CN1936550A - Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof - Google Patents
Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof Download PDFInfo
- Publication number
- CN1936550A CN1936550A CN 200610037352 CN200610037352A CN1936550A CN 1936550 A CN1936550 A CN 1936550A CN 200610037352 CN200610037352 CN 200610037352 CN 200610037352 A CN200610037352 A CN 200610037352A CN 1936550 A CN1936550 A CN 1936550A
- Authority
- CN
- China
- Prior art keywords
- add
- probe
- ihhnv
- centrifuge tube
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This invention provides a reagent box for testing IHHNV of prawns with RAM including a DNA pick up reagent, a crossbreed solution, a probe capture reagent, a washing liquid, a connecting- liquor, a RAM reaction liquor, a color developing reagent and especially a marker probe for testing IHHNV. A method for testing IHHNA with the reagent box is provided, which has the same high flexibility as the PCR test method but not need expensive PCR instrument, yet only cheap constant-temperature metal bath or water bath is enough.
Description
Technical field
The present invention relates to a kind of with isothermal branch augmentation (Isothermal Ramification Amplification, abbreviation RAM) method detects the kit that the prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral (IHHNV), further relates to the method that this kind kit fast detecting prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral of using.
Background technology
Shrimp culture industry is the pillar industry of China's sea-farming, and the fulminant of China's cultured prawn disease in 1993 is popular, brings serious economic loss for whole prawn culturing industry, and industries such as relevant prawn processing and foreign export are also had a strong impact on.In recent years, China has introduced Environment of Litopenaeus vannamei Low (the Litopenaeusv vannamei that originates in South America, be commonly called as Penaeus Vannmei) and thin shore, angle prawn (Litopenaeus stylirostris, be commonly called as blue prawn) etc. new prawn kind culture, particularly the breed of Environment of Litopenaeus vannamei Low has obtained significant success, has promoted the rapid rise of China's prawn culturing output.
Infectiousness is subcutaneous and hematopoietic tissue necrosis is viral (Infectious Hypodermal and Hematopoietic NecrosisVirus, write a Chinese character in simplified form IHHNV), claiming slight of stature---malformation syndrome virus (Runt-deformity syndrome virus) again, is the prawn ' s virus of finding in shore, the thin angle prawn that culture Hawaii first in 1981.This virus mainly infects thin angle shore prawn and Environment of Litopenaeus vannamei Low, cause shore, the thin angle prawn young and young shrimp up to 80% cumulative mortality with cause Environment of Litopenaeus vannamei Low poor growth and deformity, make Environment of Litopenaeus vannamei Low culture the serious underproduction, cause the economic loss of 10-50%.IHHNV is a kind of single-stranded DNA viruses, according to the categorizing system of its genomic characteristics and ICTV (ICTV) issue in 2002, the Brevidensovirus (Brevidensovirus) of this virus ownership Parvoviridae (Parvoviridae).IHHNV is wide-scale distribution in regional Environment of Litopenaeus vannamei Low of culturing in America and thin shore, angle prawn, does not find different strains and variant at present as yet.Propagate artificially along with China introduces these two kinds of prawns, this virus also passes to China, and China's shrimp culture industry is constituted a serious threat.
Detected prawn IHHNV in the past and mainly contained three kinds of ways: 1. electron microscopy, this method cost height, time-consuming, sensitivity is low, is not suitable for on-the-spot the detection; 2. gene probe method, this method cost height, complicated operation; 3. PCR method (PCR method), the more preceding two kinds of methods of this method are quick, sensitive, but need expensive PCR instrument.
The content of invention
The purpose of this invention is to provide a kind of high specificity, highly sensitive and cost is low detects the kit that the prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral with the isothermal branch augmentation method, the label probe that a pair of detection infectiousness is subcutaneous and hematopoietic tissue necrosis is viral particularly is provided, and provide a kind of and use the method that kit fast detecting prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral, thereby provide the foundation and the directive function of science for the healthy aquaculture of prawn.
