CN1936550A - Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof - Google Patents

Abstract

The present invention provides a kind of test kit for detecting prawn infectious subcutaneous and hematopoietic necrosis virus (IHHNV) with isothermal branch amplification, which comprises DNA extraction reagent, hybridization solution C, probe capture reagent, washing solution F, connecting solution G, Isothermal branch amplification reaction solution H, chromogenic reagent I; especially a pair of labeled probes for detecting infectious subcutaneous and hematopoietic tissue necrosis virus. A method for detecting IHHNV using the kit is further provided. The invention has strong specificity and the same high sensitivity as the PCR detection method, but does not need an expensive PCR instrument, but only needs a cheap constant temperature metal bath (the price is only 5-10% of that of the PCR instrument) or a constant temperature water bath. And the results do not need to be observed by gel electrophoresis, but fluorescent dyes can be used directly to judge the test results by visual observation, which is simple and fast. It can be widely used in scientific research, especially in the detection of IHHNV in breeding sites.

Description

Kit and method for detecting shrimp infectious subcutaneous and hematopoietic necrosis virus

technical field

The present invention relates to a kind of test kit for detection of infectious subcutaneous and hematopoietic necrosis virus (IHHNV) of prawns by isothermal branch amplification (Isothermal Ramification Amplification, referred to as RAM), and further relates to the rapid detection of infectious subcutaneous and hematopoietic necrosis virus (IHHNV) of prawns using the kit. Methods of hematopoietic necrosis virus.

Background technique

Shrimp aquaculture is the pillar industry of marine aquaculture in my country. In 1993, the outbreak of aquaculture prawn diseases in my country brought serious economic losses to the entire prawn aquaculture industry. Related industries such as shrimp processing and foreign trade exports were also seriously affected. In recent years, my country has introduced new species of prawns such as Litopenaeus v vannamei (commonly known as Litopenaeus vannamei) and Litopenaeus stylirostris (commonly known as blue prawn), which are native to South America, for farming. The culture of Penaeus prawns has achieved remarkable success, which has promoted the rapid recovery of the production of Penaeus prawns in my country.

Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV for short), also known as Runt-deformity syndrome virus, was first discovered in 1981 in Hawaiian cultured Litopenaeus stylicerata shrimp virus. The virus mainly infects Litopenaeus stylirostris and Litopenaeus vannamei, causing the cumulative mortality of Litopenaeus stylirostris larvae and larvae up to 80% and causing slow growth and deformity of Litopenaeus vannamei, which seriously reduces the production of Litopenaeus vannamei. Cause 10-50% economic loss. IHHNV is a single-stranded DNA virus. According to the characteristics of its genome and the classification system released by the International Committee on Taxonomy of Viruses (ICTV) in 2002, the virus belongs to the genus Brevidensovirus of the family Parvoviridae. IHHNV is widely spread in Litopenaeus vannamei and Litopenaeus stylirostris cultured in the Americas, and different strains and variants have not been found so far. With the introduction of these two kinds of prawns in my country for artificial breeding, the virus has also spread to our country, posing a serious threat to my country's prawn farming industry.

In the past, there were mainly three methods for the detection of IHHNV in prawns: 1. Electron microscopy, which is costly, time-consuming, and low-sensitivity, and is not suitable for on-site detection; 2. Gene probe method, which is expensive and complicated to operate; 3. Polymerase chain method Reaction method (PCR method), which is faster and more sensitive than the previous two methods, but requires an expensive PCR machine.

content of the invention

The purpose of the present invention is to provide a kit for detecting infectious subcutaneous and hematopoietic tissue necrosis virus of prawns with strong specificity, high sensitivity and low cost, especially to provide a pair of detection kits for detecting infectious subcutaneous and hematopoietic tissue It provides a labeled probe for necrosis virus, and provides a method for rapid detection of infectious subcutaneous and hematopoietic necrosis virus of prawns using a kit, thereby providing scientific basis and guidance for the healthy breeding of prawns.

The main principles of the present invention are: (1) specially designed C-probe (composed of three special regions: namely, two sequences complementary to the target gene are located at the 5' and 3' ends, and the middle is a common connection region) Hybridize the capture probe with the target gene, and capture the hybrid with magnetic beads; (2) wash the unhybridized probe; (3) connect the 5' and 3' ends of the C-probe into a closed circle with ligase; (4) Under isothermal conditions, the C-probe grows exponentially through primer extension, displacement, and amplification, resulting in a large number of branched complexes, and obtaining multimeter double-stranded DNA of various lengths, which can be observed by fluorescent dyes Amplify results.

