CN101319190B - Nucleic acid enricher and uses thereof - Google Patents
Nucleic acid enricher and uses thereof Download PDFInfo
- Publication number
- CN101319190B CN101319190B CN2008101153935A CN200810115393A CN101319190B CN 101319190 B CN101319190 B CN 101319190B CN 2008101153935 A CN2008101153935 A CN 2008101153935A CN 200810115393 A CN200810115393 A CN 200810115393A CN 101319190 B CN101319190 B CN 101319190B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- pcr
- hybridization
- dna
- enricher
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a nucleic acid concentrator and an application thereof. The nucleic acid concentrator is obtained through connecting specific probes on the inner wall of a vessel; from 3' end to 5' end, the specific probes orderly comprise a bonding zone consisting of 25 to 150 ribonucleotides which are complemented with conservative zone of a target DNA or RNA to be tested, as well as a connecting arm consisting of 6 to 30 deoxy ribonucleotides; and the ribonucleotides at 5' end of the connecting arm is modified to be connected with the inner wall of the vessel. The nucleic acid concentrator can be used to concentrate ribonucleic acid or deoxy ribonucleic acid, thereby being applied to polymerase chain reaction (PCR) and nucleic acid testing. While carrying out nucleic acid testing, the nucleic acid concentrator has the advantages of high selectivity, high specificity, one-tube-type fast testing, low cost, strong operability and wide application range, and is especially suitable for fast analysis and testing of the gene in the organization with extremely low nucleic acid content.
Description
Technical field
The present invention relates to a kind of nucleic acid enricher and application thereof.
Background technology
(Polymerase Chain Reaction PCR) is the external nucleic acid amplification technologies that the mid-80 grows up in the polymerase chain reaction.The PCR response class is similar to the natural reproduction process of DNA, constitute by sex change-annealing-three primitive reaction steps of extension, promptly under the effect of TaqDNA polysaccharase, with dNTP is reaction raw materials, target sequence is a template, by base pairing and semiconservative replication principle, synthesize new and a template DNA chain complementary semiconservative replication chain.Pass through PCR, can in vitro goal gene or a certain dna fragmentation that will study be expanded to 100,000 and even 1,000,000 times in a few hours at one, have special, responsive, productive rate is high, quick, easy, good reproducibility, easy outstanding advantage such as automatization, PCR has been widely used in fields such as biological detection and medical diagnosis on disease.
Real-time fluorescence PCR (Real time PCR) adds fluorescence labeling probe on conventional PCR basis, realize starting template quantitatively and is qualitatively analyzed by real-time detection to each circulation products fluorescent signal in the pcr amplification reaction, have high specific and highly sensitive advantage, be widely used in fields such as the detection of pathogenic agent and medical diagnosis.
In above-mentioned two kinds of PCR reaction, the purity of template DNA directly influences the specificity and the sensitivity of detection.Method for extracting nucleic acid mainly comprises SDS method, CTAB method etc. at present, often contain impurity such as amounts of protein, polysaccharide and pigment among the DNA that these methods are extracted, both influence spectrophotometer method to the quantitative accuracy of nucleic acid concentration, also disturbed the quality and the sensitivity of follow-up DNA cloning; And these extracting method often complex steps, complicated operation, length consuming time, influenced the speed and the efficient of actual detected and diagnosis.
Summary of the invention
The purpose of this invention is to provide a kind of nucleic acid enricher and application thereof.
Nucleic acid enricher provided by the invention is to connect specific probe at the inwall of container to obtain; Described specific probe is followed successively by from 3 ' end to 5 ' end: the land of being made up of the conservative region complementary Nucleotide of 20-150 and target DNA to be measured or RNA, the connecting arm of being made up of 6-30 deoxynucleotide; Described connecting arm 5 ' terminal Nucleotide has carried out modifying to be connected with the inwall of container.
Described connecting arm can be 6-30 deoxynucleotide arbitrarily, as thymidylic acid, deoxycytidylic acid, guanine deoxyribonucleoside acid, adenyl-deoxyribonucleotide, hypoxanthine deoxyriboside acid etc.
Described conservative region is meant with species kernel acid sequence homology to be measured higher, the gene fragment of these species to be measured of energy specific recognition.
Described connecting arm specifically can be made up of 15 thymidylic acids or 15 adenyl-deoxyribonucleotides.
Described container can be any conventional containers, as the PCR reaction tubes.