Cardinal principle of the present invention is: (be made up of three special region: promptly two sequences with the target gene complementation are positioned at 5 ' and 3 ' end to the C-probe of (1) particular design, the centre is general join domain) and capture probe and target gene hybridization, the magnetic capture heterozygote used; (2) wash the not probe of hybridization; (3) with ligase 5 ' and 3 ' end of C-probe is connected into closed hoop; (4) under isothermy, extension, displacement and amplification by primer make the C-probe be exponential growth, produce a large amount of branch's compounds, obtain the universal meter double-stranded DNA of all lengths, observe amplification by fluorescent dye.
What the present invention relates to detects the kit that the prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral with the isothermal branch augmentation method, and its reagent comprises:
(1) DNA extraction reagent: contain and organize lysate A and DNA adsorption liquid B,
Organize lysate A to contain the beta-mercaptoethanol of 4M guanidinium isothiocyanate (GTC), 25mM sodium citrate, 0.5% sarcosyl and 0.1M;
DNA adsorption liquid B is 50% magnetic bead (Golden Beads) suspending liquid;
(2) hybridization solution C:
Hybridization solution C contains trihydroxy methyl aminomethane-hydrochloric acid (Tris-HCl), 0.5% sarcosyl, 2-10nM IHHNV-C-probe and the 20-100nM IHHNV-capture probe of 2M guanidinium isothiocyanate (GTC), 0.5% bovine serum albumin(BSA) (BSA), 80mM ethylenediamine tetraacetic acid (EDTA), 400mM pH7.5;
(3) probe capture agent: comprise that magnetic bead D and probe catch liquid E, magnetic bead D is that concentration is streptavidin (SAV) immunomagnetic beads of 4mg/ml;
Probe is caught trihydroxy methyl aminomethane-hydrochloric acid (Tris-HCl), 1mM ethylenediamine tetraacetic acid (EDTA) and the 1-2MNaCl (sodium chloride) that liquid E contains 10mM pH7.5;
(4) cleansing solution F: the trihydroxy methyl aminomethane-hydrochloric acid (Tris-HCl) and the 1mM ethylenediamine tetraacetic acid (EDTA) that contain 10mM pH8.0;
(5) connect liquid G: contain Taq dna ligase and 1 * ligase (ligase) damping fluid of 10-20 active unit (U),
1 * ligase (ligase) damping fluid contains trihydroxy methyl aminomethane-hydrochloric acid (Tris-HCl), 25mMKAcO (potassium acetate), 10mMMgAcO (magnesium acetate), 10mM dithiothreitol (DTT) (DTT), 1mM dihydrouracil dehydrogenase (NAD) and 0.1% triton x-100 (Triton X-100) of 20mM pH7.6;
(6) isothermal branch augmentation (RAM) reactant liquor H: contain 5-15U Bst archaeal dna polymerase, 10 * Thermopol reaction buffer, 200-1000uMdNTP (potpourris of four kinds of deoxynucleotides), 0.8-1.5uM forward primer Prime-1,0.8-1.5uM reverse primer Prime-2 and 50-200ng (nanogram) T4 phage gene 32 encoding proteins (T4 Gene 32Protein);
10 * Thermopol reaction buffer contains trihydroxy methyl aminomethane-hydrochloric acid (Tris-HCl), 100mMKCl (potassium chloride), the 100mM (NH of 200mM pH8.8
4)
2SO
4(ammonium sulfate), 20mM MgSO
4(magnesium sulphate) and 1% triton x-100 (Triton X-100);
(7) developer I: be 1% fluorescent dye SYBR GREEN I (imported materials and items has only English name) wherein the IHHNV-C-probe sequence among the hybridization solution C be:
5 '-phosphoric acid-CAGCAAAGGTAACTCCCAAATAGGCGATGTCTGTGTATCTGCTAACCAAGAGCAAC TACACGAATTCTCGATTAGGTTACTGCGATTAGCACAAGCGTAGTCGCTTCAGCTT CGGCTCTGG
IHHNV-sequence capture probe among the hybridization solution C is:
5 '-biotin-AAGATACGAAAGCCGTTCAATACCGTATCTGATAAGATAGAGTAT
Forward primer Prime-1 sequence among isothermal branch augmentation (RAM) the reactant liquor H is:
5’-CTTGTGCTAATCGCAGTAACCTAAT
Reverse primer Prime-2 sequence among isothermal branch augmentation (RAM) the reactant liquor H is:
5’-ACCAAGAGCAACTACACGAATTC。
Above the best group of the every pipe 50ul of described isothermal branch augmentation (RAM) reactant liquor H become: 5.0ul 10 * Thermopol reaction buffer, 6.0ul 2.5mM dNTP (potpourris of four kinds of deoxynucleotides), 2.5ul 20uM forward primer Prime-1,2.5ul 20uM reverse primer Prime-2,0.8ul 8U/ul Bst archaeal dna polymerase, 2ul 100ng/ul T4 Gene32 Protein and 31.2ul ddH
2O (sterilization distilled water).
