CN101407837B - Gene chip for detecting blood pathogen and reagent kit for detecting - Google Patents

Abstract

The invention relates to a gene chip used for detecting blood pathogen and a kit used for detection. The gene chip includes a solid phase vector and an oligonucleotide probe fixed on the solid phase vector, wherein the oligonucleotide probe mainly comprises DNA segments selected from the 16S rRNA gene sequence and the nuc gene sequence of one or a plurality of blood pathogen. The kit includes the gene chip. The gene chip can be used for cross-breeding and detecting the pathogen in the blood according to a cross-breeding signal. The gene chip can be utilized to achieve the goal of detecting the blood pathogen, is simple to be operated, is high in accuracy and is strong in repetitiveness, can give out a detection result in 24 hours and has certain directive significance to the medicating of clinic doctors.

Description

Be used for gene chip and detection test kit that blood pathogen detects

Technical field

The present invention relates to a kind of gene chip and test kit, relate in particular to a kind of gene chip and test kit that blood pathogen detects that be used for.

Background technology

Healthy people's blood is aseptic, when body local infects when whole body is sent out and the systemic infection symptom occurs, occurs bacterium in the blood, can be divided into microbemia, septicemia and toxicaemia by the degree difference.Wherein the clinical symptom with septicemia is the most serious.Microbemia is from the propagation of pathogeny microorganism at infection site, subsequently in position propagation or with blood propagation, cause microbemia, discharge constituent lipopolysaccharides (or intracellular toxin), peptidoglycolipid, lipoteichoicacid, perienzyme of a large amount of microorganisms etc. simultaneously, and then induce the release of autogenous infection medium.Cause the release of inflammatory mediator such as cytokine, arachidonic acid metabolite, lectin, complement, nitrogen protoxide, endorphin, cytokinin to increase, and induce other important physical effects, even cause multiple organ dysfunction syndrome (MOF) death.Septicemia is meant pathogenic bacterium intrusion blood circulation, continues to exist, and breeding produces a large amount of toxin rapidly, causes serious constitutional symptom.Generally taking place in patient's whole body situation difference with under the situation that toxicity of pathogenic bacteria is big, quantity is many, is a kind of serious situation.Septicemia causes by a kind of pathogenic bacteria usually, but also has the pathogenic bacteria by two or more kinds to be caused, is called plural bacterium septicemia, and in whole septicemia, its sickness rate surpasses 10%.The prognosis of septicemia is than disease, and mortality ratio is generally 30～50%; The mortality ratio of plural number bacterium septicemia is higher, can reach 70%～80%.

The 10 class blood pathogens that China is common comprise streptococcus aureus, coagulase negative staphylococcus, streptococcus, Pseudomonas aeruginosa, serratia marcescens, klebsiella/enterobacteria (Klebsiella pneumonia, acid-producing Klebsiella bacterium; Enterobacter cloacae, enteroaerogen), intestinal bacteria, faecium, enterococcus faecalis, citrobacter freundii.

Existing advanced clinical microbemia checking system has two classes: " hemoculture detection and analytical system automatically " and " the digital classification of microorganism identification systems (API) ".These the two kinds systems that extensively adopted by hospital need biochemical identification or serological reaction after all tested sample being increased the bacterium cultivation, need 3 to 5 days usually.Maximum drawback is that required time is longer, and the abuse of Broad spectrum antibiotics causes clinical diagnosis complicated before this, can not meet clinical needs, and this often makes the clinician miss best treatment opportunity.And biochip is owing to have high-throughout characteristics, can determine the various bacteria kind that contains on the chip by single test, thereby avoid waste of time, and shortened the time of microbemia check, the clinician is effectively executed tool important directive significance.

Since nineteen nineties, biochip technology has been set up as a kind of brand-new analysis and detection technology, and along with carrying out progressively of the Human Genome Project grows up.This technological synthesis has used Protocols in Molecular Biology, ic manufacturing technology, computer technology, semiconductor technology, confocal laser scanning technique, fluorescent mark technology to make testing process have characteristics such as susceptibility height, high specificity, large scale integration, automatization, simple and efficient to handle, efficient height, is subjected to scientific research personnel's favor.At present biochip technology has been widely applied to the numerous areas such as prevention, diagnosis and treatment, new drug development, environmental pollution monitoring of molecular biology, disease.

As everyone knows, the sequence of the 16S rRNA gene in the prokaryote is very conservative, be not subjected to microorganism envrionment conditions of living in variation, nutritive substance rich scarce influence and change to some extent, can see the time ruler of organic evolution as, writing down the true vestige of organic evolution.The 16S rRNA gene of bacterium has suitable variability, thereby shows polytypism on sequence, has been widely used in the evaluation of bacterium Evolution analysis and kind.Therefore, the base sequence of the 16S rRNA gene in the analyzing prokaryote cell, the homology of 16S rRNA gene order between the microorganism that comparison is analyzed and other microbial species, distance and the phylogeny status that can disclose their sibships truly.Think that according to the life tree that the 16SrRNA gene is set up life is by bacterium territory (Bacteria), ancient bacterium territory (Archaea) and eukaryote territory (Eucarya) formation.Sequence similarity＜60% between three territory biologies, similarity in the territory＞70%, sequence similarity of the same race＞97%.16S rRNA gene order changes slowly, crosses over whole life evolutionary process, contains the rate of evolution different zones in the molecule, can be used as the basis of classification.

In sum, be necessary to invent a kind of biochip technology product and method thereof quick, accurate, that reliably blood pathogen is detected utilized.

Summary of the invention

In view of the foregoing, an object of the present invention is to provide a kind of gene chip that blood pathogen detects that is used for, to remedy the deficiency that traditional blood pathogen detection technique exists, it is quick, accurate and reliable to realize that blood pathogen detects.

