CN101283090A - Arachnocampa luciferases - Google Patents

Abstract

Nucleotide and amino acid sequences of luciferase peptides that are encoded by genes within the genome of Arachnocampa (Diptera) are disclosed. Specifically provided are functional ATP-dependent luciferases that catalyze luminescence reactions with emission spectra within the blue portion of the spectrum. The present invention specifically provides isolated peptide and nucleic acid molecules, methods of identifying orthologs and active subsequences of the enzyme peptides, and methods of identifying modulators and substrates of the luciferase peptides. Methods of assays, including multiple reporter assays utilizing at least two ATP-dependent luciferases are provided.

Description

Arachnocampa luciferases

Technical field

The present invention relates generally to luciferase.Particularly, the present invention relates to the protein and the peptide of luciferase, its function is the luminous reaction of catalysis dependency ATP, and this is reflected at the luminescent spectrum that produces maximum strength in the wave spectrum blue light part, the invention still further relates to the check of using these luciferases.Advancing on the one hand, the present invention relates to belong to the isolating luciferase of organism of (Diptera) from bacterium buffalo gnat (Arachnocampa).

Background technology

It is established using reporter gene molecule or mark to come qualitative or monitor molecular behavior quantitatively.They see in the check of following purposes: be used for medical diagnosis, be used for detecting toxin and other material of industrial environment, and be used for biology, biomedicine and biochemical basic and applied research.These checks comprise immunity inspection, nucleic acid probe molecules hybridization check and the check that wherein produces report enzyme or other peptide by the expression under specific promotor control.Reporter molecule in these checking systems or mark comprise radio isotope, fluorescent agent, enzyme and chemoluminescence agent.

The checking system that uses chemoluminescence to monitor or detect the behavior of paying close attention to comprises measures noclilucence enzyme---the active check of luciferase.

Luminescent system is known, and separate and take pride in multiple light organism, it comprises bacterium, protozoon, coelenterates, mollusk, fish, millipede, fly, fungi, worm, crustacean and beetle, and particularly Pyrophorus belongs to the Lampyridea that Pleonomus and Photinus, Photuris and Luciola belong to.Other shows noctilcent organism and lists in WO/2000/024878 and 1999/049019.In addition referring to Viviani, V.R., (2002) Cell.Mol.Life Sci.59:1833-1850, it has enumerated the character of noctilcent Lu Sheng arthropods and insect.

In many these organisms, the free energy that produces is used in the single oxygenation effect of enzyme catalysis, with molecular excitation to high-energy state.When excited molecule spontaneously returns ground state, launch visible light.The light of this emission is called " noclilucence ".It also is called for short hereinafter does " luminous ".

Since research the earliest, beetle luciferase (particularly from common North America Lampyridea species Photinus pyralis) has become understands noctilcent example.The rudimentary knowledge of luciferase and application are normally based on the single enzyme that is derived from Photinus pyralis, and it is called " Photinus pyralis LUC ".But there are about 1800 kinds of luminous beetles in the whole world.Therefore, the luciferase of Photinuspyralis is an example of a large amount of various beetle luciferases.Known all same substrates of the equal catalysis of beetle luciferase---the reaction of many heterocycles organic acid (unless otherwise noted, it is called " fluorescein " hereinafter), this substrate conversion becomes the high energy molecule.Might catalytic in each case reaction must follow same mechanism.

The beetle luciferase comprises so-called Photinus pyralis LUC, is the member of the enzyme Superfamily that forms adenylic acid (AMP).The enzymatic reaction that the catalytic polystep reaction of beetle luciferase and other form adenylic acid (AMP) has some similaritys, and the above-mentioned enzyme that other forms adenylic acid (AMP) is for example acyl group-CoA ligase enzyme, various other CoA ligase enzyme (for example 4-Coumarate-CoA ligase) and peptide synthetase.

The reaction the first step is the carboxylic carbon addition of VITAMIN B4 phosplate (adenylylation) and D-fluorescein, forms fluoresceinization-AMP (luciferyl-AMP).ATP is the source of AMP, and other reaction product is a pyrophosphate.Therefore, this reaction " dependency ATP " or " ATP dependency ".The hydrolysis of supposition pyrophosphate is used for driving reaction and advances.Fluorescein-AMP is the mixed acid anhydride of acetate and phosphoric acid.Because the adenylyl group is good leavings group, it is a relative reactivity.In similar enzyme, the first step also is the adenylylation of carboxylicesters on substrate molecule, and no matter it is acetic ester, longer chain fatty acid, 4-tonka-bean acid esters, still is amino acid.

Under the situation of the enzyme that uses CoA, have the nucleophilic attack of CoA sulfydryl usually to adenosine acidifying carboxylic acid, cause CoA to engage with substrate.Under the situation of beetle luciferase, have the attack of carbonyl place molecular oxygen, produce high energy dioxetane intermediate, it decays subsequently, discharge usually wave spectrum green-photon in the yellow part (550-570nm) adds carbonic acid gas.

Luciferase has makes it can be used as the feature of the reporter molecule of bio-sensing (using the report system to disclose the character of biosystem) especially.Signal transduction in the biosensor (transmitter that comprises biological components) generally includes two step processes: the signal by biological components produces and signal transduction and amplification by electric component.Signal produces usually and realizes by combination or catalysis.

These biological chemistry phenomenons are transformed into electrical signal, and normally based on electrochemistry or heat detection method, it is subjected to the restriction of the free energy change of biochemical reaction.For the great majority reaction, this is less than the energy of two molecule ATP hydrolysis, or about 70kJ/ mole.But luciferase causes luminously is loaded with much higher energy content.The photon (560nm) that the catalytic reaction of Photinus pyralis LUC is sent has 214Kj/ einstein.Photinus pyralis LUC changes into light with very high efficient and outstanding noise characteristic with chemical energy.The quantum yield of per molecule D-fluorescein is 0.88 (Seliger and McElroy 1960; Seliger and W.D 1960).Therefore this kind of enzyme is that very effective chemical can transducer.

But, the luciferase of known dependency ATP, as the beetle luciferase, luminous in the emmission spectrum scope of relative narrower.In the known beetle luciferase none luminous (Viviani 2002 with maximum emission intensity being less than or equal under the wavelength of 530 ± 5nm; People such as Nakatsu 2006).In fact, make the emmission spectrum energy reduce (that is, reducing to the maximum emission intensity at big wavelength place), but do not increase the energy (that is, to the shorter wavelength place) of emmission spectrum the structural modification of known luciferase.Thinking at present how structural modification changes the further information of emmission spectrum can be referring to people such as Nakatsu (2006).

Luciferase is directly isolated from various sources, the existing report of its cDNA.Referring to, for example: people such as de Wet, Molec.Cell.Biol 7,725-737 (1987); People such as Masuda, Gene 77,265-270 (1989); People such as Nakatsu (2006); With people such as Wood, Science 244,700-702 (1989).Under the situation of the cDNA of the plain enzyme of existing coding fluorescence, by separating from changing into the culture of expressing cDNA or the bacterium the analogue (for example intestinal bacteria (E.coli)), yeast, mammalian cell that to prepare a large amount of luciferases be very simple for the skilled person fully.Perhaps, express under the control of control signal in suitable promotor and other, cDNA can be used to provide luciferase (thereby final catalysis biological is luminous) as signal, with the activity of indication promotor in such cell.And the activity of promotor can reflect another factor of seeking to monitor conversely, for example induces or suppress the concentration of the material of promoter activity.Recently various these the proteic cell free systems of nucleic acid manufacturing from proteins encoded that occur also can be used to make luciferase.

By with the expression of this cDNA with produce enzyme subsequently and the genetic behavior coupling, be easy to obtain the cDNA of the plain enzyme of coding fluorescence, make might be used for to transcribe and translate that relevant this genetic behavior carries out that signal is passed on, monitoring or the check of measuring use luciferase as reporter gene.

For example, Photinus pyralis LUC has been widely used in the promoter activity that detects in eukaryote and the prokaryotic organism.The substrate that luminous reaction is required comprises that fluorescein or other substrate, oxygen and ATP are retrievable, or is easy to obtain in viable cell.

Many reporter gene checks

Usually use many, two (or dual) reporter gene to improve the experiment tolerance range.Term " two reporter gene " is meant expresses and measures two kinds of independent report enzymes simultaneously in triangular web.Term " many reporter genes " is meant expresses and measures two or more independent report enzymes simultaneously in triangular web.When using together, two or more independent report enzymes can be called " reporter gene altogether ".The example that has benefited from many reporter genes detections at present is included in heredity and goes up independent cell or the cell mass of handling to express two kinds of different reporter genes simultaneously (for example being dispersed in cells in culture, isolating tissue or whole animal).More commonly, the influence of the activity of gene report specific condition of experiment, and the activity of second reporter gene provides internal contrast, thus can carry out normalization method to the experimental value of a complete set.The activity of experiment reporter gene is with respect to the active normalization method of internal contrast, makes that the experiment mutability that causes such as cell viability or transfection efficiency difference is minimized.Liquid long-pending difference, cytolysis efficient and checkability are for example moved in variable other source, can eliminate effectively.Therefore, by reducing external influence, two reporter gene checks usually make the explanation of experimental data more reliable.

Can have benefited from the acellular reconfiguration system of two enzyme reporter gene technology, the cell lysates that obtains is transcribed and is translated in translation or coupling when being the independent inheritance material from coding experiment and contrast report enzyme.Immunity inspection can be specified similarly and is used for dual report experimental value and control value in simple sample.

At present, for example excretory alkaline phosphatase (SEAP) and uterus transferrin (Uf of coding Photinus pyralis LUC (luc), sea pansy (Renilla) luciferase, E.C. 2.3.1.28 (CAT), beta-galactosidase enzymes (lacZ), β-glucuronidase (GUS) and various Phosphoric acid esterase; Acid phosphatase) gene is combined, and as the active reporter gene altogether of heredity.The representative example of these the various reporter genes that use with array configuration that are used for the active two report of heredity purposes is provided below with reference to document: luc and GUS:Leckie, F. waits the people, and 1994; Luc and CAT, luc and lacZ:Jain, V.K. and Magrath, I.T., 1992; CAT and lacZ:Flanagan, W.M. waits the people, and 1991.In addition referring to Promega Dual-Luciferase ^TMReporter gene checking system, Dual-Glo ^TMThe luciferase checking system is described in its technical manual: Instructions for use of Products E2920, and E2940, and E2980, revised 1/06, Part Number TM058; And Wood, K.V., (1998) The Chemistry ofBioluminescent Reporter Assays, 65, the 14 pages of Promega Notes; And Promega pGL3 luciferase reporter gene carrier (available from Promega Corporation, Madison, Wis.); And United States Patent (USP) the 5th, 744, No. 320 and the 5th, 670, No. 356.

The characteristic and the consistency of the zymochemistry that the performance of any many reporter genes check is constituted and divide other result the restriction of interrelated ability.Diverse enzyme requires or condition for surveys can indicate common reporter gene can not be used for integrated single test mixture or single tube form.Ideally, many reporter gene system will comprise at least two the enzyme checks with compatible requirement, for example chemistry, temperature, processing requirements, speed, susceptibility, detecting instruments etc.

In satisfying the desirable trial that requires of many reporter gene system, in the Bioluminescent reporter genic system, can use the clone of different luciferases together, the luciferase of particularly single genus or kind.But the ability of distinguishing every kind of luciferase in the mixture is subjected to the restriction of its emmission spectrum width.Use two or more different luciferases to need the glow color of luciferase that measurable difference is arranged as the system of reporter gene.

An example of glow color difference occurs in a kind of big Pleonomus of this real estate of Pyrophorus plagiophthalamus-Caribbean.Referring to, for example, be disclosed in No. the 20030166905th, the U.S. Patent application on September 4th, 2003.This beetle has two cover luminous organs, and is a pair of on the back surface of shirtfront, and independent organ is in the veutro of belly totally cleaves mouth.From the abdomen organ, isolated four kinds of different luciferase clones, and called after LucPplGR, LucPplYG, LucPplYE and LucPplOR.These enzymatic fluorescein-luciferase reactions produce green to orange light.

