BTN3A2, HLATN3A2 A, CD8B, SELL, CD8A, CD226, CD247, CLEC2D, HCST, B1RC3 Cytokine-mediated signaling pathway (G0:0019221) 1.36E-12 IFITM1, SP100, TRADD, ITGB2, IL2RG, SAMHD1, IL27RA, OASL, CNN2, IL18RAP, RIPK1, CCR5, IL12RB1, B2M, GBP1, IL6R, JAK3, CCR2, IL32, ANXA1, IL4R, TGFB1, IL10RB, IL10RA, IL10RB, PRKCD, HLA-B, HLA-C, IL16, HLA-A, TNFRSF1B, CD4, IRF3, OAS2, IL2RB, FAS, TNFRSF25, LCP1, P4HB, IL7R, MAP3K14, CD44, IL18R1, IRF9, MYD88, B1RC3 T cell receptor complex (G0:0042101) 1.30E-11 ZAP70, CD4, CD6, CD8B, CD8A, CD3G, CD247, CD3E, CD3D, CARD11 T cell activation (G0:0042110) 2.07E-11 ITK, RHOH, CD3G, NLRC3, PTPN22, CD3E, SLA2, CD3D, CO2, ZAP70, CD4, PTPRC, CD8B, CD8A, LCK, CD28, LCP1, LAT Regulation of T cell activation (G0:0050863) 2.46E-10 PTPN22, LAX1, CCDC88B, CD2, CD4, LCK, SIT1, TBX21, TIGIT, JAK3, LAT, PAG1, CCR2 T cell receptor signaling pathway (G0:0050852) 4.35E-08 ITK, BTN3A1, TRAC, WAS, CD3G, PTPN22, BTN3A2, CD3E, CD3D, ZAP70, CD4, PTPRC, LCK, GRAP2, LCP2, CD247, CARD11, LAT, PAG1 Positive regulation of cytokine processes ( G0:0001819 ) 1.57502E-
07 GBP5, ANXA1, TGFB1, CYBA, PTPN22, PARK7, TMEM173, CCDC88B, MAVS, CD6, IRF3, CD28, RIPK1, SLAMF6, CD46, IL12RB1, TIGIT, IL6R, CARD11, MYD88, CCR2 T cell differentiation ( G0:0030217 ) 2.36E-07 ZAP70, CD4, ANXA1, PTPRC, CD8A, LCK, CD28, RHOH, PTPN22, CD3D Cytokine receptor activity (G0:0004896) 2.43E-07 IL4R, IL10RB, IL10RA, IL2RG, CD4, CXCR3, IL2RB, CCR5, IL12RB1, IL7R, IL6R, CD44, CCR2 Type I interferon signaling pathway (G0:0060337) 3.27E-07 IFITM1, SP100, IRF3, OAS2, STAT2, HLA-B, HLA-C, HLA-A, SAMHD1, IRF9, MYD88, OASL response to cytokines (G0:0034097) 0.0004679 SIGIRR, IFITM1, SP100, HCLS1, RIPK1, PTPN7, IKBKE, IL6R, JAK3, IL18R1, MYD88, AES Modulated innate immune response (G0:0045088) 0.001452 GBP5, GFI1, STAT2, ADAM8, NLRC3, PTPN22, SAMHD1, B1RC3 regulation of the tumor necrosis factor process ( G0:0032680 ) 0.003843 CD2, MAVS, CYBA, NLRC3, PTPN22, RIPK1, SLAMF1 T cell receptor binding (G0:0042608) 0.0102397 LCK, CD3G, CD3E Regulation of tumor necrosis factor-mediated signaling pathway (G0:0010803) 0.0124059 SHARPIN, TRADD, CASP4, RIPK1, TRAF1, B1RC3 Positive regulation of myeloid leukocyte differentiation ( G0:0002763 ) 0.0376647 CD4, HCLS1, RIPK1, EV12B

in vivo GM- CSF Neutralization in the xenograft model CART19 Improves cytokine release syndrome and neurotoxicity after therapy.