Described nucleic acid enricher can be applicable to enriched nucleic acid, and as enrichment Yeast Nucleic Acid or enrichment thymus nucleic acid, the thymus nucleic acid after the enrichment can directly carry out the PCR reaction, and the Yeast Nucleic Acid after the enrichment can carry out reverse transcription earlier and carry out the PCR reaction again.
The present invention also provides the method for a kind of PCR, may further comprise the steps:
1) the DNA crude extract of testing sample and hybridization buffer are added carries out hybridization in the described nucleic acid enricher; Described hybridization is: 94-95 ℃ sex change 3-5 minute, placed on ice then 3-5 minute, then 50-68 ℃ hybridization 0.5-2 hour;
2) abandon hybridization buffer and crude extract, the washing back adds other outer PCR components of removing template, carries out the PCR reaction.
Described hybridization buffer can be the hybridization buffer of any routine, and as the hybridization solution that commerce is bought, the crossbred cording body that described hybridization buffer and described DNA crude extract are formed is as follows:
Hybridization system 16 μ l
20×SSC→3×SSC 2.4μl
1％SDS→0.2％SDS 3.2μl
Methane amide → 25% 4 μ l
50×Denhardt’s→5× 1.6μl
DNA crude extract 4.8 μ l
Described hybridization specifically can be: 95 ℃ of sex change 5 minutes, placed on ice then 5 minutes, and 68 ℃ of hybridization is 2 hours then.
Described washing specifically can be: 2 * SSC washed twice, 0.2 * SSC washed twice, deionized water wash 3 times.
Described method can be applicable to testing goal nucleic acid.
Described purpose nucleic acid can be arbitrary sequence, and when described purpose nucleic acid was tomato bacterial canker germ DNA, the described specific probe in the described nucleic acid enricher was shown in the sequence 1 of sequence table; When described purpose nucleic acid was paulownia clump branch pytoplasma DNA, the sequence of described specific probe was shown in the sequence 2 of sequence table.
Nucleic acid detection method provided by the invention has the following advantages:
1) high-selectivity enrichment nucleic acid
In traditional DNA extraction method, extract in the product and contain impurity such as amounts of protein, polysaccharide, pigment usually, had a strong impact on the sensitivity of the accurate and follow-up PCR reaction of nucleic acid quantification.The present invention adopts the identification of sequence-specific nucleic acid probe and target dna, and by hybridization, fixing, impurity such as remaining protein, polysaccharide are removed in washing, optionally catches, the enrichment target nucleic acid.
2) high specific amplification of nucleic acid
In traditional DNA extraction method, the nucleic acid of extraction is genomic nucleic acids often, and wherein major part is unwanted, and its existence will disturb PCR to detect, and the non-specific amplification product occur.The present invention adopts the identification of sequence-specific nucleic acid probe and target dna, makes that non-specific nucleic acid fragment can not enrichment, has improved the high specific of detection of nucleic acids.
3) a tubular type rapid detection nucleic acid
Usually the detection of nucleic acid comprises two key steps, i.e. the extraction of DNA and PCR reaction.The extraction purifying of nucleic acid of the present invention and pcr amplification, detection are carried out in a reaction tubes, easy and simple to handle, avoid the nucleic acid in a plurality of reaction vessels, to shift, reduced the generation that PCR detects environmental pollution during especially real-time fluorescence PCR detects, avoided occurring false positive results.
4) with low cost, workable
The present invention's common polypropylene tube that has drawn from promptly can be used for pcr analysis and detects through simply modifying, handling.
5) applied widely
The present invention is applicable to the PCR rapid detection of specific nucleic acid in microorganisms such as bacterium, virus and plant tissue and the tissue.
6) real-time analysis that is applicable to gene in the extremely low tissue of nucleic acid content detects
For organizing the extremely low situation of amplifying nucleic acid content, by the highly purified DNA of the very difficult acquisition of the extraction and separation method of routine.The present invention adopts the sequence-specific probe, optionally catches target dna, has improved the sensitivity of subsequent detection, so this method is particularly useful for the real-time analysis detection of gene in the extremely low tissue of nucleic acid content.
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.
Description of drawings
Fig. 1 is XPS figure as a result
Fig. 2 is a tomato bacterial canker germ pcr amplification electrophorogram
Fig. 3 is a paulownia clump branch pytoplasma pcr amplification electrophorogram
Embodiment
Experimental technique among the following embodiment if no special instructions, is ordinary method.