546 nanometers), yellow green light (peak intensity: 560 nanometers), gold-tinted (peak intensity: 578 nanometers) and orange light (peak intensity: 4 almost equidistant eclipsed peaks 593 nanometers) spectroscopic data of these four kinds of catalytic luciferase-luciferin reaction of luciferase demonstrates transmitting green light (peak intensity:.As used herein, for example, peak intensity: 546 nanometers, the emission maximum that is meant the luminescent spectrum that the catalytic luminous reaction of luciferase produces occur in 546 nanometers or near.This contextual term " near " be meant that peak or maximum strength nidus wavelength (are also referred to as the normal accuracy limitations in the wavelength measurement of λ-max).Normal accuracy limitations is that for example, positive and negative 5 nanometers (promptly ± 5nm)

Unfortunately, although the wavelength region of the peak intensity of the light that these luciferases send surpasses about 50nm, even between the peak at 546nm and 593nm place, also have sizable spectra overlapping.Therefore increase that the peak intensity difference of wavelength is very desirable between the luminous reaction of being adopted, in the system that uses two or more luciferases, to obtain higher measuring accuracy.Particularly, to be equal to or less than the new luciferase of the luminous reaction of about 530nm be very desirable to the maximum strength that produces of catalysis.The peak intensity that is equal to or less than about 530nm is in the blue light part of wave spectrum.

In a kind of trial of satisfying this demand, in having two reporter gene system of Photinus pyralis LUC, developed the luminescent system of the emission blue light of sea pansy (sea pansy) Renilla reniformis.Sea pansy (Renilla reniformis and closely-related kind) luminous in blue spectrum, this provides in some applications with respect to yellowish green luminous advantage.The chemistry of sea pansy photoresponse and beetle uncorrelated, reaction intermediate produces by the approach that is different from the beetle luciferase.Particularly, renilla luciferase catalysis coelenterazine (coelenterazine) is sent blue light to the oxidation of coelenterazine acid amides (coelenteramide) at the 480nm place.May relate to the dioxetane intermediate, but adenylylation does not take place.Renilla luciferase is uncorrelated with the enzyme of beetle luciferase or formation adenylic acid (AMP) on evolving.Referring to, for example, United States Patent (USP) the 5th, 292, No. 658 and the 5th, 418, No. 155.

The benefit and limitation of renilla luciferase

Renilla luciferase/coelenterazine system is as the main advantage of genetic expression reporter gene, and it is luminous in blue spectrum that its use is different from the substrate of beetle fluorescein.Therefore, renilla luciferase can be used from double-label experiment with beetle luciferase/luciferin one.Referring to, for example, United States Patent (USP) the 5th, 744, No. 320.Yet in others, renilla luciferase is inferior to the beetle luciferase, and is luminous because the coelenterazine substrate shows low-level non-enzymatic.The luminous of this level changes according to the hydrophobicity of environment, and these two phenomenons have seriously limited the absolute sensitivity of check together.

The beetle luciferase can not lock into this defective, supposition is that (fluoresceinization-AMP) never can find to be free in the solution, but as indicated above is synthesized along with the oxidation that takes place on the enzyme because oxidable substrate, combined closely by luciferase simultaneously, subsequently very short age.

Other shortcoming of renilla luciferase is that it can not be directly used in the quantitative application of relevant ATP, because ATP is not used in reaction.In addition, renilla luciferase can not stand continuous double-tagging check in the presence of the beetle luciferase of active or not cancellation.

Orfelia fultoni

Orfelia fultoni is a kind of noclilucence fly (Diptera) (Fulton, 1941) that is found in the North America.The bacterium Simulium Australasia fly that biological property that it is common and next section are described is closely similar.According to Viviani, people such as Hasting (Viviani, people such as Hastings 2002), Orfelia sends the blue light of λ max=460nm, and wavelength ratio will be lacked from the light of other insect.What is interesting is, the luminous ATP that do not rely on of Orfelia, this characteristic is different from the luminous of all other insects, and it is stimulated by some gentle reductive agents.Viviani, people such as Hastings have characterized the luciferase (Viviani, people .2002 such as Hastings) of Orfelia on biological chemistry top.

The bacterium buffalo gnat

Spread all over east Australia and have the Lampyridea of launching blue light in shielded habitat, this is that the Australia original inhabitants are known over tens thousand of years.Closely-related species appear at New Zealand with the concentration of magnificence.Lampyridea uses its blue-light-emitting to lure prey to enter in the viscosity net, and it is the larva of keroplatid fly.But the description in initial Europe is thought it larva of the beetle relevant with the female big Lampyridea of Lampyridea (Lampyris noctiluca, Coleoptera, glimmering section insect) in Europe by mistake.(Diptera: bacterium Dulicidae (Keroplatidae): (Baker 2004 for species bacterium buffalo gnat subfamily (Arachnocampinae)) for the Australasia Lampyridea of present understanding; Harrison 1966; Pugsley 1983) part lists in table 1.

Table 1

Title belongs to (subgenus) and plants (authority)
	Bacterium buffalo gnat (Campara) richardsae (Harrison)
Bacterium buffalo gnat (bacterium buffalo gnat) tasmaniensis (Ferguson)
	Bacterium buffalo gnat (Campara) girraweenensis (Baker)
Bacterium buffalo gnat (Campara) gippslandensis (Baker)
	Bacterium buffalo gnat (Campara) otwayensis (Baker)
Bacterium buffalo gnat (Campara) tropicus (Baker)
	Bacterium buffalo gnat (bacterium buffalo gnat) buffaloensis (Baker)
Bacterium buffalo gnat (Campara) flava (Harrison)
	Bacterium buffalo gnat (bacterium buffalo gnat) luminosa (Skuse)

According to (Shimomura, people such as Johnson, 1966), the maximum value of bacterium buffalo gnat emmission spectrum is 487 ± 5nm, and this meets the correct transmission spectrum (Lee 1976) that A.richardsae presents very much.Viviani, the emission maximum that people such as Hastings (2002) propose A.flava is 484nm.Lee (1976) shows that also the luminous ATP of being subjected to of Arachnocampa luciferases excites, and requires Mg ⁺⁺Short wavelength's emission shows that the Arachnocampa luciferases substrate is different from beetle fluorescein (Wood 1983), and in fact, (Lee 1976 not confirm to stimulate Arachnocampa luciferases by beetle D-fluorescein as yet; Wood1983; Viviani, people such as Hastings, 2002).

Wood (1983) shows that the luminous of the cold extraction thing of the bacterium buffalo gnat light organ that exhausts can be regenerated by adding heat treated extract.Viviani, people such as Hastings (Viviani, people such as Hastings 2002) can use some bacterium buffalo gnat fluoresceins of acid ethyl acetate extraction, and use TLC to carry out part and separate.Still can not obtain structural information about natural bacterium buffalo gnat fluorescein.According to Viviani, people such as Hastings (2002), the molecular weight of Arachnocampa luciferases is speculated as 36kDa by gel-filtration, promptly approximately is half (Conti, people such as Franks 1996) of Photinus pyralis LUC molecular weight (it is 62kDa).

Summary of the invention

On the one hand, the invention provides a kind of isolating peptide, it comprises the aminoacid sequence that is selected from SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.On the other hand, the invention provides a kind of isolating peptide, it comprises the aminoacid sequence of the variant of the aminoacid sequence that is selected from SEQ ID NO:2, SEQ IDNO:6, SEQ ID NO:8 and SEQ ID NO:10, wherein this variant is by following nucleic acid molecule encoding, and this nucleic acid molecule is selected from nucleic acid molecule or the hybridization of its complement of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9 with sequence under stringent condition.

On the other hand, the invention provides a kind of isolating peptide, it comprises the straight aminoacid sequence to homologue of the aminoacid sequence that is selected from SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10, wherein this directly to homologue by following nucleic acid molecule encoding, this nucleic acid molecule is selected from the nucleic acid molecule of SEQ ID NO:1, SEQ ID NO:3, SEQ IDNO:5, SEQ ID NO:7 and SEQ ID NO:9 or the hybridization of its complement with sequence under stringent condition.

Again on the other hand, the invention provides a kind of isolating peptide, it aminoacid sequence that comprises comprises the fragment of the aminoacid sequence of at least 10 continuous amino acids that are selected from SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.In concrete embodiment, the present invention includes isolating peptide, its aminoacid sequence that has is shared at least 70%, 80% or 90% identity with the aminoacid sequence that is selected from SEQ ID NO:2, SEQID NO:6, SEQ ID NO:8 and SEQ ID NO:10.Some preferred embodiment in, the molecular weight of isolating peptide of the present invention is greater than 36 kilodaltons (kD).These peptides can be called " peptide of the present invention ".

In particularly preferred embodiments, the invention provides the enzymic activity part of peptide of the present invention, it causes the catalysis of luminous reaction, and the spectrum of this luminous reaction is being less than or equal to the wavelength place performance emission maximum of 530 ± 5nm.In particularly preferred embodiments, luminous reaction depends on ATP.

As shown here, ± 5nm reflects the typical accuracy that this wavelength can be clear and definite.Particularly, the preferred implementation luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 520 ± 5nm, 510 ± 5nm, 500 ± 5nm or 490 ± 5nm.These peptides that show these uciferase activities can be called " the plain enzyme of active fluoro " of the present invention or " peptide of the present invention of performance uciferase activity ", " functional luciferase " or " GW luciferase ".

In preferred embodiment, the invention provides a kind of isolating peptide that shows uciferase activity, wherein uciferase activity comprises the dependent luminous reaction of catalysis ATP, and this luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 530 ± 5nm.In one embodiment, peptide comprises that the sequence identity with the amino acid 200-350 of the sequence that is selected from SEQ ID NO:2, SEQ ID NO:6, SEQID NO:8 and SEQ ID NO:10 is at least 70% continuous amino acid sequence.

In another embodiment, the invention provides a kind of isolating peptide that shows uciferase activity, wherein uciferase activity comprises the dependent luminous reaction of catalysis ATP, this luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 530nm, and wherein isolating peptide has following aminoacid sequence, when comparing, be that with the difference of SEQ ID NO:4 at least one place aminoacid sequence that is selected from R218 disappearance, H245N, G315S, L342S and T343S changes with Photinus luciferase (for example SEQ ID NO:4).In another embodiment again, such peptide has following aminoacid sequence, when comparing with SEQ ID NO:4, be to be selected from A22Y with the difference of SEQ ID NO:4, Y53A, L63T, E83D, F88Y, F89Y, P91I, A103C, Y109W, E113D, V139I, G160P, S198T, H212Q, the R218 disappearance, D224S, the P225 disappearance, G228D, P233K, P242Q, F243Y, H245N, L253M, Y255R, F273Y, Y280F, S298K, L300E, E311R, G315S, P318T, L319V, G339F, L342S, T343S, D375H, K380A, E389F, T408S, W417Y, L418V, D427N, L441I, I442V, K443M, Y444V, K445D, Q448A, A452T, L458I, V485L, V486T, G490R, V506L, R513K, V516C, T527A, with begin from K549 and comprise that its at least one aminoacid sequence to all residues disappearance of carboxylic end changes.Peptide of the present invention comprises based on SEQ ID NO:4 sequence but comprises the peptide that the aminoacid sequence listing as mentioned or list in a place or many places changes that in table 5 it describes in detail hereinafter.

In other preferred implementation, the aminoacid sequence that the isolating peptide of performance uciferase activity of the present invention has is shared at least 70% identity with the aminoacid sequence that is selected from SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.

In concrete embodiment, the plain enzyme peptide of active fluoro comprises the aminoacid sequence that is selected from SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.On the other hand, the invention provides the plain enzyme peptide of a kind of active fluoro, it comprises the aminoacid sequence of the variant of the aminoacid sequence that is selected from SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10, wherein this variant is by following nucleic acid molecule encoding, and this nucleic acid molecule is selected from nucleic acid molecule or the hybridization of its complement of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQID NO:7 and SEQ ID NO:9 with sequence under stringent condition.