Using the xenograft patient-derived model for NT and CRS shown in FIG. 4A , the neutralizing effect of GM-CSF on CART19 toxicity was investigated. To rule out effects by mouse GM-CSF, mice were treated with GM-CSF antibody therapy (10 mg/kg lenzilumab and 10 mg/kg anti-mouse GM-CSF neutralizing antibody) or an isotype control antibody for 10 days. In combination with administration, CART19 cells were administered. GM-CSF neutralizing antibody therapy prevented weight loss due to CRS after CART19 therapy ( FIG. 13A ). As a result of cytokine analysis on day 11 after CART19 cell therapy, human GM-CSF was neutralized by the antibody ( FIG. 13B ). In addition, GM-CSF neutralization resulted in several human (IP-10, IL-3, IL-2, IL-1Ra, IL-12p40, VEGF, GM-CSF) ( FIG. 5C ) and mice (MIG, MCP-1, KC, IP-10) ( FIG. 13D ) cytokines were significantly reduced. Interferon γ-inducing protein (IP-10, CXCL10) was produced by monocytes, among other cell types, which acted as a chemoattractant in a number of cell types including monocytes, macrophages and T cells. IL-3 plays a role in myeloid progenitor cell differentiation. IL-2 is a major T cell cytokine. Interleukin-1 receptor antagonists (IL-1Ra) inhibit IL-1. (IL-1 is produced by macrophages and belongs to the family of major inflammatory cytokines). IL-12p40, a subtype of IL-12 produced by macrophages, among other cell types, can promote Th1 differentiation. Vascular endothelial growth factor (VEGF) promotes blood vessel formation. Monokines (MIG, CXCL9) induced by γ-interferon are T-cell chemotactic factors. Monocyte chemoattractant protein 1 (MCP-1, CCL2) attracts monocytes, T cells and dendritic cells. KC (CXCL1) is produced by macrophages, among other cell types, and attracts myeloid cells such as neutrophils. A tendency to decrease human and mouse cytokine dropsy was observed after GM-CSF neutralization. This suggests that GM-CSF acts on the downstream activity of several major cytokines in the cascade leading to CRS and NT.

Brain MRI at day 5 post CAR19 treatment confirmed that GM-CSF neutralization reduced T1 enrichment, compared to CART19 + control antibody, in brain inflammation, blood-brain barrier disruption and potentially edema. MRI images after GM-CSF neutralization (using lenzilumab and anti-mouse GM-CSF antibody) were comparable to baseline scans before treatment, suggesting that GM-CSF neutralization is effectively useful in clearing NT associated with CART19 therapy. ( FIGS. 14A and 14B ). Using human ALL blasts and human CART19 in a patient-derived xenograft model, CART19 followed by GM-CSF neutralization reduced neuro-inflammation by 59%, compared to CART19 + isotype control ( FIG. 14B ). This is a significant finding and demonstrates for the first time in vivo that CART19-induced NT can be effectively neutralized. As a result of flow cytometry analysis, human CD3 T cells were present in the brain after CART19 therapy, but a tendency to decrease upon GM-CSF neutralization was observed ( FIG. 14C ). Finally, a trend to decrease CD11b+ bright macrophages in the brains of GM-CSF-neutralized mice treated with CAR-T cells compared to isotype controls was observed during CAR-T therapy ( FIG. 14D ), indicating that GM-CSF neutralization helps reduce macrophages in the brain.

Example 3-A

CART19 GM- in cells CSF Gene KO (GM- CSF ^{k /o} CART19 ) and CAR19 Combination therapy with T-derived GM-CSF hGM-CSF neutralizing antibody (lenzilumab)

Renzilumab (eg, 10 mg/kg or up to 30 mg/kg or 1,800 mg fixed dose) was administered to subjects in combination with ^{GM-CSF k/o CART19 cells.} GM-CSF ^{k /o} CAR-T cells contribute to controlling GM-CSF release upon contact/binding of CAR-T cells to tumor cells. When the release of GM-CSF from the tumor site was decreased, activation and migration of inflammatory myeloid cells was decreased, and when measured systemically, MCP-1, IL-6, IP10, KC, MIP-1a, MIP-1b, MIG, VEGF, A decrease in IL-1RA and IL-12p40 levels was confirmed. Reducing cytokine levels prevents or reduces the incidence and severity of CRS and NT. Addition of lenzilumab aids in depletion of MDSCs from the tumor microenvironment by neutralizing GM-CSF from all sources. Renzilumab administration was repeated every 2 weeks to continuously deplete MDSCs. Combination of GM-CSF ^{k /o} CAR-T cells with lenzilumab resulted in improved response rate, improved progression-free survival and improved overall survival in patients treated with combination therapy compared to controls. In addition, the combination therapy reduced (or eliminated) the degree of toxicity associated with CAR-T cell therapies such as CRS and NT.