The present invention relates to the kit for detecting the infectious subcutaneous and hematopoietic tissue necrosis virus of prawns by using the isothermal branch amplification method, the reagents of which include:

(1) DNA extraction reagent: containing tissue lysate A and DNA adsorption solution B,

Tissue lysate A contains 4M guanidine isothiocyanate (GTC), 25mM sodium citrate, 0.5% sodium lauryl sarcosine and 0.1M β-mercaptoethanol;

DNA adsorption solution B is 50% magnetic beads (Golden Beads) suspension;

(2) Hybridization solution C:

Hybridization solution C contains 2M guanidine isothiocyanate (GTC), 0.5% bovine serum albumin (BSA), 80mM ethylenediaminetetraacetic acid (EDTA), 400mM trishydroxymethylaminomethane-hydrochloric acid (Tris- HCl), 0.5% sodium lauryl sarcosine, 2-10 nM IHHNV-C-probe and 20-100 nM IHHNV-capture probe;

(3) Probe capture reagent: including magnetic bead D and probe capture solution E, magnetic bead D is streptavidin (SAV) immunomagnetic beads with a concentration of 4 mg/ml;

Probe capture solution E contains 10mM trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl), 1mM ethylenediaminetetraacetic acid (EDTA) and 1-2MNaCl (sodium chloride) at pH7.5;

(4) Washing solution F: Tris-hydrochloric acid (Tris-HCl) containing 10mM pH8.0 and 1mM ethylenediaminetetraacetic acid (EDTA);

(5) Ligation solution G: Taq DNA ligase containing 10-20 activity units (U) and 1× ligase (ligase) buffer,

1× ligase buffer contains 20mM Tris-HCl pH7.6, 25mMKAcO (potassium acetate), 10mMMgAcO (magnesium acetate), 10mM dithiothreitol (DTT) , 1mM dihydrouracil dehydrogenase (NAD) and 0.1% Triton X-100 (Triton X-100);

(6) Isothermal branch amplification (RAM) reaction solution H: containing 5-15U Bst DNA polymerase, 10× Thermopol reaction buffer, 200-1000uMdNTP (a mixture of four deoxynucleotides), 0.8-1.5uM forward Primer Prime-1, 0.8-1.5uM reverse primer Prime-2 and 50-200ng (ng) T4 phage gene 32 encoded protein (T4 Gene 32Protein);

10× Thermopol reaction buffer contains 200mM Tris-hydrochloric acid (Tris-HCl) pH8.8, 100mM KCl (potassium chloride), 100mM (NH ₄ ) ₂ SO ₄ (ammonium sulfate), 20mM MgSO ₄ ( magnesium sulfate) and 1% Triton X-100 (Triton X-100);

(7) Chromogen I: 1% fluorescent dye SYBR GREEN I (imported material, only English name) wherein the IHHNV-C-probe sequence in the hybridization solution C is:

5'-Phospho-CAGCAAAGGTAACTCCCCAAATAGGCGATGTCTGTGTATCTGCTAACCAAGAGCAACTACACGAATTCTCGATTAGGTTACTGCGATTAGCACAAGCGTAGTCGCTTCAGCTTCGGCTCTGG

The IHHNV-capture probe sequence in hybridization solution C is:

5'-Biotin-AAGATACGAAAGCCGTTCAATACCGTATCTGATAAGATAGAGTAT

The forward primer Prime-1 sequence in the isothermal branch amplification (RAM) reaction solution H is:

5'-CTTGTGCTAATCGCAGTAACCTAAT

The reverse primer Prime-2 sequence in the isothermal branch amplification (RAM) reaction solution H is:

5'-ACCAAGAGCAACTACACGAATTC.

The optimal composition of 50ul per tube of isothermal branch amplification (RAM) reaction solution H mentioned above is: 5.0ul 10× Thermopol reaction buffer, 6.0ul 2.5mM dNTP (mixture of four deoxynucleotides), 2.5ul 20uM Forward primer Prime-1, 2.5ul 20uM reverse primer Prime-2, 0.8ul 8U/ul Bst DNA polymerase, 2ul 100ng/ul T4 Gene32 Protein and 31.2ul ddH ₂ O (sterilized double distilled water).