On the other hand, the invention provides the plain enzyme peptide of a kind of active fluoro, it comprises the straight aminoacid sequence to homologue of the aminoacid sequence that is selected from SEQ IDNO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10, wherein this directly to homologue by following nucleic acid molecule encoding, this nucleic acid molecule is selected from the nucleic acid molecule of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9 or the hybridization of its complement with sequence under stringent condition.

Again on the other hand, the invention provides the plain enzyme peptide of a kind of active fluoro, it aminoacid sequence that comprises comprises the fragment of the aminoacid sequence of at least 10 continuous amino acids that are selected from SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ IDNO:10.In concrete embodiment, the present invention includes the plain enzyme peptide of active fluoro, its aminoacid sequence that has is shared at least 70%, 80% or 90% identity with the aminoacid sequence that is selected from SEQ IDNO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.Some preferred embodiment in, the molecular weight of the bioactive peptide of performance uciferase activity of the present invention is greater than 36 kilodaltons.

Another aspect of the present invention comprises optionally the antibody in conjunction with peptide of the present invention.In preferred embodiment, such antibody can be used to detect the existence that is selected from following peptide of the present invention: (a) aminoacid sequence shown in the SEQ ID NO:2; (b) aminoacid sequence of the variant of the aminoacid sequence shown in the SEQ ID NO:2, wherein this variant is by the nucleic acid molecule encoding of hybridizing with the nucleic acid molecule shown in the SEQID NO:1 or its complement under stringent condition; (c) aminoacid sequence shown in the SEQ IDNO:2 directly to the aminoacid sequence of homologue, wherein should be directly to homologue by under stringent condition with the nucleic acid molecule encoding of nucleic acid molecule shown in the SEQ ID NO:1 or the hybridization of its complement; (d) fragment of the aminoacid sequence shown in the SEQ ID NO:2, wherein this fragment comprises at least 10 continuous amino acids.

The present invention further comprises a kind of isolated nucleic acid molecule, the aminoacid sequence of the nucleotide sequence coded SEQ of being selected from ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10 that it comprises.The present invention comprises a kind of nucleotide sequence equally, its coding is selected from the variant of the aminoacid sequence of SEQ IDNO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10, and wherein this nucleotides sequence is listed under the stringent condition and hybridizes with the nucleic acid molecule that is selected from SEQ ID NO:1, SEQ IDNO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9 or its complement.And, the present invention includes a kind of nucleotide sequence, its coding be selected from SEQ IDNO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10 aminoacid sequence directly to homologue, wherein this nucleotides sequence is listed under the stringent condition and nucleic acid molecule that is selected from SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9 or the hybridization of its complement.Further again, the present invention includes a kind of nucleotide sequence, its coding is selected from the fragment of at least 10 continuous amino acids of the aminoacid sequence of SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10, also comprises the nucleotide sequence of the complement of this nucleotide sequence.

The described nucleic acid molecule that the present invention includes can be called " nucleic acid molecule of the present invention ".The present invention includes its nucleotide sequence for the complement of nucleic acid molecule of the present invention.

In other each embodiment, the present invention further is included in the nucleic acid molecule of the present invention that comprises in gene chip, transgenic cell, nucleic acid carrier or the host cell.

Method of the present invention comprises the method for the existence of nucleic acid molecule of the present invention in the test sample.Therefore, in concrete embodiment, this method comprises makes sample contact with oligonucleotide, this oligonucleotide and nucleic acid molecule hybridize under stringent condition of the present invention, and detect oligonucleotide and whether combine with nucleic acid molecule in the sample.

Other method of the present invention comprises, for example, monitoring the method for the gene of paying close attention to or the expression of its part in host cell, this method comprises: (a) introduce vector construct in host cell, this vector construct comprises nucleic acid molecule of the present invention, and further comprises the nucleic acid molecule of coding purpose nucleotide sequence or product; Nucleic acid molecule wherein of the present invention and aim sequence or product coexpression; (b) existence of the expression of detection nucleic acid molecule of the present invention, thereby the expression of monitoring purposes sequence or product.

In concrete grammar of the present invention, the peptide of nucleic acid molecule encoding performance uciferase activity of the present invention.Therefore, in a preferred method of the invention, the existence that detects nucleic acid molecule expression of the present invention comprises the uciferase activity check.In particularly preferred method, uciferase activity comprises the dependent luminous reaction of catalysis ATP, and this luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 530 ± 5nm.

In other embodiment within the scope of the present invention, expression vector comprises the nucleotide sequence of the present invention that is connected with promotor operation (operative).In concrete embodiment, promotor has function in the cell that is selected from vegetable cell, bacterial cell, zooblast and insect cell.In another embodiment, carrier further comprises other sequence that coding is paid close attention to or the nucleotide sequence of product.Other sequence paid close attention to or product can be nucleic acid, protein, the plain enzyme of active fluoro or its enzymic activity part.Certainly, in other embodiment, the present invention includes the host cell that contains carrier of the present invention.Host cell can be any suitable cell.In concrete embodiment, host cell is selected from vegetable cell, insect cell, fungal cell, zooblast and bacterial cell.

Again aspect another, method of the present invention comprises the method with purpose nucleic acid or conversion of its part or transfection host cell, this method comprises: (a) introduce vector construct in host cell, this vector construct comprises the nucleic acid molecule of the present invention of the peptide of coding performance uciferase activity, and the peptide that wherein shows uciferase activity is expressed; (b) detect uciferase activity, thereby confirm that host cell is transformed or transfection.

In another embodiment, method of the present invention comprises the active method of monitoring host cell middle controller element (controller element), this method comprises: (a) introduce vector construct in host cell, this vector construct comprises nucleic acid molecule of the present invention, and itself and controller component are operatively connected; (b) existence of detection luciferase, thereby the activity of monitor controller element.Controller component in this embodiment can be promotor or enhanser.Nucleic acid molecule of the present invention can be encoded and be showed the peptide of uciferase activity.In such embodiment of peptide performance uciferase activity, the existence that detects luciferase can be the check of uciferase activity.

Other method of the present invention comprises differentiates compound and be the method for inferring substrate of functional luciferase that this method comprises: the functional luciferase that (a) makes nucleic acid molecule encoding of the present invention contacts with at least a candidate compound under the condition of functional uciferase activity being suitable for; (b) check uciferase activity, wherein the detection of uciferase activity shows that at least a candidate compound is the substrate of inferring of functional luciferase.The new compound of differentiating by the operation of method of the present invention obviously comprises within the scope of the present invention.

Particularly preferred method of the present invention is included in the active method of measuring at least two kinds of report enzymes in the aliquots containig, this method comprises by measuring optical signal that luminous reaction produced by the first report enzyme catalysis checks the activity of the first report enzyme, and checks the activity of at least the second report enzyme by measuring optical signal that luminous reaction produced by at least the second report enzyme catalysis.This method comprises the method that those checks are carried out in identical aliquot sample.In these embodiments, check can be carried out with random order, grouping or desired time sequence or routine.In concrete embodiment, multiple check is carried out simultaneously.In other embodiment, at least a check was carried out before at least the second check, and perhaps at least a check is carried out after other check at all, and perhaps check is carried out successively.In concrete embodiment, the first report enzyme comprises the plain enzyme of active fluoro of the present invention.Certainly, in particularly preferred embodiments, at least a in the enzyme of report is the peptide of performance uciferase activity, and wherein uciferase activity comprises the dependent luminous reaction of catalysis ATP, and this luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 530 ± 5nm.

In another embodiment again, at least two kinds of report enzymes are luciferases of dependency ATP.In particularly preferred embodiments, the first report enzyme is an Arachnocampa luciferases, and the second report enzyme is different luciferase." different luciferases " are meant any other luciferase, no matter rely on or dependency ATP not.Particularly preferred different luciferase comprises the luciferase of Lampyridea, discount worm or railway worm (railroad worm).The catalytic luminous reaction of other preferred luciferase produces maximum emission intensity at the emmission spectrum greater than the wavelength place of 530nm.

Other target of the present invention, feature and advantage will be conspicuous according to following detailed description.But be to be understood that, although the present invention has illustrated concrete embodiment, detailed description and specific embodiment provide as just example, because specify according to this, variation in the various spirit and scope of the invention and modification will be conspicuous to those skilled in the art.

Description of drawings

The following drawings forms the part of this specification sheets, and it is included to further specify some aspect of the present invention.With reference to one or more in these accompanying drawings and of the present invention the specifying that provide in conjunction with this paper, the present invention may be better understood.

The total nucleotide sequence (SEQID NO:1) of Figure 1A .Arachnocampa richardsae luciferase.

The total nucleotide sequence (SEQID NO:1) of Figure 1B .Arachnocampa richardsae luciferase, continuous from Figure 1A.

The nucleotide sequence and the corresponding amino acid sequence of Fig. 2 A.Arachnocampa richardsae luciferase.

The nucleotide sequence and the corresponding amino acid sequence of Fig. 2 B.Arachnocampa richardsae luciferase, continuous from Fig. 2 A.

The consensus amino acid sequences (SEQID NO:2) of Fig. 3 .Arachnocampa richardsae luciferase.

Fig. 4. the nucleotide sequence of luciferase of the present invention (SEQ ID NO:3).

The nucleotide sequence and the corresponding amino acid sequence of Fig. 5 A. luciferase peptide of the present invention.

The nucleotide sequence and the corresponding amino acid sequence of Fig. 5 B. luciferase peptide of the present invention, continuous from Fig. 5 A.

The nucleotide sequence and the corresponding amino acid sequence of Fig. 5 C. luciferase peptide of the present invention, continuous from Fig. 5 B.

Fig. 6 A. is from the comparison of luciferase aminoacid sequence and the Arachnocampa richardsae luciferase of the luminous beetle of 18 species.

Fig. 6 B. is from the comparison of luciferase aminoacid sequence and the Arachnocampa richardsae luciferase of the luminous beetle of 18 species, and is continuous from Fig. 6 A.

Fig. 6 C. is from the comparison of luciferase aminoacid sequence and the Arachnocampa richardsae luciferase of the luminous beetle of 18 species, and is continuous from Fig. 6 B.

Fig. 6 D. is from the comparison of luciferase aminoacid sequence and the Arachnocampa richardsae luciferase of the luminous beetle of 18 species, and is continuous from Fig. 6 C.

Fig. 6 E. is from the comparison of luciferase aminoacid sequence and the Arachnocampa richardsae luciferase of the luminous beetle of 18 species, and is continuous from Fig. 6 D.

Fig. 7. the position of Arachnocampa luciferases in the molecular species system of other luciferase of acyl group-CoA ligase enzyme superfamily is learned.

Fig. 8. peptide of the present invention is from the expression of GWLuc#1.The band numbering from left to right.First band shows molecular weight standard, with kilodalton (kD) mark.Other band shows the coli strain BL21 (DE3) that transforms with pETDuet-1:FFLuc (band 3-5) and pETDuet-1:GWLuc#1 (band 6-8).Band 4 and 7 is presented at the culture samples of hatching under the situation that does not have IPTG 48 hours.Band 3 and 6 shows the pre-induction sample of culture.Band 5 and 8 is presented at the culture samples of hatching 48 hours and expressed relevant construction under the existence of 0.4mM IPTG.

Fig. 9. from natural acid sequence (the FF luciferase of the luciferase of Lampyridea Photinus pyralis; SEQ ID NO:4).

Figure 10. the nucleotide sequence (SEQ ID NO:5) of coding A.flava luciferase.

The aminoacid sequence of Figure 11 .A.flava luciferase (SEQ ID NO:6).

Figure 12. the nucleotide sequence (SEQ ID NO:7) of coding A.girraweenensis luciferase.