Example 3-B

CART19 GM- in cells CSF Gene KO (GM- CSF ^{k /o} CART19 ) and CAR19 T-derived GM- CSF Combination therapy with hGM-CSF neutralizing antibody (lenzilumab)

Renzilumab (/600-1800 mg) was administered to subjects in combination with ^{GM-CSF k /o CART19 cells.}

Non-Hodgkin's lymphoma cancer patients were pre-conditioned prior to therapy. The patient was administered an anti-hGM-CSF antibody (600-1800 mg) IV followed by 2x10 ⁶ weeks of ^{transduced autologous CD19CAR-T cells (GM-CSF KO ).} Efficacy, eg safety, blood chemistry, neurological examination, disease status, was assessed at specific time points after treatment. Treatment was repeated monthly until no more cancer was detected or no significant decrease in cancer burden was observed.

Example 4

Recombinant anti- hGM - CSF antibody, Renzilumap is Bone marrow cell infiltration in the CNS reduce

CD14+ cells account for a higher proportion of the CNS cell population in human patients with stage 3 or higher neurotoxicity, as shown in FIG . 17A . When a recombinant anti-hGM-CSF antibody that binds and neutralizes human GM-CSF (lenzilumab) was administered to mice treated with CART10 therapy, compared to mice treated with CART19 only and untreated mice, as shown in FIG . 17B , Likewise, a decrease in CNS infiltration by CD14+ cells and CD11b+ cells was confirmed. The primary ALL mouse model was used in NT experiments as described below.

Primary Patient-derived ALL Xenograft Model for CRS/NT

As in the above experiment, mice were IP-injected with busulfan at 30 mg/kg. ^{The next day, 1-2x10 6} weeks of primary blast cells derived from peripheral blood of patients with relapsed refractory ALL were injected. Engraftment was monitored in mice for 4-6 weeks (as described in Example 2 ), and when CD19+ cells reached high levels (≧10/μL), 2-5×10 ⁶ weeks of CART19 cells were administered, and Antibody therapy was initiated for a total of 10 days as described in the text. Mice were weighed daily as a measure of well-being. Brain MRI of mice was taken 5-6 days after CART injection, and blood was collected through tail vein on 4-11 days after CART injection. Brain MRI images were analyzed with Azalyze.

Example 5

GM- in T cells CSF genes knocking out gene editing techniques

Several strategies are being investigated by various groups to incorporate gene editing techniques in developing next-generation chimeric antigen receptor (CAR) T cells to treat a variety of cancers. Severe toxicity (cytokine release syndrome and neurotoxicity) is associated with CAR T cell therapy and the patient's course may be poor. The main initiator in the toxic process appears to be GM-CSF from CAR-T cells.

Gene-editing (eg, using engineered nucleases) can be used to KO the GM-CSF gene and/or the gene/coding protein essential for GM-CSF gene expression in T cells. Nucleases available for such genome editing include, but are not limited to, CRISPR-attached (Cas) nucleases, zinc-finger nucleases (ZFNs), transcriptional activator-like effector (TALE) nucleases and homing endonuclease (HE) (also known as meganuclease).

GM- to CSF about zinc - finger Use of nucleases

In CAR-T cells, the GM-CSF gene can be inactivated using zinc finger nuclease (ZFN) technology. DNA sequence-specific nucleases cleave the GM-CSF gene, resulting in gene inactivation in DNA double-strand break repair. Sequence-specific nucleases are constructed by combining sequence-specific DNA binding domains (zinc fingers) with Fok1 endonuclease domains. Targeted nucleases act as dimers and employ two different DNA recognition domains to provide site-specific cleavage. Manipulation of Fok 1 endonuclease results in heterodimers rather than homodimers. That is, the obligate heterodimeric Fok1-EL variant provides a higher level of specificity.

Clinical experience to date on genetic KO approaches using ZFN technology is limited. However, in a small safety trial using ZFN technology to knock out the CCR5 receptor and reintroduce T cells into HIV patients, modified T cells, when anti-retroviral drug therapy was discontinued, compared to unmodified cases. , showed a significant survival advantage.

The best effect was observed when double allele disruption was achieved. This suggests that the KO technique with the highest gene disruption rate is likely to be the most effective (Singh 2017, Tebas 2014). In some human cell types, biallelic targeting efficiency is increased by RAD51 compared to expression and valproic acid treatment (Takayama 2017).