Another object of the present invention provides a kind of test kit that is used to detect blood pathogen that comprises the said gene chip at least.

A further object of the present invention provides the method for utilizing described gene chip and test kit to come fast, detect accurately, delicately blood pathogen.

For achieving the above object, the present invention has adopted following technical scheme:

The invention provides a kind of gene chip that blood pathogen detects that is used for, comprise solid phase carrier and the oligonucleotide probe that is fixed on this solid phase carrier, wherein said oligonucleotide probe comprises the dna fragmentation of choosing from the 16S rRNA gene order of a class or a few class blood pathogens and nuc gene order.

Described dna fragmentation is at least a of SEQ ID NO:1-SEQ ID NO:28.

In the preferred embodiment of the present invention, described oligonucleotide probe also comprises positive control probe, negative control probe and fluorescent probe.

In the preferred embodiment of the present invention, described fluorescent probe has the nucleotide sequence of SEQ ID NO:29; Negative control probe has the nucleotide sequence of SEQ ID NO:30; The positive control probe has the nucleotide sequence of SEQ ID NO:31.

Class described in the present invention or a few class blood pathogen are selected from streptococcus aureus, coagulase negative staphylococcus, streptococcus, Pseudomonas aeruginosa, serratia marcescens, klebsiella/enterobacteria, intestinal bacteria, faecium, enterococcus faecalis, citrobacter freundii.

Wherein said klebsiella/enterobacteria comprises Klebsiella pneumonia, acid-producing Klebsiella bacterium, enterobacter cloacae, enteroaerogen.

Gene chip described in the present invention can be used at least a detection of streptococcus aureus, coagulase negative staphylococcus, streptococcus, Pseudomonas aeruginosa, serratia marcescens, klebsiella/enterobacteria, intestinal bacteria, faecium, enterococcus faecalis, citrobacter freundii blood pathogen, and wherein said klebsiella/enterobacteria comprises Klebsiella pneumonia, acid-producing Klebsiella bacterium, enterobacter cloacae, enteroaerogen.

Wherein the detection probes of Ying Yonging is at least a among the SEQ ID NO:32-SEQ ID NO:37.

The present invention also provides a kind of test kit that blood pathogen detects that is used for, and this this test kit comprises gene chip of the present invention.

Test kit of the present invention also comprises detection probes at least a of SEQ ID NO:32-SEQ ID NO:37.

Test kit of the present invention can also comprise interpretation software and specification sheets that hybridizing box, hybridization solution and Analysis and Identification result use.

Test kit of the present invention can be used at least a detection of streptococcus aureus, coagulase negative staphylococcus, streptococcus, Pseudomonas aeruginosa, serratia marcescens, klebsiella/enterobacteria, intestinal bacteria, faecium, enterococcus faecalis, citrobacter freundii blood pathogen, and wherein said klebsiella/enterobacteria comprises Klebsiella pneumonia, acid-producing Klebsiella bacterium, enterobacter cloacae, enteroaerogen.

The present invention also proposes to use the method for described gene chip and test kit detection blood pathogen, may further comprise the steps:

(1) zone design suitable according to 16S rRNA gene order both sides and high conservative the universal primer of 16S rRNA gene order that is used to increase;

(2) prepare the genomic dna of testing sample according to a conventional method, use primer in the step (1) to treat test sample product genomic dna and carry out the target sequence that pcr amplification and purifying increase and obtain;

(3) target sequence that obtains in the markers step (2);

(4) with target sequence behind the mark and said gene chip hybridization;

(5) obtain hybridization signal and Analysis and Identification results of hybridization with biochip scanner.

In preferred embodiment of the present invention, the upstream primer sequence of the zone design of suitable according to 16S rRNA gene order both sides to high conservative is SEQ ID NO:32-33 in the above-mentioned steps (1), and the downstream primer sequence is SEQ ID NO:34-SEQ ID NO:37.

In preferred embodiment of the present invention, use interpretation software BactarrayAnalyzer Analysis and Identification results of hybridization in the above-mentioned steps (5).

As seen from the above technical solutions, utilize gene chip of the present invention to reach to detect and the purpose of definite blood infection patient institute bacterial infection kind, because it is easy and simple to handle, the accuracy height, repeatability is strong, in 24 hours, can provide detected result, certain directive significance be arranged for clinician's medication.

For above and other objects of the present invention, feature and advantage can be become apparent, below especially exemplified by preferred embodiment, and cooperate Figure of description, be described in detail below.

Description of drawings

Fig. 1 is the profile synoptic diagram of the gene chip of one embodiment of the invention.

Fig. 2 is the synoptic diagram of arranging of probe on the embodiment of gene chip of the present invention.

Fig. 3 A-Fig. 3 J is for carrying out the hybridization scanning result of sample detection with an embodiment of gene chip of the present invention.

Fig. 4 A-Fig. 4 B saves as the process synoptic diagram of .gpr file for the hybridization scanning result that an embodiment of gene chip of the present invention is carried out sample detection.

Fig. 5 is an analysis result information that embodiment detects that utilizes gene chip of the present invention.

Fig. 6 is the evolutionary tree of 64 kinds of bacterial 16 S rRNA genic systems.

Embodiment

For further specifying gene chip and the detection method thereof that blood pathogen detects that be used for of the present invention, describe especially exemplified by following preferred embodiment, these embodiment are in order to illustrate rather than limit by any way the present invention.

Embodiment one: the design of probe and preparation

1. sequence obtains

From GenBank, download the 16S rRNA gene order that obtains above-mentioned 10 class blood pathogens.

2. probe design

Compare all download sequence with Clustal X software,,, design 75 of the oligonucleotide probes of above-mentioned 10 class blood pathogens altogether at the probe of the region of variability of 16S rRNA gene order design at each bacterioid according to comparison result.