The aminoacid sequence of Figure 13 .A.girraweenensis luciferase (SEQ ID NO:8).

Figure 14. the nucleotide sequence (SEQ ID NO:9) of coding A.tasmaniensis luciferase.

The aminoacid sequence of Figure 15 .A.tasmaniensis luciferase (SEQ ID NO:10).

Figure 16. noclilucence is improved by luciferase of the present invention.

Figure 17. noclilucence is quantitative response by the amount that increases luciferase of the present invention.

Figure 18. calibration curve.

Figure 19. heat denatured is eliminated the noclilucence activity.

Figure 20. noclilucence depends on fluorescein and ATP.

Figure 21. the noclilucence activity is specific to peptide of the present invention.

Figure 22. peptide of the present invention does not use coelenterazine (coelentarazine) as substrate.

Figure 23. the maximum noclilucence that peptide of the present invention produces occurs in less than 530 ± 5nm wavelength place.

Figure 24. the expression of noclilucence activity of the present invention in yeast.

The multisequencing comparison of four kinds of Arachnocampa luciferases peptides of Figure 25 A..

The comparison of Figure 25 B. Figure 25 A is continuous.

Embodiment

Following embodiment and the detailed description of embodiment are to provide as example, and are not limited.Unless opposite indication is arranged or points out that in addition in these explanations and in this specification, term " " and " a kind of " are meant one or more (kinds).Similarly, term " or " be meant " and/or ".

What " comprise " being meant and including but not limited to, no matter be thing after word " comprises ".Therefore, use term " to comprise " and show that the element of listing is needs or compulsory, but other element chooses wantonly, can exist or not exist." by ... form " be meant and comprise and be limited to, though phrase " by ... form " in be what thing.Therefore, phrase " by ... form " show that the element of listing is needs or compulsory, and cannot have other element." substantially by ... form " be meant and comprise any element of listing in this phrase, and be limited to the element that other did not disturb or helped the active or effect of institute's column element in the disclosure.Therefore, phrase " substantially by ... form " show that the element of listing is needs or compulsory, but other element chooses wantonly, depends on whether it influences the active of institute's column element or act on and can exist or not exist.

Providing under the situation of numerical range, should be understood to the intermediate value between each this range limit and the lower limit, unless context is obviously pointed out in addition, until 1/10th units of lower limit, and the intermediate value in any other described or described scope, include within the present invention.These upper and lower bounds more among a small circle are also included within the present invention in can being included in more independently, and any concrete eliminating of carrying out in the described scope limits.

Peptide molecule

The invention provides the nucleotide sequence of encoded peptide molecule, this peptide molecule has been differentiated the member for proteinic luciferase family.The peptide sequence that provides, and obvious variant as herein described, particularly this paper discriminated union use the variant that belongs to together of information provided herein, will be called as enzyme of the present invention, enzyme peptide, peptide or protein.

One aspect of the present invention provides isolating peptide and protein molecule, its by Fig. 2,3,5,11,13,15 or SEQ ID NO:2,6,8 and 10 in the aminoacid sequence of disclosed enzyme peptide form or form or comprise by above-mentioned sequence substantially above-mentioned sequence, perhaps by Fig. 1,2,4,5,10,12,14 or SEQ ID NO:1,3,11,13 and 15 shown in nucleic acid molecule encoding, and these all this areas obvious variant of making and using.In these variants some are described in more detail below.

As used herein, when peptide is substantially free of cellular material or does not contain precursor or during other compound, claim that peptide is " separation " or " purification ".Peptide of the present invention can purify to homogeneity or other purity.The level of purifying will be based on set application.(feature of isolated nucleic acid molecule is hereinafter discussed).

In some applications, " do not contain cellular material substantially " and comprise and have other protein (being contaminating protein matter) of being less than about 30% (dry weight), be less than other protein of about 20%, be less than other protein of about 10% or be less than the preparation of other proteinic peptide of about 5%.When peptide reorganization produced, it can not contain substratum substantially yet, that is, cultivate fiduciary point protein formulation volume less than about 20%.

Literal " does not contain precursor or other compound " and comprises the preparation of peptide substantially, and wherein it separates from relate to its synthetic precursor or other compound.In one embodiment, literal " does not contain precursor or other compound substantially " and comprises and has the precursor or other compound that are less than about 30% (dry weight), is less than about 20% precursor or other compound, is less than about 10% precursor or other compound or is less than about 5% precursor or the preparation of the enzyme peptide of other compound.

Isolating enzyme peptide can be purified from its cell of natural expression, purifies from changing over the cell of expressing its (recombinant chou), or uses known protein matter synthesis method synthetic.For example, the cloned nucleic acid molecule of codase peptide in expression vector, is introduced expression vector in the host cell, protein is expressed in host cell.Can use standard protein purification techniques isolated protein from cell by suitable purification scheme then.Many these technology describe in detail hereinafter.

On the one hand, the invention provides the protein of forming by the aminoacid sequence that is provided.When aminoacid sequence was proteinic final aminoacid sequence, protein was made up of aminoacid sequence.

In others, the present invention further provides the protein of forming by the aminoacid sequence that is provided substantially.Protein is made up of aminoacid sequence substantially, is meant that such aminoacid sequence only exists with several amino-acid residues extraly, and for example, about 1 to about 100 extra residues in final protein, are generally 1 to about 20 extra residues.

Again aspect another, the invention provides the protein that the aminoacid sequence that is provided is provided.Protein comprises aminoacid sequence, is meant that aminoacid sequence is at least a portion of final protein amino acid sequence.In this mode, protein can only be peptide, perhaps has extra amino acid molecular, the amino-acid residue of associating natural with it (sequence of continuous programming code) for example, or allogeneic amino acid sequence or peptide sequence.Such protein can have several extra amino-acid residues, perhaps can comprise hundreds of or more extra amino acid.Hereinafter provide and how to have made or separate various types of these proteinic brief descriptions.

Enzyme peptide of the present invention can be connected with heterologous sequence, to form chimeric or fused protein.This chimeric and fused protein can comprise the enzyme peptide that is operatively connected with heterologous protein, the different substantially sources with the enzyme peptide of the aminoacid sequence that this heterologous protein has." being operatively connected " fusion that is meant enzyme peptide and heterologous protein makes operability separately all not be destroyed.Heterologous protein can be fused to the N-end or the C-end of enzyme peptide.

In some applications, fusion rotein can not influence the activity of enzyme peptide itself.For example, fusion rotein can include but not limited to, the enzymatic fusion rotein, and for example beta-galactosidase enzymes merges, the two hydridization GAL of yeast merge, poly--His fusions, MYC-mark, HI-mark and Ig fusion.These fusion roteins, particularly poly--His merges the purification that can promote the recombinase peptide.In some host cell (for example mammalian host cell), protein expression or secretion can be improved by using the allos signal sequence.

In some applications, fusion rotein can be the component of complementary action of protein check or PCA, wherein organized enzyme is divided into two structural domains, each merges with son (interactor) structural domain that interacts or is connected, it links together by attraction and the 3rd molecule, makes that the activity of protoenzyme is recovered.For example, referring to, United States Patent (USP) the 6th, 270, No. 964 and the 6th, 342, No. 345.

Chimeric or fusion rotein can produce by the recombinant DNA technology of standard.For example, link together in frame according to will the encode dna fragmentation of different proteins sequence of conventional art.In another embodiment, fusion gene can pass through conventional art, comprises that automatic dna synthesizer synthesizes.Perhaps, the connection of pcr amplification or gene fragment can use anchor primer to carry out, this anchor primer produces the complementary overhang between two adjacent gene fragments, it can renaturation also increase subsequently again, to produce chimeric gene sequence (referring to people such as Ausubel, Current Protocolsin Molecular Biology, 1998).And many expression vectors are commercially available, and it has been encoded and has merged part (for example GST protein).The nucleic acid of codase peptide can be cloned in such expression vector, makes that merging part is connected with the enzyme peptide in frame, and this is a kind of mode of making fusion rotein under the situation of not destroying each component operability.

As mentioned, the present invention also provides and activates the obvious variant of the proteinic aminoacid sequence of the present invention, for example the non-natural of the equipotential of the natural mature form of peptide, peptide or sequence variants, peptide reorganization deutero-variant and peptide directly to homologue and paralog.Those skilled in the art understand can from the isolating peptide of the present invention of bacterium Simulium (Diptera) directly to homologue and analogue, be the preferred implementation of peptide of the present invention.Such variant can be easy to use recombinant nucleic acid technology and protein biochemistry field technique known to produce.But should be appreciated that variant eliminating the present invention disclosed any complete aminoacid sequence before.

Use molecular engineering and sequence information disclosed herein, can differentiate or make such variant at an easy rate.And, based on the sequence or the structural homology of enzyme peptide of the present invention, can distinguish such variant and other peptide at an easy rate.The identity degree that exists will be mainly is divergence amount and the straight evolutionary distance between homologue that exists in functional variant or NOT-function variant, the paralog family based on peptide.

In order to determine the per-cent identity of two aminoacid sequences or two nucleotide sequences, in view of optimum compares purpose, with sequence alignment (for example, compare for optimum, can in one or two of first and second amino acid or nucleotide sequence, introduce breach, for comparing purpose, can ignore non-homogeneous sequence).In preferred embodiment,, be used for the comparison purpose with at least 30%, 40%, 50%, 60%, 70%, 80% or 90% or compare of reference sequence length more.The amino-acid residue or the Nucleotide at more corresponding then amino acid position or nucleotide position place.When the position in first sequence is occupied by the amino-acid residue identical with corresponding position in second sequence or Nucleotide, then molecule is same (as used herein, amino acid or nucleic acid " identity " are equal to amino acid or nucleic acid " homology ") in this position.Per-cent identity between two sequences is the function of the number of the same position shared of sequence, and considers the length of number He each breach of breach, and this need introduce for use in the optimum of two sequences and compare.

Variant and Fig. 2,3 or 5 or SEQ ID NO:2 in the sequence identity of listed aminoacid sequence be preferably at least 60%, more preferably with Fig. 2,3 or 5 or SEQ ID NO:2 in the sequence identity of listed aminoacid sequence be at least 70%, 80%, 90%, 95%, 98% or 99%.

Perhaps, as mentioned, sequence identity can be calculated at the specific region of peptide, for example fluorescein binding pocket (binding pocket).The sequence of the representative member Photinus pyralis of the aminoacid sequence of listed bacterium buffalo gnat (Arachnocampa spp) luciferase and beetle luciferase comparison shows that among the SEQ ID NO:2, the sequence identity in fluorescein binding pocket zone (being positioned at about amino acid 201 to 350 of SEQ IDNO:2) is about 28%, and the sequence identity of C-end regions (amino acid 351 to 530 of SEQ ID NO:2) is about 41% (table 6).Sequence identity on the n terminal amino acid 1 to 100 is about 29%.Therefore, peptide of the present invention preferably includes sequence identity with the amino acid 201 to 350 of SEQ ID NO:2 and is at least 50% continuous amino acid sequence, more preferably is at least 60%, 70%, 80%, 90%, 95%, 98% or 99% continuous amino acid sequence with the sequence identity of the amino acid 201 to 350 of SEQ ID NO:2.Perhaps, or extraly, peptide of the present invention preferably includes sequence identity with the amino acid 351 to 530 of SEQ ID NO:2 and is at least 50% continuous amino acid sequence, more preferably is at least 60%, 70%, 80%, 90%, 95%, 98% or 99% continuous amino acid sequence with the sequence identity of the amino acid 351 to 530 of SEQ ID NO:2.Peptide of the present invention can also comprise that the sequence identity with the amino acid/11 to 201 of SEQ ID NO:2 is at least 50% continuous amino acid sequence, more preferably is at least 60%, 70%, 80%, 90%, 95%, 98% or 99% continuous amino acid sequence with the sequence identity of the amino acid 201 to 350 of SEQ ID NO:2.