The tubular type qualitative PCR of embodiment 1, tomato bacterial canker germ detects
One, experiment material
EDC (Sigma company), NHS (Aldrich company), concentrated hydrochloric acid (Beijing chemical reagents corporation),
Potassium permanganate (Beijing chemical reagents corporation), 10 * PCR buffer (Dalian TaKaRa company),
DNTP (Dalian TaKaRa company), Taq enzyme (Dalian TaKaRa company),
DL2000 DNA Marker (Dalian TaKaRa company),
0.2mlPCR pipe (Haimen City, Jiangsu three and experiment glass instrument factory of Xinhua, article No.: 34700501),
2 * hybridization buffer (Mei Laibo biotechnology company),
Primer is synthetic automatically on ABI 3900 synthesizers, and sequence is as follows:
P1：5′-CGCGTCAGGCGTCTGTT-3′；
P2：5′-AGTGGACGCGAGCATC-3′。
The amino probe of specificity is synthetic automatically on ABI 3900 synthesizers, and sequence is as follows:
NH
2_ Prob:5 '-NH
2-C6-T15-AGTCGTAACAAGGTAGCCGT-3 ' (sequence 1 of sequence table).
Two, the preparation of nucleic acid enriching pipe and sign
1, the preparation of nucleic acid enriching pipe
The PCR that gets the 0.2ml specification manages one, adds potassium permanganate/hydrochloric acid soln (0.25/0.1mol L
-1) 50 μ L, handled 8 hours for 45 ℃, use 37% (W/W) hydrochloric acid soln flush away surface impurity then, use distilled water wash at last, dry.Add EDC and each 50 μ L of NHS that concentration is 200mM respectively, room temperature oscillatory reaction 4 hours, temperature is 28 ℃, rotating speed 200rpm.Reaction solution is abandoned in suction, distilled water wash 3 times, and the 5 '-amino specific probe 2 μ L of adding 2mM, borate buffer solution 100 μ L, room temperature oscillatory reaction 8 hours, temperature is 28 ℃, and rotating speed 200rpm inhales and abandons reaction solution, and distilled water wash 3 times dries.
2, the sign of nucleic acid enriching pipe
Adopt the carboxylated degree in x-ray photoelectron power spectrum (XPS) method characterisation of nucleic acids enrichment pipe surface, see Fig. 1.Among Fig. 1, A is the nucleic acid enriching pipe of step 1 preparation; B is a untreated PCR pipe (control sample).As seen from the figure, the C of control sample: O=98.35: 1.65, the C of the nucleic acid enriching pipe of step 1 preparation: O=93.86: 6.14, surperficial carboxyl ratio is 1.1 * 10
15/ cm
2
Three, the tubular type qualitative PCR of tomato bacterial canker germ detects
1, the extraction of the total DNA of vegetable material
Extract total DNA of catch an illness tomato seeds and healthy tomato seeds respectively.Get 0.1g catch an illness tomato seeds and healthy tomato seeds respectively, liquid nitrogen grinding is to powder, is transferred to mixing in the CTAB damping fluid (400 μ L) of preheating, and 65 ℃, 30 minutes; Add phenol/chloroform/primary isoamyl alcohol (25: 24: 1) extracting 1 time; Get supernatant ,-20 ℃ of preservations.
2, tomato bacterial canker germ DNA's catches
Get respectively and catch an illness seed and each 50 μ L of healthy seed supernatant liquor in the PCR enrichment pipe of different step 2 preparations behind phenol/chloroform/primary isoamyl alcohol extracting 1 time, add equal-volume 2 * hybridization buffer, 95 ℃ of sex change 3 minutes were put 3 minutes on ice immediately, and 50 ℃ of hybridization is 0.5 hour then.Hybridization solution and crude extract are abandoned in suction, 2 * SSC washed twice, and 0.2 * SSC washed twice, deionized water wash 3 times is directly used in pcr amplification and detects.
3, pcr amplification
The setting of detector tube, control tube:
Detector tube: with the hybridization enrichment PCR pipe of the seed DNA extract of catching an illness carry out pcr amplification;
Control tube: with the hybridization enrichment PCR pipe of healthy seed DNA extract carry out pcr amplification.