Use the method for the isothermal branch augmentation detection kit detection IHHNV that above-mentioned prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral, comprise the following steps: successively
(1) extraction of the subcutaneous and hematopoietic tissue necrosis viral DNA of prawn infectiousness:
A. get sample tissue 25-30mg to be checked in the 1.5ml centrifuge tube, add 200ul and organize lysate A, mash;
B. use 12000 rev/mins of desk centrifuges centrifugal 3 minutes, and got supernatant, place the 1.5ml centrifuge tube;
C. add 15ul DNA adsorption liquid B (include whiteness, fully shake up with preceding), room temperature was placed 5 minutes, during shake up 3 times;
D.10000 rev/mins centrifugal 15 seconds, inhale with pipettor and to remove supernatant, add 200ul 70% ethanol, shake gently with pipettor rifle head, make fully suspension of precipitation;
E.10000 rev/mins centrifugal 30 seconds, inhale with pipettor and to remove supernatant, precipitation to be put into thermostat metal bathe last 60 ℃ of bakings 3 minutes, the centrifuge tube lid is opened;
F. add 20ulddH
2O fully shakes up, 10000 rev/mins centrifugal 30 seconds, supernatant is a sample viral DNA to be checked;
(2) isothermal branch augmentation that the prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral:
A. in the 0.5ml centrifuge tube, add 80ul hybridization solution C and 1ul sample viral DNA to be checked, bathe last 60 ℃ in thermostat metal and placed 1 hour;
B. add 5ul magnetic bead D and the 80ul probe is caught liquid E, mixing, room temperature was placed 20 minutes;
C. centrifuge tube is put on the magnetic separation frame, inhales with pipettor and remove supernatant, and wash twice, each 200ul with cleansing solution F;
D. on the good magnetic bead of washing, add 20ul and connect liquid G, bathe last 60 ℃ in thermostat metal and placed 20 minutes;
E. centrifuge tube is put on the magnetic separation frame, inhales with pipettor and remove supernatant;
F. add 50ul RAM reactant liquor H, bathe last 65 ℃ in thermostat metal and placed 45 minutes;
(3) color developing detection
The centrifuge tube that has reacted is put on the magnetic separation frame, draw the 25ul supernatant with pipettor, place the centrifuge tube of 0.5ml, add 1ul developer I, the change color that directly detects by an unaided eye if color is yellow, illustrates that sample to be checked does not carry IHHNV virus, become green as color, then interpret sample is carried IHHNV virus.
Advantage of the present invention and good effect are: detection kit and the detection method of having set up the isothermal branch augmentation of IHHNV, this kit has designed specific probe according to the dna sequence dna of the gene conserved region non-structural protein 2 of IHHNV, to guarantee to detect the reliability of separate sources IHHNV strain.This technology high specificity, with the PCR detection method identical high sensitivity is arranged, but do not need expensive PCR instrument, the thermostat metal that call for bids is honest and clean is bathed (price only is the 5-10% of PCR instrument) or water bath with thermostatic control gets final product, and the result needn't observe with gel electrophoresis method, can directly use fluorescent dye, judge testing result by visual inspection, simple and quick.Can be widely used in the detection of the IHHNV of scientific research, particularly cultivation site.
Embodiment
Following example is further to explanation of the present invention, should not be used as limitation of the present invention.