Exons 1-4 of the human GM-CSF gene can be targeted with ZFNs that form a pair within a selected target region. A potential advantage of targeting close to the translation initiation codon in a DNA sequence is that gene knockout prevents synthesis of large fragments of the protein that are still being synthesized. Such protein fragments may have unwanted biological activity.

A variety of tools are available to identify potential zinc finger nuclease (ZFN) sites in specific target sequences. Examples of these tools can be found at http://bindr.gdcb.iastate.edu/ZiFiT/. Vectors (used for GM-CSF gene KO) for expressing the ZFN pairs identified in this way were investigated in human cells expressing GM-CSF, and the gene disruptive effect for each pair was examined in the cell pool. Measured by changes in CSF production. ZFN pairs that exhibit a maximal reduction in GM-CSF levels are selected for investigation in human CAR-T cells.

For example, autologous T-cells can be transduced ex vivo with a replication-defective recombinant Ad5 viral vector encoding a GM-CSF-specific ZFN pair to induce modifications in the GM-CSF gene. A vector supports only transient expression of the gene encoded by the vector. The two ZFNs bind to a complex bp sequence found specifically in the selection region (within exons 1,2, 3 or 4) for mutagenesis of the GM-CSF gene. Expression of GM-CSF-specific ZFNs induces double-strand breaks in cellular DNA, which are repaired by cellular mechanisms, resulting in random sequence insertions or deletions in transduced cells. These insertions and deletions disrupt the GM-CSF coding sequence, resulting in frame shift mutations and termination of protein expression.

T cell preparation/patient-specific samples

Leukocyte apheresis was performed in 10 L of study subjects to collect >10 ⁹ leukocytes. The leukocyte apheresis product depleted monocytes via counterflow centrifugal elutriation and magnetically depleted CD8+ T-cells to enrich for CD4+ cells, both of these methods using a disposable closure system set. do. The resulting enriched CD4+ T-cells were activated with anti-CD3/anti-CD28 mAb coated paramagnetic beads and transduced with a vector encoding CAR T and a vector encoding ZFN. The cells were then expanded and cultured in a closed system. For further amplification under perfusion conditions, T-cells were transferred to the WAVE bioreactor and continued to be amplified. At the end of the incubation period, cells were depleted with magnetic beads, washed, concentrated and cryopreserved.

In addition, primary T cells can be treated with other substances, such as valproic acid, to increase the biallelic targeting efficiency of ZFNs.

putative target sequence

exon 1

ATG TGG CTG CAG AGC CTG CTG CTC TCG GGC

TAC ACC GAC GTC TCG GAC GAC GAG AGC CCG

CTC GCC CAG CCC CAG CAC GCA GCC

GAG CGG GTC GGG GTC GTG CGT CGG

exon 2

AAT GAA ACA GTA GAA GTC ATC TCA GAA ATG

TTA CTT TGT CAT CTT CAG TAG AGT CTT TAC

GAA GTC ATC TCA GAA ATG TTT GAC

CTT CAG TAG AGT CTT TAC AAA CTG

design exon 3

GAG CCG A CC TGC CTA CAG ACC CGC CTG GAG

CTC GGC TGG ACG GAT GTC TGG GCG GAC CTC

GCC TAC AGA CCCGCCT GGA GCT GTA

CGG ATG TCT GGGCGGA CCT CGA CAT

exon 4

GAA ACT TCC TGT GCA ACC CAG ATT ATC ACC

CTT TGA AGG ACA CGT TGG GTC TAA TAG TGG

TGC AAC CCA GAT TATC ACC TTT GAA

ACG TTG GGT CTA ATAG TGG AAA CTT

TALEN

In T cells, the GM-CSF gene can be inactivated using activator-like effector nucleases (TALENS). TALENs are similar to ZFNs in that they contain a Fok1 nuclease domain fused to a sequence specific DNA binding domain. The targeted nuclease then forms a double-stranded break in the DNA, and error-prone repair produces a mutated target gene. TALENs can be easily designed using a simple protein-DNA code that uses DNA binding TALE (transcriptional activator-like effector) repeat domains for individual bases of the binding site. The robustness of TALEN means that genome editing is a reliable and facile process (Reyon D., et al., 2012 Nat Biotechnol. 2012 May;30(5):460-5. doi: 10.1038/nbt.2170, this The document is incorporated herein by reference in its entirety).