The pcr amplification condition:
10×PCR?Buffer 5uL
dNTP?Mix 4uL
P1 1uL
P2 1uL
Taq enzyme 0.5uL
ddH
2O 38.5uL
Total amount 50uL
The PCR loop parameter:
95 ℃ of sex change, 3min
Amplification (35 circulations) 94 ℃, 15sec
58℃，30sec
72℃，45sec
72 ℃ of final extensions, 8min
4, the electrophoresis detection of PCR product
Adopt the sepharose of TBE preparation 1.5%, the EB concentration in the glue is 0.5 μ g/ μ L, and PCR product applied sample amount is every hole 6 μ L, and electrophoretic molecular weight reference is DL2000.Deposition condition is 100V, and 30 minutes, electrophoresis result adopted the gel imaging system analysis.
Electrophoresis result as shown in Figure 2.Among Fig. 2, M:DL2000; 1: the pcr amplification product of control tube; 2: the pcr amplification product of detector tube.As seen from the figure, detector tube can amplify the gene fragment of tomato bacterial canker germ DNA, and clip size is 270bp, and control tube does not detect.The result shows that nucleic acid enriching pipe of the present invention can effectively be caught target dna, realizes tomato bacterial canker germ one tubular type nucleic acid rapid detection.
One tubular type qualitative PCR of embodiment 2, paulownia clump branch pytoplasma detects
One, experiment material
EDC (Sigma company), NHS (Aldrich company), concentrated hydrochloric acid (Beijing chemical reagents corporation),
Potassium permanganate (Beijing chemical reagents corporation), 10 * PCR buffer (Dalian TaKaRa company),
DNTP (Dalian TaKaRa company), Taq enzyme (Dalian TaKaRa company),
DL2000 DNA Marker (Dalian TaKaRa company),
0.2mlPCR pipe (Haimen City, Jiangsu three and experiment glass instrument factory of Xinhua, article No.: 34700501),
2 * hybridization buffer (Mei Laibo biotechnology company),
Primer is synthetic automatically on ABI 3900 synthesizers, and sequence is as follows:
PaWB(s)：TTATTGGGCGTAAAGGGTG；
PaWB(As)：CGTAACAGCCATTGTATCA。
The amino probe of specificity is synthetic automatically on ABI 3900 synthesizers, and sequence is as follows:
5 '-NH2-C6-A15-GGTCTAAGTGCAATGCTCAACATTGTGATGCTATAAAAACTGTTT AGCTAGAGTAAGATAGAGGCAAGTGGAATTCCATGTGTAGTGGTAAAATGCGTAAA TATATGGAGGAACACCAGTAGCGAAGGCGGCTTGCTGGGTCTTTACTGA-3 ' (sequence 2 of sequence table)
Two, the preparation of nucleic acid enriching pipe and sign
Three, a tubular type qualitative PCR of paulownia clump branch pytoplasma detects
1, the extraction of the total DNA of vegetable material
Extract total DNA of the paulownia blade catch an illness and healthy paulownia blade respectively.Get the paulownia blade that 0.2g catches an illness and the paulownia blade of 0.2g health respectively, liquid nitrogen grinding is to powder, is transferred to mixing in the CTAB damping fluid (400 μ L) of preheating, and 65 ℃, 30min; Add phenol/chloroform/primary isoamyl alcohol (25: 24: 1) extracting 1 time; Get supernatant ,-20 ℃ of preservations.
2, paulownia clump branch pytoplasma DNA's catches
Get respectively and catch an illness blade and healthy leaves supernatant liquor 50 μ L in the PCR enrichment pipe of different step 2 preparations behind phenol/chloroform/primary isoamyl alcohol extracting 1 time, add equal-volume 2 * hybridization buffer, 95 ℃ of sex change 5 minutes were put 5 minutes on ice immediately, and 68 ℃ of hybridization is 2 hours then.Hybridization solution and crude extract are abandoned in suction, 2 * SSC washed twice, and 0.2 * SSC washed twice, deionized water wash 3 times is directly used in pcr amplification and detects.
3, pcr amplification
The setting of detector tube, control tube:
Detector tube: with the hybridization enrichment PCR pipe of the leaf DNA extract of catching an illness carry out pcr amplification.
Control tube: with the hybridization enrichment PCR pipe of healthy leaves DNA extract carry out pcr amplification.