To relatively having confirmed 128 conservative fully residues from the luciferase aminoacid sequences of 18 kinds of luminous beetles.When comparing the corresponding residue of bacterium buffalo gnat species, 55 in these residues is different (adding 3 places disappearance).55 different in A.richardsae residues are listed in the table 5.The aminoacid sequence that preferred peptide comprises comprises corresponding to 55 amino-acid residues, i.e. Y26 listed in the table 5, A54, T64, D84, Y89, Y90, I92, C104, W110, D114,1140, P161, T197, Q211, S219, D221, K226, Q235, Y236, N238, M246, R248, Y266, F273, K291, E293, R304, S308, T311, V312, F332, S335, S336, H367, A372, F381, S400, Y409, V410, N419, I433, V434, M435, V436, D437, A440, T444, I450, L477, T478, R481, L497, K504, C507, A518.The aminoacid sequence that other preferred peptide comprises comprises corresponding to aminoacid sequence listed in the table 5, it is arranged in the fluorescein binding pocket at about amino acid 201 to 350 places, i.e. Q211, S219, D221, K226, Q235, Y236, N238, M246, R248, Y266, F273, K291, E293, R304, S308, T311, V312, F332, S335, S336.

The determining of sequence comparison between two sequences and per-cent identity and similarity can use mathematical algorithm to carry out.(Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing:Informatics andGenome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in MolecularBiology, von Heinje, G., Academic Press, 1987; With Sequence AnalysisPrimer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991).

In preferred embodiment, multisequencing contrast and kind system tree use PROTML or PROTPARS program to obtain: PROTML (Adachi, J. and Hasegawa, M.1996:Molphy Version 2.3. is used for program based on the molecule race auxology of maximum probability.The publication of Computer Science monographs No.28. Tokyo statistical mathematics institute); And PROTPARS (Felsenstein, J.1989.PHYLIP-Phylogeny Inference Package (Version 3.2) .Cladistics 5:164-166).

The level of comparison and sequence identity and homology uses the BestFit program in the GCG software package to determine in pairs.Per-cent identity between two aminoacid sequences can use the algorithm of Needleman and Wunsch to determine (J.Mol.Biol.48:444-453 (1970)), and it has been attached in the GAP program in the GCG software package.Blossom62 matrix (matrix) or PAM250 matrix are used in the employing of this algorithm, and breach weight (gap weight) is 16,14,12,10,8,6 or 4, and length weight (length weight) is 1,2,3,4,5 or 6.Per-cent identity between two nucleotide sequences uses the GAP program to determine (Devereux, J., Deng the people, Nucleic Acids Res.12 (1): 387 (1984)), use the NSWgapdna.CMP matrix, breach weight is 40,50,60,70 or 80, and length weight is 1,2,3,4,5 or 6.

Nucleic acid of the present invention and protein sequence can further be used as " search sequence (querysequence) ", to retrieve at sequence library, for example, to differentiate other family member or correlated series.This retrieval can use people's such as Altschul NBLAST and XBLAST program (version 2.0) to carry out (J.Mol.Biol.215:403-10 (1990)).The retrieval of BLAST Nucleotide can be carried out with the NBLAST program, keep the score=100, word length=12 are to obtain and nucleic acid molecule homologous nucleotide sequence of the present invention.BLAST protein retrieval can use the XBLAST program to carry out, and keeps the score=50, and word length=3 are to obtain the aminoacid sequence with protein homology of the present invention.Be used for the comparison purpose in order to obtain the breach comparison, can use as the described breach BLAST of people such as Altschul (Nucleic Acids Res.25 (17): 3389-3402 (1997)).When using BLAST and breach blast program, can use the default parameter of each program (for example XBLAST and NBLAST).

Comprise protein one of peptide of the present invention, total length preprocessing form and ripe form processing, can easily differentiate to having sequence identity completely with one of enzyme peptide of the present invention, and the nucleic acid molecule encoding of the enzyme peptide provided herein that is encoded.

The allelic variant of enzyme peptide can easily be differentiated the Arachnocampa luciferases peptide that has height sequence identity at least a portion with enzyme peptide disclosed herein.As used herein, when the homology of aminoacid sequence is generally at least approximately 70-80%, 80-90%, the most about 90-95% or when higher, two kinds of protein (or proteinic zone) have the sequence identity of height.According to the present invention, significantly the homologous aminoacid sequence will be by the stringent condition of more abundant description hereinafter nucleotide sequence coded with the making nucleic acid molecular hybridization of the Arachnocampa luciferases peptide of encoding down.

Directly can easily differentiating at least a portion with the enzyme peptide has to a certain degree remarkable sequence identity of enzyme peptide to homologue, and by from another organic genes encoding.Preferably directly separate to the organism of homologue from the member that is categorized as bacterium Simulium (Diptera).Like this directly to homologue will by more abundant description hereinafter, gentle to stringent condition nucleotide sequence coded with novel nucleic acids molecular hybridization disclosed herein down, it depends on the proteinic two kinds of organic degrees of correlation of generation.

The non-natural variant of enzyme peptide of the present invention can easily use recombinant technology to produce.Such variant includes but not limited to, the disappearance in the aminoacid sequence of enzyme peptide, increase and displacement.For example, class displacement is a conservative amino acid replacement.This displacement is with another kin amino-acid substitution with the specific amino acids in the enzyme peptide.What be commonly referred to be conservative substitution is mutual replacement between aliphatic amino acid Ala, Val, Leu and the Ile; The exchange of hydroxyl residue Ser and Thr; The exchange of acidic residues Asp and Glu; Displacement between amide residues Asn and the Gln; The exchange of alkaline residue Lys and Arg; And the displacement of aromaticity residue Phe and Tyr.About may phenotype the guidance that changes of the amino acid of silence can be referring to people such as Bowie, Science247:1306-1310 (1990).

Be compared to functional peptide, the peptide of SEQ ID NO:2 for example, the variant enzyme peptide can not change on all functions, perhaps can form by the function of the change in one or more activity, perhaps even lack function in one or more activity, for example with the displacement of substrate bonded ability or emmission spectrum.Functional variant can only contain conservative the variation or the variation in non-key residue or non-critical areas.Fig. 6, table 3 and 5 and further details wherein can be used to discern key structure territory/zone.Functional variant can also contain and not cause changes of function or change inapparent similar amino acid whose displacement.

In one embodiment, variant has uciferase activity, and this uciferase activity comprises the dependent luminous reaction of catalysis ATP, and this luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 530nm.Preferably, variant has the uciferase activity of the luciferase of at least 25% SEQ ID NO:2, the more preferably uciferase activity of the luciferase of at least 40%, 50%, 60%, 70%, 80%, 90% or 95% SEQ ID NO:2.In particularly preferred embodiments, variant has the uciferase activity of the luciferase of SEQ ID NO:2 at least, and perhaps activity is bigger.

Perhaps, amino-acid substitution can change function to a certain extent.Such variant contains displacement, disappearance, insertion, the inversion or truncate of one or more non-conserved amino acids usually in Key residues or critical area.Similarly, Fig. 6, table 3 and 5 and further details wherein can be used for discerning such change in key structure territory/zone.The variant of changing function can also contain and not cause changes of function or change inapparent similar amino acid whose displacement.

The necessary amino acid of function also can be discerned by methods known in the art, for example site-directed mutagenesis or alanine scanning mutagenesis (people such as Cunningham, Science244:1081-1085 (1989)).A kind of method each residue place in molecule, back introduces single alanine mutation.In check, the mutant molecule that produces is carried out biological activity test, for example enzymic activity or emmission spectrum displacement then.Binding partners/substrate bonded critical sites also can determine by structural analysis, for example crystallization, nucleus magnetic resonance or light avidity mark (people such as Smith, J.Mol.Biol.224:899-904 (1992); People such as de Vos, Science 255:306-312 (1992)).The crystalline structure of Photinus luciferase is known (people Structure4:287-298 (1996) such as Conti), can reference when carrying out the identification of function key amino acid.Referring to, for example, people such as Nakatsu (2006).

Write peptide or enzyme peptide sequence, amino acid position begins to be numbered to the carboxylic terminal amino acid from the initial methionine that is numbered " 1 ".The concrete amino acid of particular locations represents that with amino acid whose single-letter title for example M is MET or methionine(Met), is the Position Number of related amino acid then, and for example M1 is an initial methionine.From context, obviously find out, peptide ammino acid sequence of the present invention and other for example the Photinus luciferase some relatively in, the order that relatively is described has been represented the related amino acid sequence of the refers to of institute's reference.Therefore, residues different with Photinus pyralis luciferase in the Arachnocampa richardsae luciferase can be expressed as, for example, A343I351, the L-Ala of 343 positions is corresponding to the Isoleucine of 351 positions among the P.pyralis in this expression bacterium buffalo gnat sequence.Similarly, DEL213-214 R218 represents that if there is arginine, the arginine of 218 positions of P.pyralis disappearance falls between the residue 213 and 214 of bacterium buffalo gnat sequence.Referring to, for example, the comparison that Fig. 6 A-6E provides.

Locational displacement in aminoacid sequence or the peptide, by amino acid single-letter title, then be the Position Number of relevant non-constant series or peptide, be that one or more single-letter titles of substituted amino acid are represented then.Therefore, for example, the leucine of natural Photinus pyralis luciferase 342 positions is replaced as Serine and is expressed as L342S.Similarly title is very clearly from context and further details provided herein.For example, the other title of L342S can be expressed as L342-＞S.Similarly, the identical change in other luciferase sequence can be shown as with reference to any one such sequence table " with the Leu of SEQ ID NO:4 ₃₄₂The position of parallelism is replaced as Ser with Leu ".

The present invention also further provides the fragment of peptide outside the protein and peptide that comprise these fragments and be made of it, particularly comprise Fig. 2,3,5 and SEQ ID NO:2 in the fragment of the residue determined.But the fragment that the present invention relates to and being not construed as will be included in disclosed fragment before the present invention.

Comprise that the peptide fragment of the present invention of molecule N-end can stop the genetically engineered generation in site by the translation in the coding region.Perhaps, can produce multiple N-end, C-end and intermediate segment with the proteolysis enzyme treated peptide that is called proteolytic enzyme.In some embodiments, peptide can be synthetic by currently known methods.Segmental example can comprise that length is 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,30,35,40,45,50,55,60,65,75,80,85,90,95,100,200,300,400,500 or more a plurality of amino acid whose continuous residue.These fragments can be purified according to known method, for example the separation (sedimentation, gel electrophoresis, gel-filtration) of precipitation (for example ammonium sulfate), HPLC, ion-exchange chromatography, avidity chromatogram (comprising immune avidity chromatogram) or various scopes.

These fragments can be selected based on the ability that keeps one or more enzyme peptide biological activities, perhaps can select to bring into play the ability of function, for example combine with substrate or serve as immunogen.The fragment of particularly important is a bioactive fragment, and for example, length is about 10 or more a plurality of amino acid whose peptide.Such fragment generally includes the structural domain or the motif of enzyme peptide, for example, and the avtive spot of enzyme peptide, membrane spaning domain, substrate binding domains or enzymatic activity part.And possible fragment includes but not limited to, contains fragment, the soluble peptide fragment of structural domain or motif and contains the fragment of immunogen structure.The structural domain of prediction and functional site can be discerned (for example PROSITE analyzes) by the computer program of as well known to those skilled in the art and easy acquisition at an easy rate.

In one embodiment, fragment has uciferase activity, and this uciferase activity comprises the dependent luminous reaction of catalysis ATP, and this luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 530nm.Preferably, fragment has the uciferase activity of the luciferase of at least 25% SEQ ID NO:2, the more preferably uciferase activity of the luciferase of at least 40%, 50%, 60%, 70%, 80%, 90% or 95% SEQ ID NO:2.In particularly preferred embodiments, fragment has the uciferase activity of the luciferase of SEQ ID NO:2 at least, and perhaps activity is bigger.