For example, some TALE target sequences within exon 1 of the human GM-CSF gene are:

1. TGGCTGCAGAGCCTGCTG CTCTTGGGCACTGTGG CCTGCAGCATCTCTGCA

2. TTGGGCACTGTGGCCCTGC AGCATCTCTGCACCCG CCCGCTCGCCCAGCCCCA

Example of TALE target sequence in exon 4 of human GM-CSF gene:

TGTGCAACCCAGATTATC ACCTTTGAAAGTTTCA AAGAGAACCTGAAGGA

TCCTGTGCAACCCAGATT ATCACCTTTGAAAGTT TCAAAGAGAACCTGAA

3. TTATCACCTTTGAAAG TTTCAAAGAGAACCTGA AGGACTTTCTGCTTGTCA

in primary T cells CRISPR Cas -9 each GM- CSF KO of genes.

CRISPR (clustered regularly interspaced short palindromic repeats), the Cas-9 system, consists of Cas9, RNA-guided nucleases, and short guide RNAs (gRNAs) that readily form site-specific DNA breaks that are repaired by cellular endogenous mechanisms. . Upon delivery of Cas9/gRNA RNPs to primary human T cells, highly efficient target gene modification is achieved. A CRISPR/Cas9 mediated method to knockout the GM-CSF gene is described by a detailed protocol. Oh, SA, Seki, A., & Rutz, S. (2018) Current Protocols in Immunology , 124, e69. doi: 10.1002/cpim.69, and Seki and Rutz, J Exp. Med . 2018 Vol. 215 No. 3 985-997 (each of which is incorporated herein by reference in its entirety).

It has been reported that GM-CSF inactivation by gene KO reduces cytokine release syndrome and neurotoxicity, and improves anti-tumor activity in tumor xenografted CAR T-treated mice (Sterner RM et al., 2018 Blood) 2018:blood-2018-10-881722; doi: https://doi.org/10.1182/blood-2018-10-881722, which is incorporated herein by reference in its entirety).

exon 1 or 2 or 3 or 4 targeting doing CRISPR Inactivation of GM-CSF gene by approach

To ensure effective gene activity in all samples, multiple, eg, three, Cas9 constructs targeting three different sequences in the GM-CSF gene can be used. (This is easily done with CRISPR compared to other gene editing methods).

A high frequency biallelic KO with Cas9 has been published (Zhang, Y., et al. Methods . 2014 September; 69(2): 171-178. doi:10.1016/j.ymeth.2014.05.003, which incorporated herein by reference in its entirety). This high frequency of biallelic KOs offers a potential advantage.

GM- in CAR T cells CSF Other genes for KO silence technique

Other methods available for gene silencing are well known to those skilled in the art and include, but are not limited to, homing endonuclease (HE), RNA interference (RNAi), short interfering RNA (also known as meganuclease) ( siRNA), and DNA-specific RNA interference (ddRNAi).

GM- in CAR T cells CSF Gene KO and non-CAR T-derived GM- to CSF Combination of neutralizing antibodies against

To clear/neutralize all GM-CSF in a patient, anti-GM-CSF antibody, anti-receptor antibody or soluble receptor-Fc fusion should be used in combination with GM-CSF gene KO in CAR-T cells. CAR-T cells administered include, but are not limited to, GM-CSF ^{k /o} CAR-T cells. In one embodiment, the GM-CSF ^k/o CAR-T cell ^{administered is GM-CSF k /o} CART19.

In such combination therapy, an anti-GM-CSF neutralizing antibody such as, but not limited to, lenzilumab is administered. Renzilumab is a novel, high affinity, recombinant human, anti-hGM-CSF neutralizing antibody. In non-human primate studies, this antibody has been demonstrated to be safe upon repeated dosing even at high doses >100 mg/kg/wk for 6 weeks. This antibody is safe even with repeated administration (administered 7 times at 400 mg/dose for 24 weeks to severe asthma patients). This antibody can be used in combination with GM-CSF KO CAR-T cell therapy in cancer patients to provide complete neutralization of human GM-CSF. After IV administration of anti-hGM-CSF antibody (600-1800 mg) to cancer patients, ^{2x10 6 weeks of CAR T cells (GM-CSF KO} ) cells were administered. At specific time points after treatment, effects such as safety, blood chemistry, neurological tests, disease status were investigated. Treatment can be repeated monthly or at 3-month intervals, and disease remission and progression-free survival improvement can be achieved.