3. probe screening

Carry out the probe screening by 766 hybrid experiments, finally obtain 31 suitable probes, comprise 28 specific probes at blood pathogen, 1 positive control probe, 1 negative control probe and fluorescent probe, its base sequence is shown in following table 1, table 2.

Wherein, 28 probes (SEQ ID NO:1-NO:28) that are numbered NO.1-NO.28 are selected from the 16S rRNA gene order of streptococcus aureus in the blood common pathogen, streptococcus, coagulase negative staphylococcus, Pseudomonas aeruginosa, serratia marcescens, klebsiella/enterobacteria, intestinal bacteria, faecium, enterococcus faecalis, citrobacter freundii respectively, and these probes can detect corresponding source strain respectively from test sample.The quality of glass chip is monitored and the probe location on the scanning result figure is positioned with the poly T sequence that has fluorescent mark Cy3., be used for non-specific hybridization situation is monitored as negative control probe with the probe that contains a plurality of T.The probe that is numbered NO.31 is used for test sample and whether contains bacterium as the positive control probe.

Selected probe sequence and relevant detection bacterium among table 1. gene chip one embodiment of the present invention

SEQID	The probe numbering	Source (being selected from the nuc gene order of streptococcus aureus respectively)	Probe sequence (5 '-3 ')	Detect bacterium
					NO：1	?NO.1	Streptococcus aureus	AACGGACGAGAAGCTTGCTTCTCT	Streptococcus aureus
NO：2	?NO.2	Streptococcus aureus	GATACACCTGAAACAAAGCATCC	Streptococcus aureus
					NO：3	?NO.3	Streptococcus aureus	GTGTAGAGAAATATGGTCCTGA	Streptococcus aureus

Selected probe sequence and relevant detection bacterium (continuing) among table 2. gene chip one embodiment of the present invention

SEQID

The probe numbering

Source (being selected from the 16SrRNA gene order of following bacterium respectively)

Probe sequence (5 '-3 ')

Detect bacterium

NO：4	NO.4	Streptococcus aureus	GACAAAGGTCAAAGAACTGAT	Streptococcus aureus
					NO：5	?NO.5	Streptococcus pneumoniae	GTTAGACCCTTTCCGGGGTTTA	Streptococcus pneumoniae
NO：6	?NO.6	Streptococcus pneumoniae	AAGAGTAGATGTTGCATGACATTT	Streptococcus pneumoniae
					NO：7	?NO.7	Streptococcus pneumoniae	GTGAGAGTGGAAAGTTCACACTG	Streptococcus pneumoniae
NO：8	?NO.8	Coagulase negative staphylococcus/streptococcus aureus	CCTACCTATAAGACTGGGATAA	Coagulase negative staphylococcus
					NO：9	?NO.9	Coagulase negative staphylococcus/streptococcus aureus	AACTTCGGGAAACCGGAGCT	Coagulase negative staphylococcus/streptococcus aureus
NO：10	?NO.10	Coagulase negative staphylococcus/streptococcus aureus	GTCACTTATAGATGGACCCG	Coagulase negative staphylococcus/streptococcus aureus
					NO：11	?NO.11	Pseudomonas aeruginosa	CATACGTCCTGAGGGAGAAAGTG	Pseudomonas aeruginosa
NO：12	?NO.12	Pseudomonas aeruginosa	GGGCAGTAAGTTAATACCTTGCTGT	Pseudomonas aeruginosa
					NO：13	?NO.13	Pseudomonas aeruginosa	ATGAAGGGAGCTTGCTCCTGGAT	Pseudomonas aeruginosa
NO：14	?NO.14	Pseudomonas aeruginosa	CCGTTGGGATCCTTGAGATC	Pseudomonas aeruginosa

NO：15	?NO.15	Serratia marcescens	ACGCTCATCAATTGACGTTACT	Serratia marcescens
					NO：16	?NO.16	Serratia marcescens/citrobacter freundii	GCACAGGGGAGCTTGCTCCCTGG	Serratia marcescens/citrobacter freundii
NO：17	?NO.17	Serratia marcescens	GGTGGTGAACTTAATACGTTCATCA	Serratia marcescens
					NO：18	?NO.18	Klebsiella/enterobacteria	GGCGATAAGGTTAATAACCTTGTCG	Klebsiella/enterobacteria
NO：19	?NO.19	Klebsiella/enterobacteria/citrobacter freundii	AGCACAGAGAGCTTGCTCTCGG	Klebsiella/enterobacteria/citrobacter freundii
					NO：20	?NO.20	Klebsiella/enterobacteria/serratia marcescens/intestinal bacteria/citrobacter freundii	CAAAGTGGGGGACCTTCGGGCCTC	Klebsiella/enterobacteria/serratia marcescens/intestinal bacteria/citrobacter freundii
NO：21	?NO.21	Intestinal bacteria/serratia marcescens/Cray primary/enterobacteria/citrobacter freundii	GCCATCGGATGTGCCCA	Intestinal bacteria/serratia marcescens/Cray primary/enterobacteria/citrobacter freundii
					NO：22	?NO.22	Intestinal bacteria	AGGGAGTAAAGTTAATACCTTTGCTC	Intestinal bacteria
NO：23	?NO.23	Intestinal bacteria	CAGGAAACAGCTTGCTG	Intestinal bacteria
								TTTCGC
NO：24	?NO.24	Intestinal bacteria	CAGGAAGAAGCTTGCTTCTTTGC	Intestinal bacteria

NO：25	?NO.25	Faecium	ATGAGAGTAACTGTTCATCCCTTG	Faecium
					NO：26	?NO.26	Faecium	CAAAACCGCATGGTTTTGATTTG	Faecium
NO：27	?NO.27	Enterococcus faecalis	ACGTTAGTAACTGAACGTCCCCTG	Enterococcus faecalis
					NO：28	?NO.28	Enterococcus faecalis	ATGCCGCATGGCATAAGAGTG	Enterococcus faecalis
NO：29	?NO.29	Fluorescent probe	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-Cy3	Contrast as fluorescence
					NO：30	?NO.30	Negative control probe	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT	As negative control
NO：31	?NO.31	The positive control probe	ACTCCTACGGGAGGCAGC	As positive control

4. probe is synthetic

According to the sequence synthesising probing needle in the table 1, carry out poly (T) and amido modified at 5 ' end.