Polypeptide of the present invention can contain 20 amino acid amino acid in addition of so-called 20 natural amino acids.And many amino acid comprise end amino acid, can for example process and other posttranslational modification by natural method, perhaps modify by chemical modification technology well known in the art.The common modification of natural generation is described in basic reader, detailed feature article and scientific research document in the enzyme peptide, and they are well known to a person skilled in the art.

Known modification includes but not limited to; acetylize; acylations; the ADP-ribosylation; amidation; flavine covalently bound; heme moiety covalently bound; Nucleotide or nucleotide derivative covalently bound; lipid or lipid derivate covalently bound; phosphatidylinositols covalently bound; crosslinked; cyclisation; disulfide linkage forms; demethylation; covalent cross-linking forms; Gelucystine forms; Pyrrolidonecarboxylic acid forms; formylation; gamma-carboxylation; glycosylation; the formation of GPI anchor; hydroxylation; iodate; methylate; the Semen Myristicae acidylate; oxidation; proteolysis processing; phosphorylation; isoprenylation; racemization; selenoization (selenoylation); sulfation; the amino acid of transfer-RNA mediation is to proteinic interpolation, for example arginylization and ubiquitination.

These modifications are well known to a person skilled in the art, have obtained describing in detail in scientific literature.For example, the gamma-carboxylation of several common especially modifications---glycosylation, lipid connection, sulfation, glutaminic acid residue, hydroxylation and ADP-ribosylation, be described in the most basic textbook, Proteins-Structure and Molecular Properties for example, 2nd Ed., T.E.Creighton, W.H.Freeman and Company, New York (1993).This theme has many detailed summaries, Wold for example, F., Posttranslational Covalent Modification ofProteins, B.C.Johnson, Ed., Academic Press, New York 1-12 (1983); People (Ann.N.Y Acad.Sci.663:48-62 (1992)) such as people such as Seifter (Meth.Enzymol.182:626-646 (1990)) and Rattan.

Therefore, enzyme peptide of the present invention also comprises derivative or analogue, wherein the metathetical amino-acid residue is not the residue of genetic code coding, comprising substituting group, wherein maturing enzyme peptide and other compound (for example increasing the compound (for example polyoxyethylene glycol) of enzyme peptide transformation period) merge, perhaps wherein extra amino acid and maturing enzyme peptide merge, for example leader sequence or secretion sequence or the be used to sequence or preceding albumen (pro-protein) sequence of maturing enzyme peptide of purifying.

The application of proteins/peptides

The potential application of peptide of the present invention is mainly based on proteinic source and proteinic classification/effect.These application can use information provided herein (it is for well known in the art) and normal experiment to determine at an easy rate.Protein of the present invention (comprise may before the present invention disclosed variant and fragment) can be used to relate to the biological test of luciferase member involved enzyme.These checks are usually directed to any known enzyme function or activity or luciferase character.Peptide of the present invention, fragment or luciferase also can be used for well known by persons skilled in the art and be suitable for the luciferase peptide or segmental any method or composition.The non exhaustive tabulation of example use comprises United States Patent (USP) the 6th, 927,037; 6,690,461; 6,602,658; 6,602,657; 6,586,196; 6,503,723; 6,297,018; 6,171,809; 6,143,502; With 6,068, those disclosed in No. 979.And, embodiments of the present invention for example be suitable for the excitability mating partner (excitatory partner) in being called the technology that the noclilucence resonance energy shifts (BRET) application (referring to, for example, WO/1999/066324)..

Protein of the present invention can be used to produce antibody, perhaps causes other immune response; Be used as reagent in the check of the level of the protein in being designed to the quantitative assay biofluid (or its binding partners or part); And as the marker of the tissue of expressing earlier of fine quality of corresponding protein wherein.During in protein binding or potentially in conjunction with another albumen or part (for example, in enzyme-effector protein-interacting or enzyme-ligand interaction), protein can be used for differentiating binding partners/part, differentiates the system of binding interactions inhibitor with exploitation.These any or all of application can be developed to reagent grade or kit form, are used for the commercialization of commodity.

The method that is used to carry out above-mentioned application is well known to a person skilled in the art.The reference that discloses these methods comprises " Molecular Cloning:A Laboratory Manual ", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E.F.Fritsch and T.Maniatis eds., 1989 and " Methods in Enzymology:Guide to MolecularCloning Techniques ", Academic Press, Berger, S.L. and A.R.Kimmel eds., 1987.

Polypeptide can be used to differentiate the compound of regulating proteinic enzymic activity with the form of its native state or change.Enzyme of the present invention and suitable variant and fragment may be used to high flux screening, combine or participate in the ability of luminous reaction with enzyme with the check candidate compound.These compounds can further screen at functional enzyme, to determine the influence of compound to enzymic activity.And these compounds can be tested in animal or invertebrates system, to measure activity/effectiveness.Compound can also be differentiated to enzyme being activated (agonist) or deactivation (antagonist) to required degree.

And, protein of the present invention can be used for that SCREENED COMPOUND stimulates or inhibitory enzyme protein and the common and interactional molecule of zymoprotein (for example component of substrate or the common interactional signal pathway of zymoprotein or cofactor that luminous reaction relates to) between interactional ability.These checks generally include following steps: make under the interactional condition of zymoprotein or fragment and target molecule, zymoprotein and candidate compound are merged, to detect the formation of the mixture between protein and the target, or the interactional biological chemistry result between detection and zymoprotein and the target, for example single reactions steps of the luminous reaction of luciferase or luminous reaction.

Candidate compound comprises, for example: (1) organic and inorganic molecules (for example molecule that obtains from synthetic combinatorial libraries or natural product storehouse); (2) antibody (for example polyclone, mono-clonal, humanization, anti--atopy, chimeric and single-chain antibody and Fab, F (ab ') .sub.2, Fab expression library fragment and antibody epitope binding fragment); (3) phospho-peptide (for example at random with the member in the directed phospho-peptide storehouse of part degeneracy, referring to, people such as Songyang for example, Cell 72:767-778 (1993)); (4) peptide, soluble peptide for example, comprise the fusogenic peptide and the random peptide library of Ig-tail the member (referring to, for example, people such as Lam, Nature 354:82-84 (1991); People such as Houghten, Nature354:84-86 (1991)) and the library of molecules of forming by D-or L-configuration amino acid that obtains of combinatorial chemistry.

A kind of candidate compound is a variant peptides of the present invention, and it combines with the peptide competition substrate of for example SEQ ID NO:2.Other candidate compound comprises mutant enzyme or contains the suitable fragment of sudden change, thereby it influences the function and the competition substrate of enzyme.Therefore, the present invention includes the fragment of competition substrate, for example with higher avidity, perhaps bound substrates but the fragment that do not discharge.

The present invention further comprises other terminal point check of the compound of identification adjusting (stimulating or inhibition) enzymic activity.Check generally includes the active check in the luminous approach that shows enzymic activity.Any biology of enzyme mediation or biochemical function can be as the terminal point checks.Particularly, can check the biological function of the cell or tissue of expressing enzyme.

Protein of the present invention can be used for competition and combine check in the method that is designed to find with the compound (for example binding partners, part or substrate) of enzyme interacting.Therefore, make compound in conjunction with polypeptide or with the interactional condition of polypeptide under, compound is exposed to enzyme polypeptide.Also can in mixture, add the lyoenzyme polypeptide.If test compound and lyoenzyme polypeptide interact, its can increase or reduce formation mixture amount or from the activity of enzyme target.Such check especially can be used to seek the situation with the interactional compound in specific region of enzyme.Therefore, be designed to contain peptide sequence with the soluble polypeptide of target enzyme region-competitive corresponding to interest region.

In order to carry out purpose compound or proteinic acellular screening test, need immobilized enzyme albumen or fragment or its target molecule sometimes, mixture is separated from one or both not complex form helping.

The reagent of regulating one of enzyme of the present invention can use or be used in combination one or more above-mentioned checks separately and discern.Usually preferably, at first use cell based or cell free system, in any other model system that may want, confirm active then.These model systems are well known in the art, can use in this context at an easy rate.The present invention further comprises new reagent or the substrate by above-mentioned screening test identification.

Peptide of the present invention also is provided for diagnosing the active target of active protein, particularly known activity of other luciferase and condition.Therefore, can from biological sample, isolate peptide, and check cause the distorting existence of transgenation of peptide.This comprises amino-acid substitution, disappearance, insertion, rearrangement, (because distortion splicing phenomenon) and unsuitable posttranslational modification.Analytical procedure comprises enzymic activity, substrate or the antibodies mode altering that changes in tryptic peptide digestion, cell based or the acellular check of electrophoresis flowability, change of change, iso-electric point, direct amino acid order-checking and any other known inspection technology that can be used for detecting protein mutant of change.Such detection can provide with single test format or many test format, for example the antibody chip array.The ex vivo technique that is used for the peptide detection comprises enzyme-linked immunosorbent assay (ELISA), western blotting, immunoprecipitation and immunofluorescence, and it uses detection reagent, for example antibody or protein bonding reagent.

Many reporter gene checks

Peptide of the present invention is particularly suitable for using in many reporter gene checks.Usually use many, two (or dual) reporter gene to improve the experiment tolerance range.Term " many reporter genes " is meant expresses and measures two or more independent report enzymes simultaneously in triangular web.When using together, these independent report enzymes can be called " reporter gene altogether ".In the heredity report, the example that has benefited from two reporter genes detections at present is included in and is manipulated to the independent cell or the cell colony (for example being dispersed in cells in culture, isolating tissue or whole animal) of expressing two kinds of different reporter genes simultaneously in the heredity.More commonly, the influence of the activity of gene report specific condition of experiment, and the activity of second reporter gene provides internal contrast, thus can carry out normalization method to the experimental value of a complete set.The activity of experiment reporter gene is with respect to the active normalization method of internal contrast, and the feasible experiment mutability that causes such as the difference of cell viability or transfection efficiency minimizes.Liquid long-pending difference, cytolysis efficient and checkability are for example moved in other mutability source, can eliminate effectively.Therefore, by reducing external influence, two reporter gene checks usually make the explanation of experimental data more reliable.

The example that has benefited from least two kinds of reporter genes of employing (promptly two reporter genes check) at present is included in and is manipulated to the independent cell or the cell colony (for example being dispersed in cells in culture, isolating tissue or whole animal) of expressing two kinds of different reporter genes simultaneously in the heredity.More commonly, the influence of the activity of gene report specific condition of experiment, and the activity of second reporter gene provides internal contrast, thus can carry out normalization method to the experimental value of a complete set.

Can have benefited from the acellular reconfiguration system of many reporter genes technology, the cell lysates that obtains is transcribed and is translated in translation or coupling when being coding experiment and the independent inheritance material that contrasts the report enzyme.Immunity inspection can be designed for multiple report experimental value and control value in simple sample similarly.Referring to, Promega Dual-Luciferase for example ^TMReporter gene detection system and Promega pGL3 luciferase reporter gene carrier (available from Promega Corporation, Madison, Wis.) and United States Patent (USP) the 5th, 744, No. 320 and the 5th, 670, No. 356.

Antibody

The present invention also provide optionally in conjunction with peptide of the present invention, comprise this peptide protein, with and variant and fragment in a kind of antibody.As used herein, antibody optionally combining target peptide is meant, its combining target peptide and can be significantly in conjunction with incoherent protein.Even antibody, is also still thought optionally binding peptide of this antibody also in conjunction with other and target peptide homologous protein not substantially, as long as the fragment or the structural domain of the peptide target of these protein and antibody are enjoyed homology.In this case, although to a certain degree cross reactivity is arranged, the antibody that also is understood as binding peptide is still optionally.

The method of the antibody of many generations or identification intended target peptide is known.Harlow, Antibodies, Cold Spring Harbor Press, (1989) have described some such methods.Usually, in order to produce antibody, isolating peptide is used as immunogen, and gives the Mammals organism, for example rat, rabbit or mouse.Can use full length protein, antigenic peptide fragment or fusion rotein.The fragment of particularly important is the segment that contains structural domain, divergent structural domain between the structural domain of this paper identification and sequence homology or family for example, and for example the fragment that can use the protein comparison method to be easy to discern is as shown in table 6.