In addition, GM-CSF can be neutralized using anti-human GM-CSF receptor α (Rα) antibodies (as described in Minter, RR, et al. 2012 DOI:10.1111/j.1476-5381.2012.02173.x). can Cancer patients are administered IV anti-hGM-CSF receptor antibody (70-700 mg) followed by 2x10 ⁶ weeks of ^{CAR T cells (GM-CSF KO).} At specific time points after treatment, effects such as safety, blood chemistry, neurological tests, disease status are investigated. Improvement in disease remission and progression-free survival is achieved upon treatment. Treatment may be repeated monthly until no cancer is detectable or no significant reduction in cancer burden is observed.

etc implementation

While the present invention has been described with reference to the detailed description, the foregoing description is for illustrative purposes only and does not limit the scope of the invention as defined by the scope of the claims. Other aspects, advantages and modifications are also included within the scope of the appended claims.

<110> HUMANIGEN, INC. MAYO FOUNDATION FOR MEDICAL EDUCATION AND RESEARCH <120> MATERIALS AND METHODS FOR TREATING CANCER <130> P-588784-PC1 <140> PCT/US19/59275 <141> 2019-10-31 <150> 62/753,485 <151> 2018-10-31 <160> 26 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> guideRNA targeting a GM-CSF nucleic acid <400> 1 gacctgccta cagacccgcc 20 <210> 2 <211> 1458 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid encoding a chimeric antigen receptor targeting CD19 (CAR19) <400> 2 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccggacatcc agatgacaca gactacatcc tccctgtctg cctctctggg agacagagtc 120 accatcagtt gcagggcaag tcaggacatt agtaaatatt taaattggta tcagcagaaa 180 ccagatggaa ctgttaaact cctgatctac catacatcaa gattacactc aggagtccca 240 tcaaggttca gtggcagtgg gtctggaaca gattattctc tcaccattag caacctggag 300 caagaagata ttgccactta cttttgccaa cagggtaata cgcttccgta cacgttcgga 360 ggggggacca agctggagat cacaggtggc ggtggctcgg gcggtggtgg gtcgggtggc 420 ggcggatctg aggtgaaact gcaggagtca ggacctggcc tggtggcgcc ctcacagagc 480 ctgtccgtca catgcactgt ctcaggggtc tcattacccg actatggtgt aagctggatt 540 cgccagcctc cacgaaaggg tctggagtgg ctgggagtaa tatggggtag tgaaaccaca 600 tactataatt cagctctcaa atccagactg accatcatca aggacaactc caagagccaa 660 gttttcttaa aaatgaacag tctgcaaact gatgacacag ccatttacta ctgtgccaaa 720 cattattact acggtggtag ctatgctatg gactactggg gccaaggaac ctcagtcacc 780 gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840 cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900 agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960 gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg 1020 tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080 agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140 agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200 ggacgaagag aggagtacga tgttttggac aagagacgtg gccgggaccc tgagatgggg 1260 ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320 atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380 gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440 caggccctgc cccctcgc 1458 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> guideRNA targeting a GM-CSF nucleic acid <400> 3 tcaggagacg ccgggcctcc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> guideRNA targeting a GM-CSF nucleic acid <400> 4 cagcagcagt