Embodiment two: primer design and preparation

Utilize the interior sequence resources of public databases such as information biology software analysis GenBank such as Primer 5.0, the zone design of suitable high conservative in 16S rRNA gene order both sides 2 of the universal primers of the 16S rRNA gene order that is used to increase, this primer sequence and uses thereof is as shown in table 2 below.

Table 3.16S rRNA gene amplification universal primer and purposes

The primer numbering	Primer sequence (5 '-3 ')	The primer purposes
			1	5 '-AGAGTTTGATCATGGCTCAG-3 ' (SEQ ID NO:32) and 5 '-AGAGTTTGATCCTGGCTCAG-3 ' (SEQ ID NO:33)	The 16S upstream primer

2

5 '-CCGTCAATTCATTTAAGTTT-3 ' (SEQ ID NO:34), 5 '-CCGTCAATTCATTTGAGTTT-3 ' (SEQ ID NO:35), 5 '-CCGTCAATTCCTTTAAGTTT-3 ' (SEQ ID NO:36) and 5 '-CCGTCAATTCCTTTGAGTTT-3 ' (SEQ ID NO:37)

The 16S downstream primer

Embodiment three: the preparation of gene chip

1. dissolving probe

Synthetic probe among the embodiment one is dissolved in the 50%DMSO solution, makes the final concentration of probe reach 1 μ g/ μ l.

2. point sample

Utilize automated biological chip point sample instrument (Spotarray 72) with probe points to slide, form the microarray design.As shown in Figure 1, the chip that uses in the present embodiment is to be solid phase carrier with 57.5mm * 25.5mm * 1mm (length * wide * height) through the slide of aldehyde radicalization, in the point sample district with 31 oligonucleotide probe points of synthetic among the embodiment one 3mm * 3mm on slide, low density DNA micromatrix in the formation, the array arrangement rule is identical in six point sample districts on the slide.As shown in Figure 2, the probe that has provided each point sample district is in detail arranged, and is the individual probe points in 9 (OK) * 12 (row) in each point sample district, and every probe repeats point sample 3 times, be numbered probe label in the table 1 in the bracket, the position that synopsis 1 can every probe of detail knowledge.

With the slide drying behind the point sample, UV-crosslinked, promptly obtain the gene chip that is used to detect the blood important pathogenic bacteria of preferred embodiment according to the present invention.

Embodiment four: utilize the pathogenic bacterium in the above-mentioned gene chip rapid detection blood for preparing

Utilizing the above-mentioned gene chip for preparing to detect in the method for blood pathogen, the present invention has all done a series of experiment to factors such as detection step, testing conditions and has groped, as each component proportions in the PCR reaction mixture, the PCR cycling condition, hybridization temperature, hybridization time etc. and main agents prescription are as hybridization solution, washing lotions etc. (prescription sees following examples for details) are the good ratio that obtains through after the gradient experiment.PCR cycling condition, especially annealing time and extension time is the good condition for selecting after the gradient experiment also.The blood important pathogenic bacteria detects the experiment flow of gene chip also for optimizing the back result.

In addition, the present invention use from clinical sample (positive or negative, promptly being that fully automatic blood is cultivated the positive or negative hemoculture thing after instrument is reported to the police) method of extracting bacterial genomes is the method (it is described to see following examples for details) of alkali cleaning/thermo-cracking, this method can be extracted bacterial genomes effectively from the hemoculture thing, be applicable to Gram-positive and gram negative bacterium.This method can also be eliminated in the hemoculture thing inhibitor to subsequent reactions (mainly being PCR), and has higher sensitivity.

Detection method of the present invention is: after extracting the testing sample genome, through the double-stranded amplification of PCR, the double-stranded PCR product of purifying, utilize downstream primer PCR strand mark, purification of single stranded PCR product, obtain marked product, marked product and hybridization solution are mixed the probe array FX that is added on the gene chip at 1: 1, and 50 ℃ of water-baths were hybridized 1.5 hours, after hybridization is finished, gene chip is washed by ionic strength order from high to low with the washing lotion for preparing, after air-dry, at 635nm, the 532nm wavelength is the scanning chip down, obtains the collection of illustrative plates and the data message of target sequence and chip hybridization, by computer software analysis, judge the kind of bacterial infection.

Below, be described in detail as follows for utilizing the above-mentioned gene chip for preparing to detect the preferred embodiment of blood pathogen:

1. the prehybridization of chip

(1) above-mentioned UV-crosslinked chip is put into the prehybridization solution of 42 ℃ of preheatings of 500ml, 42 ℃ left standstill 1 hour.

The prehybridization solution prescription: 1%BSA (bovine serum albumin) (W/V)

5 * SSC (sodium-chlor-sodium citrate solution)

0.1%SDS (sodium lauryl sulphate) (W/V)

(2) at ddH ₂Carry among the O and wash ethanol dehydration in 1 minute twice, 95% 2 minutes, cold wind dries up, and is standby.

2. sample source

Positive: clinical collection patient venous blood 5ml injects Blood culture bottle, 35 ℃ of positive blood cultures of cultivating after certain hour to fully automatic blood is cultivated the instrument warning.(annotate: the positive in the research is from U.S. BD and French Mei Liai hemoculture instrument)

Negative sample: fully automatic blood is cultivated the negative hemoculture thing of instrument warning.