Antibody can be from any zone preparation of peptide as herein described.But preferred zone comprises participation function/activity or the interactional zone of enzyme/binding partners.Other guidance that Fig. 6 A-6E and table 3 and 5 information and this paper provide by embodiment may be used to discern the zone of particularly important, can use various sequence alignments to discern conservative and single sequence fragment.

The antigenicity fragment generally includes at least 8 continuous amino acid residues.But the antigenicity fragment can comprise at least 10,12,14,16 or more a plurality of amino-acid residue.These fragments can be selected based on physical properties, and for example fragment is corresponding to the zone that is positioned at protein surface, and for example hydrophilic region perhaps can be selected based on the uniqueness of sequence.

Detection of antibodies of the present invention can be by promoting antibody and detectable substance coupling (for example physical connection).The example of detectable substance comprises various enzymes, prothetic group, fluorescent material, luminescent material, bioluminescent material and radio active material.The example of suitable enzyme comprises horseradish peroxidase, alkaline phosphatase, beta-galactosidase enzymes or acetylcholinesterase; The example of suitable prothetic group mixture comprises streptavidin/vitamin H and avidin/biotin; The example of suitable fluorescent material comprises Umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazine base amine fluorescein, dansyl chloride or phycoerythrin; The example of luminescent material comprises luminol,3-aminophthalic acid cyclic hydrazide (luminol); The example of bioluminescent material comprises luciferase, fluorescein and aequorin; The example of suitable radioactive material comprises ¹²⁵I, ¹³¹I, ³⁵S or ³H.

Antibody can be used for by standard technique, and for example avidity chromatogram or immunoprecipitation separate one of protein of the present invention.Antibody can promote the purification of natural protein from cell, and the proteinic purification of the reorganization of expressing in host cell generation.In addition, these antibody can be used for detecting the existence of one of protein of the present invention at cell or tissue, to confirm protein normal or unusual expression pattern between the different tissues or on developmental process in organism.And these antibody can be used in position, external or detect protein in cell lysates or supernatant liquor, with the abundance and the pattern of evaluation expression.The free segmental antibody test of full length protein can be used to discern turnover.

Antibody can also be used for arrestin matter function, and for example, blocking-up enzyme peptide combines with binding partners (for example substrate).The situation that these purposes can also be applied to analyze is wherein analyzed the function that relates to arrestin matter.Antibody can be used for, for example, and blocking-up combination, thereby the activity of regulating (excitement or antagonism) peptide.Antibody can perhaps prepare at the whole protein relevant with cell or organism at the specific fragment that contains the required site of function.

The present invention also comprises the test kit that is used for using the proteinic existence of antibody test biological sample.Test kit can comprise antibody, but the antibody of mark or mark and be used for the proteinic compound or the reagent of detection of biological sample for example; The device that is used for the proteinic amount of working sample; Be used for proteinic amount of sample and standard device relatively; And working instructions.This test kit may be provided in and detects single protein or epi-position, perhaps can be arranged to detect a kind of in numerous epi-positions, for example in the antibody test array.The array that is used for nucleic acid array is described in more detail below, and has developed the similar approach that is used for antibody array.

Nucleic acid molecule

The invention provides Fig. 1,2,4,5 and SEQ ID NO:1 and 3 shown in isolated nucleic acid molecule with and various modification or fragment.In embodiment, the invention provides coding enzyme peptide of the present invention or proteinic isolated nucleic acid molecule (cDNA, transcription and genome sequence).These nucleic acid molecule can directly be made up of to homologue or paralog the nucleotide sequence of coding one of enzyme peptide of the present invention, its allelic variant or its, or are made up of it substantially or comprise it.

As used herein, " isolating " nucleic acid molecule be with the nucleic acid natural origin in the nucleic acid molecule of other separate nucleic acid of existing.Preferably, " isolating " nucleic acid is not contained in the natural sequence that is positioned at the nucleic acid flank in the genomic dna of organism (nucleic acid therefrom obtains) (promptly be positioned at nucleic acid 5 ' and the sequence of 3 ' end).But, some flanking nucleotide sequences can be arranged, for example, about at the most 5 kilobase are to (KB), 4KB, 3KB, 2KB or 1KB or littler, particularly continuously in peptide-coding sequence and the genome sequence in same gene but the peptide-coding sequence of being separated by intron.Important part is the unessential flanking sequence of nucleic acid and far-end is separated, and makes it can carry out specific operation as herein described, preparation and other application that is specific to nucleotide sequence of for example recombinant expressed, probe and primer.

And, " isolating " nucleic acid molecule, for example transcription or cDNA molecule when producing by recombinant technology, can be substantially free of other cell material or substratum, perhaps are substantially free of precursor or other compound when by chemosynthesis.But nucleic acid molecule can or be regulated sequence with other coding and merge, and it is isolating still being considered as.

For example, the recombinant DNA molecules that contains in the carrier is considered to isolating.Other example of isolated DNA molecule comprises the dna molecular that (part or basically) in the recombinant DNA molecules that keeps in the heterologous host cell or the solution purified.Isolating RNA molecule comprise in the external or body of isolated DNA molecule of the present invention the rna transcription body with and new fragment.Further comprise the synthetic such molecule that produces according to isolated nucleic acid molecule of the present invention.

Therefore, the invention provides the nucleic acid molecule of forming by nucleotide sequence of the present invention.Nucleic acid molecule is made up of nucleotide sequence and is meant that nucleotide sequence is the complete nucleotide sequence of nucleic acid molecule.The present invention further provides the nucleic acid molecule of forming by nucleotide sequence of the present invention substantially.Nucleic acid molecule is made up of nucleotide sequence substantially and is meant, such nucleotide sequence only is present in the final nucleic acid molecule with seldom other nucleic acid residue.The present invention further provides the nucleic acid molecule that comprises nucleotide sequence of the present invention.Nucleic acid molecule comprises that nucleotide sequence is meant, nucleotide sequence is at least a portion of the final nucleotide sequence of nucleic acid molecule.By this way, nucleic acid molecule can only be a nucleotide sequence, or has extra nucleic acid residue, for example natural with it bonded nucleic acid residue or heterologous nucleotide sequence.Such nucleic acid molecule can have several extra Nucleotide, perhaps can comprise hundreds of or more a plurality of extra Nucleotide.Below provided concise and to the point description how easily to make or separate various types of these nucleic acid molecule.

Isolated nucleic acid molecule can add extra ammonia end or carboxylic terminal amino acid by encoding mature protein, or the amino acid of mature peptide inside (for example when ripe form has more than a peptide chain).These sequences can play a role in the processing of the protein from the precursor to the mature form, promote the protein transportation, and prolong or shorten protein transformation period or promotion and be used for check or produce proteinic operation, or the like.Usually under the situation in position, extra amino acid can be processed away from mature protein by cellular enzymes.

As mentioned, isolated nucleic acid molecule includes but not limited to, the sequence of independent codase peptide; The sequence of encoding mature peptide and extra encoding sequence, for example leading or secretion sequence (for example precursor-former (pre-pro) or preceding protein sequence); Have or do not have the sequence of the encoding mature peptide of extra encoding sequence; add extra non-coding sequence; intron or non-coding 5 ' and 3 ' sequence for example; the sequence of for example transcribing but not translating, its transcribe, mRNA processing (comprising splicing and poly-adenylylation signal), rrna combination and mRNA stable in play a role.In addition, nucleic acid molecule can merge with the flag sequence of coding such as the peptide that helps to purify.

Isolated nucleic acid molecule can be the form of RNA, and the form of for example mRNA, or DNA comprises cDNA and genomic dna, and it obtains by the clone or passes through chemical synthesising technology or pass through its combination results.Nucleic acid, particularly DNA can be two strands or strand.Single-chain nucleic acid can be coding strand (sense strand) or noncoding strand (antisense strand).

The present invention further provides the segmental nucleic acid molecule of coding peptide of the present invention, and the nucleic acid molecule of the obvious variant of the above-mentioned zymoprotein of the present invention of encoding.These nucleic acid molecule can be natural, and for example allelic variant (homologous genes seat), paralog (different genes seat), perhaps can make up by recombinant DNA method or by chemosynthesis to homologue (different organism) with directly.These non-natural variants can produce by induced-mutation technique, comprise being applied to nucleic acid molecule, cell or organic induced-mutation technique.Therefore, discuss as mentioned, variant can contain nucleotide subsitution, disappearance, inversion and insertion.Variation can be in the coding region and/or non-coding region take place.Variation can produce conservative and nonconservative amino-acid substitution.

As used among the application, term " nucleic acid molecule of the plain enzyme of coding fluorescence " is meant and is separated into the nucleic acid molecule that does not contain full nucleus.Term used herein " the suitable codon of function " is meant the codon of coding same amino acid, and for example 6 of arginine or Serine codons (table 2) also refer to the amino acid whose codon that encoding human is suitable, as hereinafter discussing.

Consider the degeneracy of genetic code, have about at least 50%, about at least 60%, more generally about 70%, the most common about 80%, preferred about at least Nucleotide identical of 90%, most preferably about 95% usually as infructescence, think that then this sequence and described sequence are basic identical with nucleotide sequence of the present invention.Sequence and described sequence are basic identical also can be defined as and can to hybridize with the nucleic acid fragment of the complement that contains polynucleotide under stringent condition from function.The closely-related sequence of term is meant that sequence has sizable sequence similarity, and perhaps sequence encoding is finished luciferase function (being that one or more cause luminous activity) or as described hereinly caused similar antigen reactive protein.It is 50% sequence that this paper uses the closely-related sequence of term to name to compare with polynucleotide that compares or polypeptide the similarity minimum.

Dna fragmentation of the present invention comprises the luciferase protein matter that those encoding human functions are suitable and the dna fragmentation of peptide, and is as indicated above.Such sequence can be the codon Feng Yu result suitable with aminoacid functional, and this is known at nucleotide sequence be natural generation thus in the encoded protein matter.Perhaps, protein that function is suitable or peptide can produce via using recombinant DNA technology, and wherein the variation of protein structure can design according to the consideration to the amino acid whose character of exchange.Variation can be passed through practical site directed mutagenesis technical project, perhaps can introduce at random and screens required function subsequently, and is as mentioned below.

Natively, the present invention also comprises and the complementary or basic complementary oligonucleotide of the polynucleotide sequence of coding Arachnocampa luciferases.The nucleotide sequence of " complementation " is can be according to the sequence of the complementary regular base pairing of standard Watson-Crick.As used herein, it is complementary substantially that term " complementary sequence " is meant that nucleotide sequence relatively can be evaluated as by above-mentioned identical Nucleotide, perhaps be defined as and can under relative strict condition, hybridize with the nucleic acid fragment of polynucleotide, for example as herein described those.

Perhaps, hybridized fragment can be short oligonucleotide.17 long sequences of base should only occur once in complicated genome, therefore are enough to specify single target sequence.Although in easier manufacturing of shorter oligomer and the easier arrival body, determine that the specificity of hybridization also relates to many other factorses.The binding affinity of oligonucleotide and its complementary target and sequence-specific all increase and increase along with length.Expectation will use 8,9,10,11,12,13,14,15,16,17,18,19,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95,100 or the exemplary oligonucleotide of more a plurality of base pairs, but estimate also to use other oligonucleotide.Also estimate 250,500,1000,1212,1500,2000,2500,3000 or 3500 bases of coding and longer longer polynucleotide.These oligonucleotide or polynucleotide can be used for usually, for example, be used as probe in southern blotting technique and western blotting, and be used as primer in amplified reaction, perhaps are used for vaccine.