The method for detecting IHHNV using the above-mentioned isothermal branch amplification detection kit for infectious subcutaneous and hematopoietic necrosis virus of prawns comprises the following steps in turn:

(1) Extraction of Shrimp Infectious Subcutaneous and Hematopoietic Necrosis Virus DNA:

A. Take 25-30mg of the sample tissue to be tested in a 1.5ml centrifuge tube, add 200ul tissue lysate A, mash;

B. Use a desktop centrifuge at 12000 rpm for 3 minutes, take the supernatant, and place it in a 1.5ml centrifuge tube;

C. Add 15ul DNA adsorption solution B (contains white substance, shake well before use), let stand at room temperature for 5 minutes, shake well 3 times during the period;

D. Centrifuge at 10000 rpm for 15 seconds, suck up the supernatant with a pipette, add 200ul of 70% ethanol, shake gently with the pipette tip to fully suspend the precipitate;

E. Centrifuge at 10,000 rpm for 30 seconds, suck up the supernatant with a pipette, put the precipitate in a constant temperature metal bath and bake at 60°C for 3 minutes, and open the centrifuge tube cover;

F. Add 20ulddH ₂ O, shake well, centrifuge at 10,000 rpm for 30 seconds, and the supernatant is the virus DNA of the sample to be tested;

(2) Isothermal branch amplification of shrimp infectious subcutaneous and hematopoietic necrosis virus:

A. Add 80ul hybridization solution C and 1ul virus DNA of the sample to be tested in a 0.5ml centrifuge tube, and place it on a constant temperature metal bath at 60°C for 1 hour;

B. Add 5ul magnetic beads D and 80ul probe capture solution E, mix well, and let stand at room temperature for 20 minutes;

C. Put the centrifuge tube on the magnetic separation rack, suck up the supernatant with a pipette, and wash it twice with washing solution F, 200ul each time;

D. Add 20ul of linking solution G to the washed magnetic beads, and place on a constant temperature metal bath at 60°C for 20 minutes;

E. Put the centrifuge tube on the magnetic separation rack, and suck off the supernatant with a pipette;

F. Add 50ul RAM reaction solution H, and place it on a constant temperature metal bath at 65°C for 45 minutes;

(3) Color detection

Put the reacted centrifuge tube on the magnetic separation rack, use a pipette to absorb 25ul supernatant, put it in a 0.5ml centrifuge tube, add 1ul chromogen I, and directly observe the color change with the naked eye, if the color is yellow , indicating that the sample to be tested does not carry the IHHNV virus. If the color turns green, it indicates that the sample carries the IHHNV virus.

The advantages and positive effects of the present invention are: the detection kit and detection method of the isothermal branch amplification of IHHNV have been established, and the specific probe has been designed according to the DNA sequence of the nonstructural protein 2 in the gene conservative region of IHHNV in this kit, so as to Ensure the reliability of detecting IHHNV strains from different sources. This technology has strong specificity and has the same high sensitivity as the PCR detection method, but does not need expensive PCR instrument, only need cheap constant temperature metal bath (price is only 5-10% of PCR instrument) or constant temperature water bath. And the results do not need to be observed by gel electrophoresis, but fluorescent dyes can be used directly to judge the test results by visual observation, which is simple and fast. It can be widely used in scientific research, especially in the detection of IHHNV in breeding sites.

Detailed ways

The following examples are further illustrations of the present invention and should not be regarded as limiting the present invention.

Prepare the isothermal branch amplification detection kit for shrimp infectious subcutaneous and hematopoietic necrosis virus according to the following formula: tissue lysate A: 4MGTC, 25mM sodium citrate, 0.5% sodium lauryl sarcosine and 0.1M β-mercaptoethanol

DNA adsorption solution B: 50% Golden Beads suspension

Hybridization solution C: 2M GTC, 0.5% BSA, 80mM EDTA, 400mM Tris-HCl pH7.5, 0.5% dodecyl

Sodium sarcosinate, 2.5nM IHHNV-C-probe and 25nM IHHNV-capture probe

Magnetic beads D: 4mg/ml SAV immunomagnetic beads

Probe capture solution E: 10mM Tris-HCl pH7.5, 1mM EDTA and 2M NaCl

Wash solution F: 10mM Tris-HCl pH8.0 and 1mM EDTA

Ligation solution G: 20ul 1×ligase buffer and 0.25ul Taq DNA ligase (40U/ul)

RAM reaction solution H: 6ul 2.5mM dNTP, 5ul 10×Thermopol reaction buffer, 2.5ul 20uM forward primer Prime-1, 2.5ul 20uM reverse primer Prime-2, 0.8ul 8U/ul Bst DNA polymerase, 2ul 100ng /ul T4 Gene32 Protein and 31.2ul ddH ₂ O (sterilized double distilled water).