3. sample extraction

(1) getting 450 μ l clinical samples joins in the 1.5ml screw socket centrifuge tube.

(2) add 900 μ l sample extracting solution I (0.5M sodium hydroxide, 0.05M Trisodium Citrate), put upside down mixing repeatedly 10 minutes.

(3) 13, centrifugal 5 minutes of 000 * g topples over supernatant at once.

(4) precipitation is resuspended with 500 μ l sample extracting solution II (0.5MTris-HCl pH8.0).

(5) 13, centrifugal 5 minutes of 000 * g topples over supernatant at once.

(6) precipitation is resuspended with 500 μ l sample extracting solution II.

(7) 13, centrifugal 5 minutes of 000 * g abandons supernatant.

(8) precipitation is resuspended with 100 μ l sample extracting solution III (10mMTris-HCl pH8.0,1mM EDTA), and 100 ℃ were boiled 10 minutes.

(9) 13, centrifugal 15 minutes of 000 * g gets supernatant 60 μ l and transfers in the new 1.5ml sterilization centrifuge tube, carries out follow-up PCR reaction or-20 ℃ of storages.

4. increase and mark

(1) the double-stranded amplification of PCR

Get the extract 3 μ l that above-mentioned steps 3 obtains and join in the double-stranded amplification PCR reaction mixture, the prescription of double-stranded amplification PCR reaction mixture is as shown in table 3 below.

The double-stranded amplification of table 4 PCR reaction mixture prescription

Composition	The source	Concentration	Application of sample amount (μ l)
				The PCR damping fluid	The precious biological rTaq in Dalian carries	10×	3
dATP	Dalian is precious biological	100mM	0.024
				dCTP	Dalian is precious biological	100mM	0.024
dGTP	Dalian is precious biological	100mM	0.024
				dTTP	Dalian is precious biological	100mM	0.016
dUTP	The worker is given birth in Shanghai	100mM	0.008
				The Taq enzyme	Precious biological	5U/μl	0.4
DNase?I	Dalian is precious biological	70U/μl	0.07

Primer 1	The worker is given birth in Shanghai	100μM	0.08
				Primer 2	The worker is given birth in Shanghai	100μM	0.08
The UNG enzyme	The worker is given birth in Shanghai	1U/μl	0.1
				ddH2O	Millipore	-	23.174

Annotate: upward primer 1 and primer 2 are primer listed in the table 2 in the table.Reaction tubes is put into PCR instrument (Biometra), and the loop parameter of setting is as follows:

37 ℃ 15 minutes

94 ℃ 10 minutes

72 ℃ 5 minutes

4 ℃ 20 hours

(2) purifying of double-stranded PCR product

With the double-stranded PCR product that amplification in the above-mentioned steps (1) obtains, add in the purification column (MILLIPORE company), moisturizing to 400 μ l, 1,000 * g, centrifugal 15 minutes, abandon liquid, on the purification column film, add 30 μ l ddH ₂O, 37 ℃ left standstill 5 minutes, purification column is tipped upside down on the new 1.5ml centrifuge tube, 1,000 * g, centrifugal 2 minutes, the solution of centrifugal gained was the purified product of double-stranded PCR.

(3) PCR strand mark

Get the double-stranded PCR purified product 10 μ l that obtain in the above-mentioned steps (2) and join in the strand mark PCR reaction mixture, the prescription of strand mark PCR reaction mixture is as shown in table 4 below.

Table 5: strand mark PCR reaction mixture prescription

Composition	Concentration	Application of sample amount (μ l)
			The PCR damping fluid	10×	3
dATP	100mM	0.024
			dCTP	100mM	0.024

dGTP	100mM	0.024
			dTTP	100mM	0.016
dUTP	100mM	0.008
			The Taq enzyme	5U/μl	0.4
DNase?I	70U/μl	0.07
			Primer 2	100μM	0.08
Cy5-dCTP	1nmol/μl	0.3
			ddH 2O	-	16.054

Annotate: upward primer 2 is a primer listed in the table 2 in the table.

Reaction tubes is put into PCR instrument (Biometra), and the loop parameter of setting is as follows:

94 ℃ 10 minutes

72 ℃ 5 minutes

4 ℃ 20 hours

(4) obtain strand PCR product

5. hybridization

The preparation of hybridization reaction solution: the strand PCR product 8 μ l that above-mentioned steps 4 obtains, 2 * hybridization solution, the 8 μ l of 50 ℃ of preheatings mix, and centrifugal froth breaking is standby.

Getting the gene chip for preparing in the foregoing description three places in the hybridizing box (Bo Ao company), cover the cover plate (Bo Ao company) of customization, with the hybridization reaction solution point for preparing probe array zone at this chip, note between cover plate and the chip bubble being arranged, cover tight hybridizing box, put into 50 ℃ of water-bath 1.5h.After hybridizing end, take out hybridizing box, remove cover plate, washed 3 minutes in washing lotion A successively respectively, washed 3 minutes among the washing lotion B, washing is 1.5 minutes among the washing lotion C, and air-dry in air.

Hybridization solution prescription: 10% T 500 (dextran Sulfate); 25% methane amide (formamide); 0.1%SDS; 6 * SSPE

Washing lotion A:1 * SSC, 0.1%SDS

Washing lotion B:0.05 * SSC

Washing lotion C:95% ethanol

6. scanning

Use GenePix ^TMPersonal 4100A biochip scanner, operation Gene Pix Pro4.1 program is selected 635nm and 532nm two channels, and the PMT value transfers to 600, and scanning result saves as JPG, the file of TIF form.