gtctctactc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> guideRNA targeting a GM-CSF nucleic acid <400> 5 ctcagaaatg tttgacctcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> guideRNA targeting a GM-CSF nucleic acid <400> 6 ggccggtctc actcctggac 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> guideRNA targeting a CSF2 gene nucleic acid <400> 7 gacctgccta cagacccgcc tgg 23 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CSF2 nucleic acid having a deletion caused by a CRISPR/Cas system <400> 8 gacctgccta cagaccgcc 19 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CSF2 nucleic acid having an insertion caused by a CRISPR/Cas system <400> 9 gacctgccta cagaccccgc c 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> guideRNA targeting a GM-CSF nucleic acid <400> 10 gcagtgctgc ttgtagtggc 20 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> guideRNA targeting a CSF2 gene nucleic acid <400> 11 ccgacctgcc tacagacccg cctgga 26 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic primer <400> 12 tgactacaga gaggcacaga 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> synthetic primer <400> 13 tcacctctga cctcattaac c 21 <210> 14 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> human GM-CSF EXON 1 putative ZNF targeting sequence <400> 14 atgtggctgc agagcctgct gctctcgggc ctcgcccagc cccagcacgc agcc 54 <210> 15 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> human GM-CSF EXON 1 complementary strand of putative ZNF targeting sequence <400> 15 tacaccgacg tctcggacga cgagagcccg gagcgggtcg gggtcgtgcg tcgg 54 <210> 16 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> human GM-CSF EXON 2 putative ZNF targeting sequence <400> 16 aatgaaacag tagaagtcat ctcagaaatg gaagtcatct cagaaatgtt tgac 54 <210> 17 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> human GM-CSF EXON 2 complementary strand of putative ZNF targeting sequence <400> 17 ttactttgtc atcttcagta gagtctttac cttcagtaga gtctttacaa actg 54 <210> 18 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> design Exon 3 human GM-CSF <400> 18 gagccgacct gcctacagac ccgcctggag gcctacagac ccgcctggag ctgta 55 <210> 19 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> GM-CSF Exon 3 complementary strand <400> 19 ctcggctgga cggatgtctg ggcggacctc cggatgtctg ggcggacctc gacat 55 <210> 20 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Exon 4 <400> 20 gaaacttcct gtgcaaccca gattatcacc tgcaacccag attatcacct ttgaa 55 <210> 21 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Exon 4 complementary strand <400> 21 ctttgaagga cacgttgggt ctaatagtgg acgttgggtc taatagtgga aactt 55 <210> 22 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> GM-CSF Exon 1 <400> 22 tggctgcaga gcctgctgct cttgggcact gtggcctgca gcatctctgc a 51 <210> 23 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> GM-CSF Exon 1 <400> 23 ttgggcactg tggcctgcag catctctgca cccgcccgct cgcccagccc ca 52 <210> 24 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> GM-CSF Exon 4 <400> 24 tgtgcaaccc agattatcac ctttgaaagt ttcaaagaga acctgaagga 50 <210> 25 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> GM-CSF Exon 4 <400> 25 tcctgtgcaa cccagattat cacctttgaa agtttcaaag agaacctgaa 50 <210> 26 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> GM-CSF Exon 4 <400> 26 ttatcacctt tgaaagtttc aaagagaacc tgaaggactt tctgcttgtc a 51