Make the isothermal branch augmentation detection kit that the prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral by following prescription: organize lysate A:4MGTC, 25mM sodium citrate, 0.5% sarcosyl and 0.1M beta-mercaptoethanol
DNA adsorption liquid B:50%Golden Beads suspending liquid
The Tris-HCl of hybridization solution C:2M GTC, 0.5%BSA, 80mM EDTA, 400mM pH7.5,0.5% dodecyl
Sodium sarcosinate, 2.5nM IHHNV-C-probe and 25nM IHHNV-capture probe
The SAV immunomagnetic beads of magnetic bead D:4mg/ml
Probe is caught Tris-HCl, 1mM EDTA and the 2M NaCl of liquid E:10mM pH7.5
The Tris-HCl of cleansing solution F:10mM pH8.0 and 1mM EDTA
Connect liquid G:20ul 1 * ligase damping fluid and 0.25ul Taq dna ligase (40U/ul)
RAM reactant liquor H:6ul 2.5mM dNTP, 5ul 10 * Thermopol reaction buffer, 2.5ul 20uM forward primer Prime-1,2.5ul 20uM reverse primer Prime-2,0.8ul 8U/ul Bst archaeal dna polymerase, 2ul 100ng/ul T4 Gene32 Protein and 31.2ul ddH
2O (sterilization distilled water).
The SYBR GREEN I of developer I:1%
Detect according to following program:
(1) extraction of the subcutaneous and hematopoietic tissue necrosis viral DNA of prawn infectiousness
A. get sample tissue 25-30mg to be checked in the 1.5ml centrifuge tube, add 200ul and organize lysate A, mash;
B. use 12000 rev/mins of desk centrifuges centrifugal 3 minutes, and got supernatant, place the 1.5ml centrifuge tube;
C. add 15ul DNA adsorption liquid B (include whiteness, fully shake up with preceding), room temperature was placed 5 minutes, during shake up 3 times;
D.10000 rev/mins centrifugal 15 seconds, inhale with pipettor and to remove supernatant, add 200ul 70% ethanol, shake gently with pipettor rifle head, make fully suspension of precipitation;
E.10000 rev/mins centrifugal 30 seconds, inhale with pipettor and to remove supernatant.Precipitation is put into thermostat metal bathe last 60 ℃ of bakings 3 minutes (the centrifuge tube lid is opened);
F. add 20ulddH
2O fully shakes up, 10000 rev/mins centrifugal 30 seconds, supernatant is a sample viral DNA to be checked.
(2) isothermal branch augmentation that the prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral
A. in the 0.5ml centrifuge tube, add 80ul hybridization solution C and 1ul sample viral DNA to be checked, bathe last 60 ℃ in thermostat metal and placed 1 hour;
B. add 5ul magnetic bead D and the 80ul probe is caught liquid E, mixing, room temperature was placed 20 minutes;
C. centrifuge tube is put on the magnetic separation frame, inhales with pipettor and remove supernatant, and wash twice, each 200ul with cleansing solution F;
D. on the good magnetic bead of washing, add 20ul and connect liquid G, bathe last 60 ℃ in thermostat metal and placed 20 minutes;
E. centrifuge tube is put on the magnetic separation frame, inhales with pipettor and remove supernatant;
F. add 50ul RAM reactant liquor H, bathe last 65 ℃ in thermostat metal and placed 45 minutes
(3) color developing detection
The centrifuge tube that has reacted is put on the magnetic separation frame, draw the 25ul supernatant with pipettor, place the centrifuge tube of 0.5ml, add 1ul developer I, the change color that directly detects by an unaided eye if color is yellow, illustrates that sample to be checked does not carry IHHNV virus, become green as color, then interpret sample is carried IHHNV virus.