Hybridization scanning result when test sample is above-mentioned 10 bacterioids respectively with the above-mentioned gene chip for preparing is shown in Fig. 3 A-Fig. 3 J.Wherein the sample represented respectively of Fig. 3 A-Fig. 3 J is: A, serratia marcescens, B, enterococcus faecalis, C, intestinal bacteria, D, streptococcus aureus, E, Cray Bai Shi Salmonella/enterobacteria, F, Pseudomonas aeruginosa, G, faecium, H, coagulase negative staphylococcus, I, streptococcus pneumoniae, J, citrobacter freundii.

Call the lasso file, obtain the fluorescence intensity level of each probe site, and the result is saved as the .gpr file, shown in Fig. 4 A and Fig. 4 B.

7. interpretation as a result

1. install and use interpretation software Bactarray Analyzer (by Tianjin Biochip Technology Co., Ltd's exploitation) as a result.

2. move Bactarray Analyzer program, and input user name, password.

3. the newly-built project of " new project " button on the click tools hurdle imports .gpr file to be analyzed by " importing file " then.Press Ctrl, can select and open a plurality of files simultaneously.

4. click " processing data " button, software will generate the log file of a treating processes automatically.Click filename at " listed files " page, the report page can automatically switch to the analysis result information of this document.Analysis result information is kept under the catalogue of this project place automatically.

5. interpretation as a result: as shown in Figure 5, report provides information such as censorship file name, sample number into spectrum, result, microorganism name, confidence level, score value, specific probe hybrid rate, fluorescence intensity, software interpretation date, software operation people.Wherein, " microorganism " item is detected bacterium name in the microbemia.

Embodiment five: gene chip is carried out specificity identify

Choose 64 kinds of comparatively common blood pathogens, utilized their 16S rRNA sequence construct systematic evolution tree.Systematic evolution tree can clearly show the evolutionary relationship between the various bacterial strains, and the residing evolution of the 10 bacterioids position that this chip detected.This analytical results that utilization obtains, we select for use with very approaching some bacteriums of target bacterium evolutionary relationship and carry out the specificity experiment.If can accurately distinguish these nearly edge bacteriums, illustrate that then probe has higher specificity, also just must distinguish the farther edge bacterium far away of other evolutionary relationship.

64 kinds of bacteriums of the structure evolutionary tree that present embodiment is selected for use comprise: 1 Acinetobactercalcoaceticus subsp.anitratus Acinetobacter calcoaceticus anitratum subspecies; 2Acinetobacter baumannii Acinetobacter baumannii; 3 Acinetobacter calcoaceticus Acinetobacter calcoaceticus; 4 Aerococcus viridans aerococcus viridanses; 5 Alcaligenes faecalis subsp.faecalis alcaligenes faecalis excrement subspecies; 6 Achromobacter xylosoxidans subsp.xylosoxidans Achromobacter xylosoxidans oxidation wood sugar subspecies; 7 Bacillus cereus Bacillus cereuss; 8 Bacillus subtilis subsp.subtilis Bacillus subtilus withered grass subspecies; 9 Bacteroidesfragilis bacteroides fragiliss; 10 Brucella melitensis biovar abortus Brucella melitensis miscarriage biotype; 11 Brucella melitensis Brucella melitensis; 12 Brucellamelitensis biovar neotomae Brucella melitensis wood mouse biotype; 13 Brucellamelitensis biovar Ovis Brucella melitensis sheep biotypes; 14 Corynebacteriumdiphtheriae corynebacterium diphtheriaes; 15 Citrobacter freundii citrobacter freundiis; 16Clostridium perfringens clostridium perfringens; 17 Enterobacter aerogenes enteroaerogen; 18 Pantoea agglomerans pantoea agglomerans; 19 Enterobacter cloacaesubsp.cloacae enterobacter cloacae cloaca subspecies; 20 Enterobacter hormaechei Huo Shi enterobacterias; 21 Enterococcus faecalis enterococcus faecalis; 22 Enterococcus faecium faeciums; 23 Enterococcus gallinarum Enterococcus gallinarums; 24 Escherichia coli intestinal bacteria; 25 Haemophilus influenzae hemophilus influenzaes; 26 Hafnia alvei hafnia alveis; 27 Klebsiella oxytoca acid-producing Klebsiella bacteriums; 28 Klebsiella pneumoniae Klebsiella pneumonia; 29 Listeria monocytogenes monokaryon hyperplasia listeria spps; 30 Micrococcusluteus micrococcus luteuses; 31 Mycobacterium tuberculosis mycobacterium tuberculosis; 32Neisseria gonorrhoeae Diplococcus gonorrhoeae; 33 Propionibacterium acnes CBPs; 34 Proteus mirabilis Proteus mirabilises; 35 Pseudomonas aeruginosa Pseudomonas aeruginosas; 36 Pseudomonas fluorescens Pseudomonas fluorescens; 37 Pseudomonasfluorescens Pseudomonas fluorescens; 38 Pseudomonas putida pseudomonas putidas; 39Pseudomonas stutzeri Pseudomonas stutzeri; 40 Streptococcus agalactiae streptococcus agalactiaes; 41 Streptococcus salivarius streptococcus-salivariuses; 42 Salmonella enterica subsp.enterica serovar Typhi salmonella typhis; 43 Salmonella enterica subsp.enterica enteron aisle Salmonellas sramana subspecies; 44 Serratia marcescens subsp.marcescens serratia marcescens cement subspecies; 45 Sphingobacterium multivorum Sphingobacterium multivorums; The golden yellow subspecies of 46Staphylococcus aureus subsp.aureus streptococcus aureus; 47Staphylococcus cohnii subsp.cohnii Staphylococcus cohnis Ke Shi subspecies; 48Staphylococcus epidermidis staphylococcus epidermidis; 49 Staphylococcus haemolyticus staphylococcus haemolyticuses; 50 Staphylococcus hominis subsp.hominis staphylococcus hominis people subspecies; 51 Staphylococcus intermedius Staphylococcus intermedius; The saprophytic subspecies of 52 Staphylococcussaprophyticus subsp.saprophyticus Staphylococcus saprophyticus; 53Staphylococcus sciuri subsp.sciuri Staphylococcus sciuri squirrel subspecies; 54Staphylococcus simulans imitates staphylococcus; 55 Staphylococcus xylosus staphylococcus xylosus; 56 Stenotrophomonas maltophilia stenotrophomonas maltophilias; 57Streptococcus oralis Streptococcus oralis; 58 Streptococcus pneumoniae streptococcus pneumoniaes; 59 Streptococcus pyogenes micrococcus scarlatinaes; 60 Tetragenococcus doogicus; 61 Tetragenococcus koreensis; 62 Aeromonas hydrophila subsp.hydrophila Aeromonas hydrophilas are had a liking for the water subspecies; The sense of 63 Moraxella (Branhamella) catarrhalis moraxelle catarrhalis; 64 Lactobaci llus acidophilus Lactobacterium acidophilums are specifically referring to Fig. 6.