Claims (38)

A method of enhancing the anti-tumor efficacy of immunotherapy in a subject, comprising:
Comprising administering to the subject CAR-T cells comprising GM-CSF gene inactivation, GM- CSF gene knockdown or gene knockout ( GM-CSF ^{k/o CAR-T cells),}
A method, wherein administration of CAR-T cells lowers or prevents immunotherapy-related toxicity. According to claim 1,
further comprising administering an anti-hGM-CSF antibody to the subject;
The method of claim 1, wherein the anti-hGM-CSF antibody is a recombinant anti-hGM-CSF antibody that binds to and neutralizes human GM-CSF. 3. The method of claim 2,
A method comprising administering to the subject an anti-hGM-CSF antibody. According to claim 1,
(i) GM- CSF gene inactivation, GM- CSF gene knockdown or CAR-T cells, including gene knockout ^{(GM-CSF k / o CAR} -T cell), or (ii) CAR-T cell and anti- administration of the hGM-CSF antibody reduces or prevents CD14+ bone marrow cell migration into the central nervous system (CNS) of the individual;
A method, wherein high levels of CD14+ bone marrow cells in the subject's CNS are indicative of neurotoxicity. 3. The method of claim 2,
The method of claim 1, wherein the objective response rate of the subject administered the anti-hGM-CSF antibody is improved as compared to the subject not administered the anti-hGM-CSF antibody. 6. The method of claim 5,
wherein the objective response rate is a complete response rate or a partial response rate. 4. The method of claim 3,
The method of claim 1, wherein the progression-free response rate and/or survival rate of the subject is improved as compared to a subject not receiving the anti-hGM-CSF antibody. 8. The method of claim 7,
wherein the survival rate is the overall survival rate of the subject. 4. The method of claim 3,
Wherein the -hGM-CSF antibody is administered to GM- CSF gene inactivation, gene knockdown GM- CSF or GM-CSF ^{k / o} before administration, administration object during or after administration of a CAR-T cells, including the CAR-T cells How to become. According to claim 1,
wherein said immunotherapy comprises administration of chimeric antigen receptor-expressing T cells (CAR T-cells). 11. The method of claim 10,
The method of claim 1, wherein the CAR-T cells are CART19 cells. According to claim 1,
wherein said immunotherapy comprises administration of T-cell receptor (TCR) modified T-cells, tumor-infiltrating lymphocytes (TIL), chimeric antigen receptor (CAR)-modified natural killer cells or dendritic cells, or any combination thereof A method comprising adoptive cell transfer selected from According to claim 1,
wherein the immunotherapy comprises administration of a monoclonal antibody, a cytokine, a cancer vaccine, a T cell engaging bispecific antibody, or any combination thereof. According to claim 1,
The method of claim 1, wherein the subject has cancer. 15. The method of claim 14,
wherein the cancer is lymphoma or leukemia. 16. The method of claim 15,
The method of claim 1, wherein the lymphoma is diffuse large B-cell lymphoma (DLBCL). 16. The method of claim 15,
wherein the leukemia is acute lymphoblastic leukemia (ALL). Treated with, immunotherapy comprising administering an object CAR-T cells, including the GM- CSF gene inactivation, GM- CSF gene knockdown or gene knockout ^{(GM-CSF k / o CAR} -T cells) to A method for lowering the level of non-GM-CSF cytokines in a subject. 19. The method of claim 18,
The method further comprising administering to the subject an anti-hGM-CSF antibody. 19. The method of claim 18,
The non-GM-CSF cytokine is IP-10, IL-1a, IL-1b, IL-2, IL-3, IL-4, IL-5, IL-6, IL-1Ra, IL-9, IL -10, VEGF, TNF-a, FGF-2, IFN-γ, IL-12p40, IL-12p70, sCD40L, KC, MDC, MCP-1, MIP-1a, MIP-1b, or a combination thereof. Including in the targeted genome editing, or GM-CSF gene silencing cells, GM- CSF gene inactivation, how to achieve the GM-CSF gene knockdown, or GM-CSF knockout (KO). 22. The method of claim 21,
The method further comprising an endonuclease as a nucleic acid cleaving enzyme. 23. The method of claim 22,
The method of claim 1, wherein the endonuclease is a Fok1 restriction enzyme or flap endonuclease 1 (FEN-1). 23. The method of claim 22,
The method of claim 1, wherein the endonuclease is Cas9 CRISPR related protein 9 (Cas9). 22. The method of claim 21,
A method, wherein GM- CSF gene inactivation by CRISPR/Cas9 targets and edits the GM-CSF gene in exon 1, exon 2, exon 3 or exon 4. 22. The method of claim 21,
CRISPR / Cas9 GM-CSF gene fire, how to enable the targeting and edit GM- CSF gene in exon 3 that includes. 22. The method of claim 21,
CRISPR / Cas9 GM-CSF gene fire, how to enable the targeting and edit GM- CSF gene in exon 1 that includes. 23. The method of claim 22,
The method of claim 1, wherein the GM- CSF gene inactivation comprises a plurality of CRISPR/Cas9 enzymes, each Cas9 enzyme targeting and editing different sequences of the GM- CSF gene in exon 1, exon 2, exon 3 or exon 4. 23. The method of claim 22,
The GM- CSF gene inactivation is GM- CSF A method comprising biallelic CRISPR/Cas9 targeting and knockout/inactivation of a gene. 30. The method of claim 29,
and treating the primary T cells with valproic acid to enhance biallelic knockout/inactivation. 22. The method of claim 21,
wherein the targeted genome editing comprises a zinc finger (ZnF) protein. 22. The method of claim 21,
wherein said targeted genome editing comprises a transcriptional activator-like effector nuclease (TALENS). 22. The method of claim 21,
wherein the targeted genome editing comprises a homing endonuclease, and wherein the homing endonuclease is an ARC nuclease (ARCUS) or a meganuclease. 22. The method of claim 21,
wherein the targeted genome editing comprises flap endonuclease (FEN-1). 22. The method of claim 21,
The method of claim 1, wherein the cell is a CAR T cell. 22. The method of claim 21,
The method of claim 1, wherein the CAR T cells are CD19 CAR-T cells. 22. The method of claim 21,
The method of claim 1, wherein the CAR T cell is a BCMA CAR-T cell. 22. The method of claim 21,
wherein said GM-CSF gene silencing is selected from the group consisting of RNA interference (RNAi), short interfering RNS (siRNA) and DNA-specific RNA interference (ddRNAi).

Images