Color developer I: 1% SYBR GREEN I

Follow the procedure below for testing:

(1) Extraction of Shrimp Infectious Subcutaneous and Hematopoietic Necrosis Virus DNA

A. Take 25-30mg of the sample tissue to be tested in a 1.5ml centrifuge tube, add 200ul tissue lysate A, mash;

B. Use a desktop centrifuge at 12000 rpm for 3 minutes, take the supernatant, and place it in a 1.5ml centrifuge tube;

C. Add 15ul DNA adsorption solution B (contains white substance, shake well before use), let stand at room temperature for 5 minutes, shake well 3 times during the period;

D. Centrifuge at 10000 rpm for 15 seconds, suck up the supernatant with a pipette, add 200ul of 70% ethanol, shake gently with the pipette tip to fully suspend the precipitate;

E. Centrifuge at 10000 rpm for 30 seconds, and suck off the supernatant with a pipette. Put the precipitate in a constant temperature metal bath and bake at 60°C for 3 minutes (open the cap of the centrifuge tube);

F. Add 20ulddH ₂ O, shake well, centrifuge at 10,000 rpm for 30 seconds, and the supernatant is the viral DNA of the sample to be tested.

(2) Isothermal Branch Amplification of Shrimp Infectious Subcutaneous and Hematopoietic Necrosis Virus

A. Add 80ul hybridization solution C and 1ul virus DNA of the sample to be tested in a 0.5ml centrifuge tube, and place it on a constant temperature metal bath at 60°C for 1 hour;

B. Add 5ul magnetic beads D and 80ul probe capture solution E, mix well, and let stand at room temperature for 20 minutes;

C. Put the centrifuge tube on the magnetic separation rack, suck up the supernatant with a pipette, and wash it twice with washing solution F, 200ul each time;

D. Add 20ul of linking solution G to the washed magnetic beads, and place on a constant temperature metal bath at 60°C for 20 minutes;

E. Put the centrifuge tube on the magnetic separation rack, and suck off the supernatant with a pipette;

F. Add 50ul RAM reaction solution H, and place it on a constant temperature metal bath at 65°C for 45 minutes

(3) Color detection

Put the reacted centrifuge tube on the magnetic separation rack, use a pipette to absorb 25ul supernatant, put it in a 0.5ml centrifuge tube, add 1ul chromogen I, and directly observe the color change with the naked eye, if the color is yellow , indicating that the sample to be tested does not carry the IHHNV virus. If the color turns green, it indicates that the sample carries the IHHNV virus.

Claims (3)