Claims (3)
1. one kind is detected the kit that the prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral with the isothermal branch augmentation method, and its reagent comprises:
(1) DNA extraction reagent: contain and organize lysate A and DNA adsorption liquid B,
Organize lysate A to contain the beta-mercaptoethanol of 4M guanidinium isothiocyanate, 25mM sodium citrate, 0.5% sarcosyl and 0.1M;
DNA adsorption liquid B is 50% bead suspension;
(2) hybridization solution C:
Hybridization solution C contains trihydroxy methyl aminomethane-hydrochloric acid, 0.5% sarcosyl, 2-10nM IHHNV-C-probe and the 20-100nMIHHNV-capture probe of 2M guanidinium isothiocyanate, 0.5% bovine serum albumin(BSA), 80mM ethylenediamine tetraacetic acid, 400mM pH7.5;
(3) probe capture agent: comprise that magnetic bead D and probe catch liquid E,
Magnetic bead D is that concentration is the streptavidin immunomagnetic beads of 4mg/ml;
Probe is caught trihydroxy methyl aminomethane-hydrochloric acid, 1mM ethylenediamine tetraacetic acid and the 1-2MNaCl that liquid E contains 10mM pH7.5;
(4) cleansing solution F: the trihydroxy methyl aminomethane-hydrochloric acid and the 1mM ethylenediamine tetraacetic acid that contain 10mM pH8.0;
(5) connect liquid G: contain Taq dna ligase and 1 * ligase damping fluid of 10-20 active unit,
1 * ligase damping fluid contains trihydroxy methyl aminomethane-hydrochloric acid, 25mMKAcO, 10mMMgAcO, 10mM dithiothreitol (DTT), 1mM dihydrouracil dehydrogenase and 0.1% triton x-100 of 20mM pH7.6;
(6) isothermal branch augmentation reactant liquor H: contain 5-15U
BstArchaeal dna polymerase, 10 * Thermopol reaction buffer, 200-1000uMdNTP, 0.8-1.5uM forward primer Prime-1,0.8-1.5uM reverse primer Prime-2 and 50-200ng T4 phage gene 32 encoding proteins;
10 * Thermopol reaction buffer contains trihydroxy methyl aminomethane-hydrochloric acid, 100mMKCl, the 100mM (NH of 200mM pH8.8
4)
2SO
4, 20mM MgSO
4With 1% triton x-100;
(7) developer I: be 1% fluorescent dye SYBR GREEN I; Wherein the IHHNV-C-probe sequence among the hybridization solution C is:
5 '-phosphoric acid-CAGCAAAGGTAACTCCCAAATAGGCGATGTCTGTGTATCTGCTAACCAAGAGCAAC TACACGAATTCTCGATTAGGTTACTGCGATTAGCACAAGCGTAGTCGCTTCAGCTT CGGCTCTGG;
IHHNV-sequence capture probe among the hybridization solution C is:
5 '-biotin-AAGATACGAAAGCCGTTCAATACCGTATCTGATAAGATAGAGTAT;
Forward primer Prime-1 sequence among the isothermal branch augmentation reactant liquor H is:
5’-CTTGTGCTAATCGCAGTAACCTAAT；
Reverse primer Prime-2 sequence among the isothermal branch augmentation reactant liquor H is:
5’-ACCAAGAGCAACTACACGAATTC。
2. according to the kit described in the claim 1, it is characterized in that consisting of of the isothermal branch augmentation reactant liquor every pipe 50ul of H: 5.0ul 10 * Thermopol reaction buffer, 6.0ul 2.5mM dNTP, 2.5ul 20uM forward primer Prime-1,2.5ul 20uM reverse primer Prime-2,0.8ul 8U/ul Bst archaeal dna polymerase, 2ul 100ng/ul T4 Gene 32Protein and 31.2ul ddH
2O.