By 449 hybrid experiments, prove that this chip can accurately distinguish: enterococcus faecalis, faecium and Enterococcus gallinarum (in the evolutionary tree position: 23,24,25) of homology between 95% to 95.5%; Homology is 97.4% streptococcus aureus and staphylococcus epidermidis (position in the evolutionary tree: 52 and 54); Homology is 92.1% streptococcus pneumoniae and streptococcus-salivarius (position in the evolutionary tree: 47 and 64); Homology is 93.0% Pseudomonas aeruginosa and Pseudomonas fluorescens (position in the evolutionary tree: 41 and 42); Intestinal bacteria between the homology 94% to 97.1%, Klebsiella pneumonia, serratia marcescens and Salmonellas (position in the evolutionary tree: 26,31,50,48 and 49).In addition, present embodiment also utilizes the bacterium of some edge far away, has carried out the specificity experiment as the inferior Salmonella of germ oligotrophy unit cell, acinetobacter calcoaceticus, Staphylococcus saprophyticus and honeycomb Hough Buddhist nun, all obtains good result.

This detection chip can be finished in 24 hours and detect 9 common class pathogenic bacterium of China.

Finish the clinical samples of bacterial infection patients in 647 example this chip detection scopes altogether from year January in March, 2005 to 2006, particular case sees the following form:

Finish routine number	Traditional detection and chip detection be coincidence rate as a result	The chip detection accuracy
			647	74.65％	98.6％

Traditional detection and chip detection be coincidence rate as a result: be meant that routine number that traditional detection and chip detection meet accounts for the ratio of whole case load.For incongruent case, will carry out the 16S sequence verification.

Chip detection accuracy: after the 16SrDNA sequence verification, prove that the correct routine number of chip detection result accounts for the ratio of whole case load.

Though the present invention discloses as above with preferred embodiment; but be not in order to qualification the present invention, any person of ordinary skill in the field, without departing from the spirit and scope of the present invention; can do a little change and improvement, thus protection scope of the present invention when with claim the person of being defined be as the criterion.

Sequence table

＜110〉Tianjin Biochip Technology Co., Ltd

＜120〉be used for gene chip and the detection test kit that blood pathogen detects

<130>5P13002-CN

<160>37

<170>PatentIn?version?3.2

<210>1

<211>49

<212>DNA

＜213〉be selected from the nuc gene order of streptococcus aureus

<400>1

tttttttttt?tttttttttt?tttttaacgg?acgagaagct?tgcttctct 49

<210>2

<211>49

<212>DNA

＜213〉be selected from the nuc gene order of streptococcus aureus

<400>2

tttttttttt?tttttttttt?ttttttgata?cacctgaaac?aaagcatcc 49

<210>3

<211>49

<212>DNA

＜213〉be selected from the nuc gene order of streptococcus aureus

<400>3

tttttttttt?tttttttttt?tttttttgtg?tagagaaata?tggtcctga 49

<210>4

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of streptococcus aureus

<400>4

tttttttttt?tttttttttt?ttttttttga?caaaggtcaa?agaactgat 49

<210>5

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of streptococcus pneumoniae

<400>5

tttttttttt?tttttttttt?tttttttgtt?agaccctttc?cggggttta 49

<210>6

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of streptococcus pneumoniae

<400>6

tttttttttt?tttttttttt?tttttaagag?tagatgttgc?atgacattt 49

<210>7

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of streptococcus pneumoniae

<400>7

tttttttttt?tttttttttt?ttttttgtga?gagtggaaag?ttcacactg 49

<210>8

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of coagulase negative staphylococcus/streptococcus aureus

<400>8

tttttttttt?tttttttttt?tttttttcct?acctataaga?ctgggataa 49

<210>9

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of coagulase negative staphylococcus/streptococcus aureus

<400>9

tttttttttt?tttttttttt?ttttttttta?acttcgggaa?accggagct 49

<210>10

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of coagulase negative staphylococcus/streptococcus aureus

<400>10

tttttttttt?tttttttttt?tttttttttg?tcacttatag?atggacccg 49

<210>11

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of Pseudomonas aeruginosa

<400>11

tttttttttt?tttttttttt?ttttttcata?cgtcctgagg?gagaaagtg 49

<210>12

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of Pseudomonas aeruginosa

<400>12

tttttttttt?tttttttttt?ttttgggcag?taagttaata?ccttgctgt 49

<210>13

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of Pseudomonas aeruginosa

<400>13

tttttttttt?tttttttttt?ttttttatga?agggagcttg?ctcctggat 49

<210>14

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of Pseudomonas aeruginosa

<400>14

tttttttttt?tttttttttt?tttttttttc?cgttgggatc?cttgagatc 49

<210>15

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of serratia marcescens

<400>15

tttttttttt?tttttttttt?tttttttacg?ctcatcaatt?gacgttact 49

<210>16

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of serratia marcescens/citrobacter freundii