1. A test kit for detecting prawn infectious subcutaneous and hematopoietic tissue necrosis virus with isothermal branch amplification method, its reagent comprises: (1) DNA extraction reagent: containing tissue lysate A and DNA adsorption solution B, Tissue lysate A contains 4M guanidine isothiocyanate, 25mM sodium citrate, 0.5% sodium lauryl sarcosine and 0.1M β-mercaptoethanol; DNA adsorption solution B is 50% magnetic bead suspension; (2) Hybridization solution C: Hybridization solution C contains 2M guanidine isothiocyanate, 0.5% bovine serum albumin, 80mM ethylenediaminetetraacetic acid, 400mM tris-hydrochloric acid at pH7.5, 0.5% sodium lauryl sarcosine, 2-10 nM IHHNV-C-probe and 20-100 nM IHHNV-capture probe; (3) Probe capture reagent: including magnetic beads D and probe capture solution E, Magnetic beads D are streptavidin immunomagnetic beads with a concentration of 4 mg/ml; Probe capture solution E contains 10mM tris-hydrochloric acid at pH7.5, 1mM ethylenediaminetetraacetic acid and 1-2MNaCl; (4) Washing solution F: Tris-hydrochloric acid containing 10mM pH8.0 and 1mM ethylenediaminetetraacetic acid; (5) Ligation solution G: Taq DNA ligase containing 10-20 activity units and 1× ligase buffer, 1× Ligase buffer contains 20mM tris-hydrochloric acid pH7.6, 25mMKAcO, 10mMMgAcO, 10mM dithiothreitol, 1mM dihydrouracil dehydrogenase and 0.1% triton X-100; (6) Isothermal branch amplification reaction solution H: containing 5-15U Bst DNA polymerase, 10×Thermopol reaction buffer, 200-1000uMdNTP, 0.8-1.5uM forward primer Prime-1, 0.8-1.5uM reverse primer Prime -2 and 50-200ng T4 phage gene 32 encoded protein; 10×Thermopol reaction buffer contains 200 mM Tris-hydrochloric acid pH8.8, 100 mM KCl, 100 mM (NH ₄ ) ₂ SO ₄ , 20 mM MgSO ₄ and 1% Triton X-100; (7) Chromogen I: 1% fluorescent dye SYBR GREEN I; wherein the IHHNV-C-probe sequence in the hybridization solution C is: 5'-phospho-CAGCAAAGGTAACTCCCCAAATAGGCGATGTCTGTGTATCTGCTAACCAAGAGCAACTACACGAATTCTCGATTAGGTTACTGCGATTAGCACAAGCGTAGTCGCTTCAGCTTCGGCTCTGG; The IHHNV-capture probe sequence in hybridization solution C is: 5'-Biotin-AAGATACGAAAGCCGTTCAATACCGTATCTGATAAGATAGAGTAT; The forward primer Prime-1 sequence in the isothermal branch amplification reaction solution H is: 5'-CTTGTGCTAATCGCAGTAACCTAAT; The reverse primer Prime-2 sequence in the isothermal branch amplification reaction solution H is: 5'-ACCAAGAGCAACTACACGAATTC. 2. according to the kit described in claim 1, it is characterized in that the composition of every tube 50ul of isothermal branch amplification reaction solution H is: 5.0ul 10× Thermopol reaction buffer, 6.0ul 2.5mM dNTP, 2.5ul 20uM forward Primer Prime-1, 2.5ul 20uM Reverse Primer Prime-2, 0.8ul 8U/ul Bst DNA Polymerase, 2ul 100ng/ul T4 Gene 32Protein and 31.2ul _ddH2O. 3. a method for detecting IHHNV using the isothermal branch amplification detection kit of claim 1 prawn infectious subcutaneous and hematopoietic necrosis virus, comprising the following steps successively: (1) Extraction of Shrimp Infectious Subcutaneous and Hematopoietic Necrosis Virus DNA: A. Take 25-30mg of the sample tissue to be tested in a 1.5ml centrifuge tube, add 200ul tissue lysate A, mash; B. Use a desktop centrifuge at 12000 rpm for 3 minutes, take the supernatant, and place it in a 1.5ml centrifuge tube; C. Add 15ul DNA adsorption solution B, let stand at room temperature for 5 minutes, shake well 3 times during the period; D. Centrifuge at 10000 rpm for 15 seconds, suck up the supernatant with a pipette, add 200ul of 70% ethanol, shake gently with the pipette tip to fully suspend the precipitate; E. Centrifuge at 10,000 rpm for 30 seconds, suck up the supernatant with a pipette, put the precipitate in a constant temperature metal bath and bake at 60°C for 3 minutes, and open the centrifuge tube cover; F. Add 20ulddH ₂ O, shake well, centrifuge at 10,000 rpm for 30 seconds, and the supernatant is the virus DNA of the sample to be tested; (2) Isothermal branch amplification of shrimp infectious subcutaneous and hematopoietic necrosis virus: A. Add 80ul hybridization solution C and 1ul virus DNA of the sample to be tested in a 0.5ml centrifuge tube, and place it on a constant temperature metal bath at 60°C for 1 hour; B. Add 5ul magnetic beads D and 80ul probe capture solution E, mix well, and let stand at room temperature for 20 minutes; C. Put the centrifuge tube on the magnetic separation rack, suck up the supernatant with a pipette, and wash it twice with washing solution F, 200ul each time; D. Add 20ul of linking solution G to the washed magnetic beads, and place on a constant temperature metal bath at 60°C for 20 minutes; E. Put the centrifuge tube on the magnetic separation rack, and suck off the supernatant with a pipette; F. Add 50ul RAM reaction solution H, and place it on a constant temperature metal bath at 65°C for 45 minutes; (3) Color detection: Put the reacted centrifuge tube on the magnetic separation rack, use a pipette to absorb 25ul supernatant, put it in a 0.5ml centrifuge tube, add 1ul chromogen I, and directly observe the color change with the naked eye, if the color is yellow , indicating that the sample to be tested does not carry IHHNV virus, if the color turns green, it indicates that the sample carries IHHNV.