3. a method of using the isothermal branch augmentation detection kit detection IHHNV that claim 1 prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral comprises the following steps: successively
(1) extraction of the subcutaneous and hematopoietic tissue necrosis viral DNA of prawn infectiousness:
A. get sample tissue 25-30mg to be checked in the 1.5ml centrifuge tube, add 200ul and organize lysate A, mash;
B. use 12000 rev/mins of desk centrifuges centrifugal 3 minutes, and got supernatant, place the 1.5ml centrifuge tube;
C. add 15ul DNA adsorption liquid B, room temperature was placed 5 minutes, during shake up 3 times;
D.10000 rev/mins centrifugal 15 seconds, inhale with pipettor and to remove supernatant, add 200ul 70% ethanol, shake gently with pipettor rifle head, make fully suspension of precipitation;
E.10000 rev/mins centrifugal 30 seconds, inhale with pipettor and to remove supernatant, precipitation to be put into thermostat metal bathe last 60 ℃ of bakings 3 minutes, the centrifuge tube lid is opened;
F. add 20ulddH
2O fully shakes up, 10000 rev/mins centrifugal 30 seconds, supernatant is a sample viral DNA to be checked;
(2) isothermal branch augmentation that the prawn infectiousness is subcutaneous and hematopoietic tissue necrosis is viral:
A. in the 0.5ml centrifuge tube, add 80ul hybridization solution C and 1ul sample viral DNA to be checked, bathe last 60 ℃ in thermostat metal and placed 1 hour;
B. add 5ul magnetic bead D and the 80ul probe is caught liquid E, mixing, room temperature was placed 20 minutes;
C. centrifuge tube is put on the magnetic separation frame, inhales with pipettor and remove supernatant, and wash twice, each 200ul with cleansing solution F;
D. on the good magnetic bead of washing, add 20ul and connect liquid G, bathe last 60 ℃ in thermostat metal and placed 20 minutes;
E. centrifuge tube is put on the magnetic separation frame, inhales with pipettor and remove supernatant;
F. add 50ul RAM reactant liquor H, bathe last 65 ℃ in thermostat metal and placed 45 minutes;
(3) color developing detection:
The centrifuge tube that has reacted is put on the magnetic separation frame, draw the 25ul supernatant with pipettor, place the centrifuge tube of 0.5ml, add 1ul developer I, the change color that directly detects by an unaided eye if color is yellow, illustrates that sample to be checked does not carry IHHNV virus, become green as color, then interpret sample is carried IHHNV.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200610037352XA CN100460519C (en) | 2006-08-29 | 2006-08-29 | Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200610037352XA CN100460519C (en) | 2006-08-29 | 2006-08-29 | Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1936550A true CN1936550A (en) | 2007-03-28 |
| CN100460519C CN100460519C (en) | 2009-02-11 |
Family
ID=37954176
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB200610037352XA Expired - Fee Related CN100460519C (en) | 2006-08-29 | 2006-08-29 | Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100460519C (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101591712A (en) * | 2008-05-27 | 2009-12-02 | 富士胶片株式会社 | The recognition methods of the base sequence of nucleic acid |
| CN101845444A (en) * | 2010-04-16 | 2010-09-29 | 国家海洋局第三海洋研究所 | Capsid protein gene and virus-like particles of shrimp infectious hypodermal and hematopoietic tissue necrosis |
| CN103571928A (en) * | 2012-07-23 | 2014-02-12 | 上海生物芯片有限公司 | Method and kit for detecting gene point mutation |
| CN101506387B (en) * | 2006-08-24 | 2014-04-09 | 纳幕尔杜邦公司 | Sequences diagnostic for shrimp pathogens |
| CN104204231A (en) * | 2012-02-27 | 2014-12-10 | 马来亚大学 | Real-time viral detection method and kit for infectious hypodermaland haematopoietic necrosis virus |
| CN113897459A (en) * | 2021-06-09 | 2022-01-07 | 湛江海关技术中心 | Primer pair, amplification reagent, kit, detection method and application for detecting infectious hypodermal and hematopoietic necrosis viruses of prawns |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101935645B (en) * | 2010-09-13 | 2012-07-25 | 原平皓(天津)生物技术有限公司 | Kit for extracting DNA from histiocytes and method thereof |