<400>16

tttttttttt?tttttttttt?ttttttgcac?aggggagctt?gctccctgg 49

<210>17

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of serratia marcescens

<400>17

tttttttttt?tttttttttt?ttttggtggt?gaacttaata?cgttcatca 49

<210>18

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of klebsiella/enterobacteria

<400>18

tttttttttt?tttttttttt?ttttggcgat?aaggttaata?accttgtcg 49

<210>19

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of klebsiella/enterobacteria/citrobacter freundii

<400>19

Tttttttttt?tttttttttt?tttttttagc?acagagagct?tgctctcgg 49

<210>20

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of klebsiella/enterobacteria/serratia marcescens/intestinal bacteria/citrobacter freundii

<400>20

tttttttttt?tttttttttt?tttttcaaag?tgggggacct?tcgggcctc 49

<210>21

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of intestinal bacteria/serratia marcescens/Cray primary/enterobacteria/citrobacter freundii

<400>21

tttttttttt?tttttttttt?tttttttttc?ttgccatcgg?atgtgccca 49

<210>22

<211>49

<212>DNA

＜213〉be selected from colibacillary 16SrRNA gene order

<400>22

tttttttttt?tttttttttt?tttagggagt?aaagttaata?cctttgctc 49

<210>23

<211>49

<212>DNA

＜213〉be selected from colibacillary 16SrRNA gene order

<400>23

tttttttttt?ttttttttttttttttcagg?aaacagcttg?ctgtttcgc 49

<210>24

<211>49

<212>DNA

＜213〉be selected from colibacillary 16SrRNA gene order

<400>24

tttttttttt?tttttttttt?ttttttcagg?aagaagcttg?cttctttgc 49

<210>25

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of faecium

<400>25

tttttttttt?tttttttttt?tttttatgag?agtaactgtt?catcccttg 49

<210>26

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of faecium

<400>26

tttttttttt?tttttttttt?ttttttcaaa?accgcatggt?tttgatttg 49

<210>27

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of enterococcus faecalis

<400>27

tttttttttt?tttttttttt?tttttacgtt?agtaactgaa?cgtcccctg 49

<210>28

<211>49

<212>DNA

＜213〉be selected from the 16SrRNA gene order of enterococcus faecalis

<400>28

tttttttttt?tttttttttt?ttttttttat?gccgcatggc?ataagagtg 49

<210>29

<211>49

<212>DNA

＜213〉fluorescent probe sequence

<400>29

tttttttttt?tttttttttt?tttttttttt?tttttttttt?ttttttttt 49

<210>30

<211>49

<212>DNA

＜213〉negative control probe sequence

<400>30

tttttttttt?tttttttttt?tttttttttt?tttttttttt?ttttttttt 49

<210>31

<211>49

<212>DNA

＜213〉positive control probe sequence

<400>31

tttttttttt?tttttttttt?tttttttttt?tactcctacg?ggaggcagc 49

<210>32

<211>20

<212>DNA

＜213〉detection probes upstream primer sequence

<400>32

agagtttgat?catggctcag 20

<210>33

<211>20

<212>DNA

＜213〉detection probes upstream primer sequence

<400>33

agagtttgat?cctggctcag 20

<210>34

<211>20

<212>DNA

＜213〉detection probes downstream primer sequence

<400>34

ccgtcaattc?atttaagttt 20

<210>35

<211>20

<212>DNA

＜213〉detection probes downstream primer sequence

<400>35

ccgtcaattc?atttgagttt 20

<210>36

<211>20

<212>DNA

＜213〉detection probes downstream primer sequence

<400>36

ccgtcaattc?ctttaagttt 20

<210>37

<211>20

<212>DNA

＜213〉detection probes downstream primer sequence

<400>37

ccgtcaattc?ctttgagttt 20

Claims (9)

1. one kind is used for the gene chip that blood pathogen detects, comprise solid phase carrier and the oligonucleotide probe that is fixed on this solid phase carrier, it is characterized in that described oligonucleotide probe comprises the dna fragmentation of choosing from the 16S rRNA gene order of blood pathogen and nuc gene order, described dna fragmentation is shown in SEQ ID NO:1-SEQ ID NO:28.

2. gene chip according to claim 1 is characterized in that described oligonucleotide probe also comprises positive control probe, negative control probe and fluorescent probe.

3. gene chip according to claim 2 is characterized in that described fluorescent probe is shown in SEQ ID NO:29.

4. gene chip according to claim 2 is characterized in that described negative control probe is shown in SEQ ID NO:30.

5. gene chip according to claim 2 is characterized in that described positive control probe is shown in SEQ ID NO:31.

6. according to each described gene chip of claim 1-5, it is characterized in that described blood pathogen is selected from streptococcus aureus, coagulase negative staphylococcus, streptococcus, Pseudomonas aeruginosa, serratia marcescens, klebsiella/enterobacteria, intestinal bacteria, faecium, enterococcus faecalis and citrobacter freundii.

7. one kind is used for the test kit that blood pathogen detects, and it is characterized in that this test kit comprises the described gene chip of claim 1.

8. test kit according to claim 7 is characterized in that described test kit also comprises the primer shown in the SEQ ID NO:32-SEQ ID NO:37.

9. test kit according to claim 8 is characterized in that described test kit also comprises interpretation software and specification sheets that hybridizing box, hybridization solution and Analysis and Identification result use.

Images