The pcr amplification condition:
10×PCR?Buffer?5?uL
dNTP?Mix 4uL
PaWB(s) 1uL
PaWB(As) 1uL
Taq enzyme 0.5uL
ddH
2O 38.5uL
Total amount 50uL
The PCR loop parameter:
95 ℃ of sex change, 5min
Amplification (35 circulations) 94 ℃, 1min
60，1min
72，1.5min
72 ℃ of final extensions, 8min
4, the electrophoresis detection of PCR product
Adopt the sepharose of TBE preparation 1.5%, the EB concentration in the glue is 0.5 μ g/ μ L, and PCR product applied sample amount is every hole 6 μ L, and electrophoretic molecular weight reference is DL2000.Deposition condition is 100V, and 30 minutes, electrophoresis result adopted the gel imaging system analysis.
Electrophoresis result as shown in Figure 3.Among Fig. 3, M:DL2000; 1: the pcr amplification product of control tube; 2: the pcr amplification product of detector tube.As seen from the figure, detector tube can amplify the gene fragment of paulownia clump branch pytoplasma, and clip size is 680bp, and control tube does not detect.The result shows that nucleic acid enriching pipe of the present invention can effectively be caught target dna, realizes paulownia clump branch pytoplasma one tubular type nucleic acid rapid detection.
Sequence table
＜110〉China Inst. of Quarantine Inspection Sciences
<120>CGGNARY81444
＜130〉a kind of nucleic acid enricher and application thereof
<160>2
<210>1
<211>35
<212>DNA
＜213〉artificial sequence
<400>1
tttttttttt?tttttcggag?aaggtcggtc?ctgaa 35
<210>2
<211>165
<212>DNA
＜213〉artificial sequence
<400>2
aaaaaaaaaa?aaaaaggtct?aagtgcaatg?ctcaacattg?tgatgctata?aaaactgttt 60
agctagagta?agatagaggc?aagtggaatt?ccatgtgtag?tggtaaaatg?cgtaaatata 120
tggaggaaca?ccagtagcga?aggcggcttg?ctgggtcttt?actga 165
Claims (8)
1. nucleic acid enricher is that inwall at container connects specific probe and obtains; Described specific probe is followed successively by from 3 ' end to 5 ' end: the land of being made up of the conservative region complementary Nucleotide of 25-150 and target DNA to be measured or RNA, by 15 thymidylic acids or 15 connecting arms that adenyl-deoxyribonucleotide is formed; Described connecting arm 5 ' terminal Nucleotide has carried out modifying to be connected with the inwall of container;
Described container is the PCR reaction tubes.
2. the application of the described nucleic acid enricher of claim 1 in enriched nucleic acid.
3. application as claimed in claim 2 is characterized in that: described nucleic acid is Yeast Nucleic Acid or thymus nucleic acid.
4. the method for a PCR may further comprise the steps:
1) the DNA crude extract of testing sample and hybridization buffer are added in the described nucleic acid enricher of claim 1 carries out hybridization; Described hybridization is: 94-95 ℃ sex change 3-5 minute, placed on ice then 3-5 minute, then 50-68 ℃ hybridization 0.5-2 hour;
2) abandon hybridization buffer and crude extract, the washing back adds other outer PCR components of removing template, carries out the PCR reaction.
5. method as claimed in claim 4 is characterized in that: described hybridization is: 95 ℃ of sex change 5 minutes, placed on ice then 3 minutes, and 68 ℃ of hybridization is 2 hours then.
6. as claim 4 or 5 described methods, it is characterized in that: described washing is: 2 * SSC washed twice, 0.2 * SSC washes twice, deionized water wash 3 times.
7. the application of arbitrary described method in testing goal nucleic acid in the claim 4 to 6.