| CN101935646B (en) * | 2010-09-13 | 2012-07-25 | 原平皓(天津)生物技术有限公司 | Kit and method for extracting DNA from micro samples |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5942391A (en) * | 1994-06-22 | 1999-08-24 | Mount Sinai School Of Medicine | Nucleic acid amplification method: ramification-extension amplification method (RAM) |
| CN1317576A (en) * | 2001-02-20 | 2001-10-17 | 张小丽 | Reticular blanch amplification technique of nucleic acid |
| CN1410549A (en) * | 2001-09-21 | 2003-04-16 | 中国科学院南海海洋研究所 | Fast detection prawn infectious subcutaneous and hemopoiesis tissue necrosis virus reagent box |
| CN100351630C (en) * | 2005-10-23 | 2007-11-28 | 王学海 | Kit for diagnosing FQ-PCR of prawn IHHNV and its testing method |
-
2006
- 2006-08-29 CN CNB200610037352XA patent/CN100460519C/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101506387B (en) * | 2006-08-24 | 2014-04-09 | 纳幕尔杜邦公司 | Sequences diagnostic for shrimp pathogens |
| CN101591712A (en) * | 2008-05-27 | 2009-12-02 | 富士胶片株式会社 | The recognition methods of the base sequence of nucleic acid |
| CN101845444A (en) * | 2010-04-16 | 2010-09-29 | 国家海洋局第三海洋研究所 | Capsid protein gene and virus-like particles of shrimp infectious hypodermal and hematopoietic tissue necrosis |
| CN104204231A (en) * | 2012-02-27 | 2014-12-10 | 马来亚大学 | Real-time viral detection method and kit for infectious hypodermaland haematopoietic necrosis virus |
| CN103571928A (en) * | 2012-07-23 | 2014-02-12 | 上海生物芯片有限公司 | Method and kit for detecting gene point mutation |
| CN113897459A (en) * | 2021-06-09 | 2022-01-07 | 湛江海关技术中心 | Primer pair, amplification reagent, kit, detection method and application for detecting infectious hypodermal and hematopoietic necrosis viruses of prawns |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100460519C (en) | 2009-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100460519C (en) | Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof | |
| CN106636471B (en) | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns | |
| Anderson et al. | Comparison of four multiplex PCR assays for the detection of viral pathogens in respiratory specimens | |
| CN109487008B (en) | Multiplex PCR detection kit for respiratory pathogens, application and use method thereof | |
| CN108342463B (en) | Gene detection kit free from nucleic acid purification | |
| Zhu et al. | Multiplex and visual detection of African Swine Fever Virus (ASFV) based on Hive-Chip and direct loop-mediated isothermal amplification | |
| CN103397105B (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN102766701B (en) | The kit of HCV gene typing and method | |
| CN103060473A (en) | Herpes virus EBV (Epstein-Barr Virus) detection kit | |
| CN106967845A (en) | A kind of kit detected for pig Delta coronavirus and detection method | |
| CN111575245A (en) | Novel coronavirus pseudovirus, preparation method and application thereof | |
| CN102251061A (en) | Nucleic acid dual fluorescence PCR (Polymerase Chain Reaction) detection kit for influenza A/B virus | |
| CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
| CN110607297A (en) | Lysis solution for extracting nucleic acid by magnetic bead method and method for extracting nucleic acid by using lysis solution | |
| CN112111597B (en) | Fluorescent PCR kit for rapidly detecting novel coronavirus 2019-nCoV nucleic acid without nucleic acid extraction | |
| CN111118219A (en) | RDA method and kit for rapidly detecting influenza A virus | |
| CN100460518C (en) | Reagent box for detecting prawn leucoplakia syndrome virus using isothermal branch augmentation and method therefor | |
| CN109680101B (en) | Rapid detection method for distinguishing strong and weak viruses of H7N9 subtype avian influenza virus | |
| CN105525036B (en) | A kind of hepatitis b virus hbv real-time fluorescence nucleic acid isothermal amplification detection kit | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| CN101643793A (en) | Reagent kit for testing infectious hypodermic and hematopoietic necrosis viruses of prawns, and testing method thereof | |
| CN102071262A (en) | Method and kit for detecting genotypes of herpes simplex virus | |
| CN101319190B (en) | Nucleic acid enricher and uses thereof | |
| CN102559933A (en) | Gene chip, kit and method for distinguishing hepatitis B virus genotypes | |
| CN103409556B (en) | Macrobrachium rosenbergii Nodavirus NASBA-LFD detection method and detection kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090211 Termination date: 20210829 |