8. application as claimed in claim 7 is characterized in that: described purpose nucleic acid is tomato bacterial canker germ DNA, and the described specific probe in the described nucleic acid enricher is shown in the sequence 1 of sequence table; Described purpose nucleic acid is paulownia clump branch pytoplasma DNA, and the sequence of described specific probe is shown in the sequence 2 of sequence table.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101153935A CN101319190B (en) | 2008-06-23 | 2008-06-23 | Nucleic acid enricher and uses thereof |
| PCT/CN2009/000270 WO2009155772A1 (en) | 2008-06-23 | 2009-03-13 | Nucleic acid enrichment device and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101153935A CN101319190B (en) | 2008-06-23 | 2008-06-23 | Nucleic acid enricher and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101319190A CN101319190A (en) | 2008-12-10 |
| CN101319190B true CN101319190B (en) | 2011-05-25 |
Family
ID=40179466
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101153935A Expired - Fee Related CN101319190B (en) | 2008-06-23 | 2008-06-23 | Nucleic acid enricher and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN101319190B (en) |
| WO (1) | WO2009155772A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9133510B2 (en) * | 2012-10-15 | 2015-09-15 | Life Technologies Corporation | Compositions, methods, systems and kits for target nucleic acid enrichment |
| CN103773835A (en) * | 2012-10-23 | 2014-05-07 | 启新生物科技有限公司 | Oligonucleotide probe and biochip for identification of Mycobacterium and identification method |
| CN108823312A (en) * | 2018-07-05 | 2018-11-16 | 苏州科诺医学检验所有限公司 | The quickly method of detection ALK fusion gene and enrichment probe and detection primer |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1521269A (en) * | 2003-01-28 | 2004-08-18 | 国家质量监督检验检疫总局动植物检疫 | Method for detecting nucleic acid based on hybridization trapping in single tube |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100580092C (en) * | 2007-03-08 | 2010-01-13 | 中国检验检疫科学研究院动植物检疫研究所 | Gene chip for detection and typing of bird flu virus |
-
2008
- 2008-06-23 CN CN2008101153935A patent/CN101319190B/en not_active Expired - Fee Related
-
2009
- 2009-03-13 WO PCT/CN2009/000270 patent/WO2009155772A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1521269A (en) * | 2003-01-28 | 2004-08-18 | 国家质量监督检验检疫总局动植物检疫 | Method for detecting nucleic acid based on hybridization trapping in single tube |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101319190A (en) | 2008-12-10 |
| WO2009155772A1 (en) | 2009-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bernad et al. | A novel RT-PCR approach for detection and characterization of citrus viroids | |
| CN108411036A (en) | A kind of quickly detection first, influenza B virus kit for detecting nucleic acid and method | |
| CN111560482A (en) | Detection method based on CRISPR/Cas and nucleic acid test paper and human papilloma virus detection kit | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN109486923B (en) | Primer system for sequencing multiple amplicons, application thereof and method for constructing sequencing library | |
| CN103397105B (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN110567951A (en) | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof | |
| CN110643693A (en) | Primer, probe, kit and detection method for detecting Mcr by RAA fluorescence method | |
| CN101319190B (en) | Nucleic acid enricher and uses thereof | |
| CN102719542B (en) | Simultaneous amplification and testing reagent kit for VC (vibrio cholerae) | |
| CN103388033A (en) | Enterovirus type 71 (EV71) real-time fluorescent nucleic acid isothermal amplification detection kit | |
| CN101736078A (en) | Method for detecting viable bacteria of Mycobacterium tuberculosis through isothermal amplification of nucleic acid and kit | |
| CN1936550A (en) | Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof | |
| CN113774053B (en) | Nucleic acid probe and kit for simultaneously detecting various tomato viruses and application of nucleic acid probe and kit | |
| CN111521781A (en) | Detection kit for SARS-CoV-2 nucleic acid of new coronary pneumonia virus and detection method thereof | |
| Faggioli et al. | Simultaneous detection of stone or pome fruit viroids by single tube-RT-PCR | |
| CN103388032A (en) | Coxsackie virus type A16 (CA16) real-time fluorescent nucleic acid isothermal amplification detection kit | |
| CN111996274B (en) | Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing | |
| CN101864489B (en) | Method for gathering foreign DNA in transgenosis product | |
| CN110511879A (en) | The building of saccharomyces cerevisiae engineered yeast and the preparation method of betulinic acid | |
| CN101760563A (en) | Classical swine fever virus detecting method and kit thereof by nucleic acid isothermal amplication | |
| CN110387399B (en) | Method for linearly amplifying double-stranded DNA and application | |
| CN106957915A (en) | Detection primer, kit and the quantitative detecting method of apple tree/Fungus of Pear Canker Disease bacterium | |
| CN111534603A (en) | Method for identifying aedes albopictus by using fluorescent RPA | |
| Huang et al. | One-PCR-tube approach for in situ DNA isolation and detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110525 Termination date: 20130623 |
|
| C49 | Reinstatement of patent right or utility model | ||
| RR01 | Reinstatement of patent right |
Former decision: cessation of patent right due to non-payment of the annual fee Former decision publication date: 20140813 |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110525 Termination date: 20170623 |