Table 2

Natively, the present invention also comprises and the complementary or basic complementary oligonucleotide of the sequence of Nucleotide of the present invention.The nucleotide sequence of " complementation " is can be according to the sequence of the complementary regular base pairing of standard Watson-Crick.As used herein, it is complementary substantially that term " complementary sequence " is meant that nucleotide sequence relatively can be evaluated as by above-mentioned identical Nucleotide, perhaps be defined as and can under relative strict condition, hybridize with the nucleic acid fragment of polynucleotide, for example as herein described those.

Segmental length will be decided by its set purposes.For example, the zone that has epi-position that fragment can encoded peptide perhaps can be used as dna probe and primer.Such fragment can use known nucleotide sequence to separate, with synthetic oligonucleotide probe.The probe of mark can be used to screen cDNA storehouse, genomic dna storehouse or mRNA then, to separate the nucleic acid corresponding to coding region.And primer can be used for the PCR reaction, with clone's special genes zone.It is right that probe/primer consists essentially of the oligonucleotide or the oligonucleotide of purification usually.

Directly can use method identification well known in the art to homologue, homologue and allelic variant.As described in peptide moiety, these variants comprise the nucleotide sequence of encoded peptide, and the pulsating homology of the nucleotide sequence shown in this peptide and the chart or this sequence is generally 60-70%, 70-80%, 80-90%, more typically is at least about 90-95%.These nucleic acid molecule can be identified as at an easy rate and can hybridize with the fragment of the nucleotide sequence shown in the chart or this sequence to strict condition in gentleness.Allelic variant can be determined by the genetic loci of encoding gene at an easy rate.

As used herein, and it is conventionally known to one of skill in the art, be used for " high stringency ", " stringency " of nucleic acid hybridization and " low stringency " at Current Protocolsin Molecular Biology (Ausubel, F.M. wait the people, " Current Protocols inMolecular Biology ", John Wiley ﹠amp; Sons, (1998)) in 2.10.1-2.10.16 page or leaf and 6.3.1-6 page or leaf explain.The precise conditions of determining the hybridization severity not only depends on the concentration of ionic strength (for example 0.2X SSC, 0.1X SSC), temperature (for example room temperature, 42 degrees centigrade, 68 degrees centigrade) and destabilizing agent (for example methane amide) or denaturing agent (for example SDS), also depend on following factor, for example the frequency of occurrences of this sequence hypotype in the mispairing per-cent between the length of nucleotide sequence, based composition, the hybridization sequences and other the non-identical sequence.Therefore, high, in or low stringency can rule of thumb determine.Change to the level of first observed by severity level that hybridization conditions is never hybridized, can determine to make sequence hybridization the most similar in specified sequence and the sample () condition for example, optionally to hybridization.

Exemplary condition is described in Krause, M.H. and S.A.Aaronson, Methods inEnzymology, 200:546-556 (1991).In addition referring to people such as Ausubel, " CurrentProtocols in Molecular Biology ", John Wiley ﹠amp; Sons, (1998) are during it has been described or the determining of the wash conditions of low stringency.Condition is set the minimum level of determining the hybrid complementarity usually in the washing step.Usually, begin with the minimum temperature that homology hybridization only takes place, 1 degree centigrade of final wash temperature of every reduction (it is constant that SSC concentration keeps) makes the at utmost increase by 1% of the central mispairing of hybridization sequences.Usually, SSC concentration doubles to cause Tm to increase about 17 degrees centigrade.Use these to instruct, the wash temperature that is used for height or low severity can rule of thumb be determined according to the mispairing level of looking for.

For example, low severity washing can comprise at room temperature in the solution that contains 0.2X SSC/0.1%SDS washing 10 minutes; Middle severity washing can be included under 42 degrees centigrade washed 15 minutes in containing the pre-temperature solution (42 degrees centigrade) of 0.2X SSC/0.1%SDS; High severity washing can be included under 68 degrees centigrade washed 15 minutes in containing the pre-temperature solution (68 degrees centigrade) of 0.1X SSC/0.1%SDS.And washing can repeat or order is carried out, and to obtain required result, this is known in the art.By in the similar degree of identity or the homophylic while that keep between target nucleic acid molecules and the primer or the probe, change one or more parameters (its example is known in the art), can determine suitable condition.

The application of nucleic acid molecule

Nucleic acid molecule of the present invention can be used for probe, primer, chemical intermediate, and is used for biological test.Nucleic acid molecule can be used as the hybridization probe of messenger RNA(mRNA), transcribe rna or cDNA and genomic dna, separating the full-length cDNA and the genomic clone of the described peptide of coding, and separate cDNA and genomic clone corresponding to the variant that produces identical or related peptides (allelotrope, directly to homologue etc.).

Probe can be corresponding to the arbitrary sequence along the whole length of nucleic acid molecule that is provided.But as discussed, fragment should be understood to and does not comprise the present invention's disclosed fragment before.

Nucleic acid molecule also can be used as the PCR primer, with any designated area of amplifier nucleic acid molecule, and is used for synthesizing the antisense molecule of desired length and sequence.As mentioned, antisense molecule obviously comprises the RNA construction that disturbs realization effectively to express adjusting by RNA.

Nucleic acid molecule can also be used to make up recombinant vectors.These carriers comprise part or all expression vector of expression of peptides sequence.Carrier also comprises the insertion carrier, is used for being incorporated into another sequence of nucleic acid molecules, for example is incorporated in the cellular genome, changes the expression of gene or gene product with original position.For example, interior source coding sequence can be contained all or part of replacement of the coding region of the sudden change that one or more specificitys introduce via homologous recombination.

Nucleic acid molecule can also be used for the antigenic portions of marking protein.

Nucleic acid molecule can also be used as probe, is used for the chromosome position by in-situ hybridization method definite kernel acid molecule.

Nucleic acid molecule can also be used to make carrier, and this carrier contains the generegulation zone of nucleic acid molecule of the present invention.

Nucleic acid molecule can also be used to design ribozyme, and this ribozyme is all or part of corresponding to the mRNA's that is produced by nucleic acid molecule as herein described.

Nucleic acid molecule can also be used to make the part or all of carrier of expression of peptides.

Nucleic acid molecule can also be used for the part or all of host cell of construction expression nucleic acid molecule and peptide.

Nucleic acid molecule can also be used for all or part of transgenosis organism of construction expression nucleic acid molecule and peptide.

Nucleic acid molecule can also be used as hybridization probe, is used for determining existence, level, form and the distribution of expression of nucleic acid.Therefore, probe can be used for detecting the existence of cell, tissue and organism specific nucleic acid molecule or measuring its level.The nucleic acid of mensuration level can be DNA or RNA.Therefore, can be used for estimating the expression or the gene copy number of designated cell, tissue or organism corresponding to the probe of peptide as herein described.

The ex vivo technique that is used to detect mRNA comprises RNA hybridization and in situ hybridization.The ex vivo technique that is used to detect DNA comprises DNA hybridization and in situ hybridization.

The check that is used for the enzymatic nucleic acid expression can comprise the direct survey of nucleic acid level (for example mRNA level), perhaps checks attached (collateral) compound that relates in the luminous reaction.And, can also check the expression of gene of being regulated by increment or decrement in response to signal or environmental agent or condition.In this embodiment, the regulation domain of these genes can be operatively connected with the reporter gene of coding one or more luciferase peptides of the present invention.

Therefore, the instrumentality of enzyme gene expression can be discerned in following method, and cell is contacted with candidate compound, and measures luminous level (being intensity or spectrum).To exist the luminescence feature (spectrum, intensity distribution, absolute strength etc.) under the situation of candidate compound to compare with luminescence feature under the situation that does not have candidate compound.Based on this relatively, candidate compound can be identified as the instrumentality of expression of nucleic acid, and is used for then, and for example, treatment is the disease of feature with the distortion expression of nucleic acid.

Perhaps, the instrumentality that enzymatic nucleic acid is expressed can be to use the small molecules or the medicine of screening test identification as herein described, as long as medicine or small molecules suppress the cell of marking protein and the enzymatic nucleic acid in the tissue is expressed.

Nucleic acid molecule can be used as the antisense construct thing, with the genetic expression of enzyme in control cell, tissue and the organism.The DNA antisense nucleic acid molecule is designed to the regional complementarity with relevant gene of transcribing, and prevents to transcribe also thereby prevent the generation of zymoprotein.Sense-rna or DNA nucleic acid molecule will be hybridized with mRNA, thereby blocking-up mRNA translates in the zymoprotein.Carrying out RNA interferential technology and method obviously is included in these technology.

The present invention also comprises and is used for detecting the test kit of enzymatic nucleic acid in the existence of biological sample.For example, test kit can comprise reagent, but the nucleic acid of mark or mark for example, or the reagent of the enzymatic nucleic acid in can the detection of biological sample; The device that is used for the amount of working sample enzymatic nucleic acid; With the amount and the standard device relatively that are used for the sample enzymatic nucleic acid.Compound or reagent can be packaged in the suitable containers.Test kit may further include the specification sheets that uses test kit to detect zymoprotein mRNA or DNA.

Nucleic acid array

The present invention further provides kit for detecting nucleic acid, for example based on the array or the microarray of the nucleic acid molecule of the sequence information that is provided.

As used herein, " array " or " microarray " be meant at substrate, for example the synthetic array of homopolynucleotide or oligonucleotide not on the film of paper, nylon or other type, filter, chip, slide glass or any other suitable solid carrier.In one embodiment, microarray prepares according to the method described in the following document and uses: United States Patent (USP) the 5th, 837, and No. 832, WO/1995/011995, Lockhart, people such as D.J. (1996; Nat.Biotech.14:1675-1680) and Schena, people such as M. (1996; Proc.Natl.Acad.Sci.93:10614-10619).In other embodiments, such array is by the method manufacturing described in No. the 5th, 807,522, the United States Patent (USP).

Microarray or detection kit preferably are made up of the nucleotide sequence a large amount of unique, strand that is fixed on the solid carrier, and above-mentioned nucleotide sequence is synthetic antisense oligonucleotide or cDNA fragment normally.The oligonucleotide preferred length is about 6-60 Nucleotide, and more preferably length is 15-30 Nucleotide, and most preferably length is about 20-25 Nucleotide.For the microarray or the detection kit of some type, can preferably use the only oligonucleotide of 7-20 Nucleotide of length.Microarray or detection kit can contain cover known 5 ' or the oligonucleotide of 3 ' sequence, cover the continuous oligonucleotide of full length sequence; Perhaps be selected from along unique oligonucleotide of the specific region of sequence length.The polynucleotide that uses in microarray or the detection kit can be specific to the oligonucleotide of the gene of paying close attention to or a plurality of genes.

In the example of the sample analysis that uses microarray or detection kit, RNA or the DNA from biological sample can be made hybridization probe.Separating mRNA produces cDNA and used as the template of making sense-rna (aRNA).ARNA is increased in the presence of fluorescent nucleotide, and the probe of mark is hatched with microarray or detection kit, makes the complementary oligonucleotide of probe sequence and microarray or detection kit hybridize.Incubation conditions is adjusted to hydridization with accurate complementary coupling or less complementary generation the in various degree.Remove after the probe of non-hydridization, use scanning device to measure the level and the pattern of fluorescence.Investigate the image of scanning, to determine the complementary degree and the relative abundance of each oligonucleotide sequence on microarray or the detection kit.Biological sample can be available from any suitable source of paying close attention to.Detection system can be used for measuring simultaneously all not shortage, existence and amounts of homotactic hybridization.These data can be used for the sequence between sample, species or the environmental sample, expression pattern, sudden change, variant or polymorphism are carried out extensive cognation research.

Specimen of the present invention comprises protein or the film extract or even the thick environmental sample of cell, cell.The specimen that is used for aforesaid method will change based on the character of check form, detection method with as sample tissue, cell or extract to be tested.The method for preparing nucleic acid extractive or cell is well known in the art, and it is adapted to obtain the sample compatible with system for use in carrying.

In another embodiment of the present invention, provide and contain the test kit that carries out the essential reagent of check of the present invention.

Carrier/host cell

The present invention also provides the carrier that contains nucleic acid molecule described herein.Term " carrier " is meant the supporting agent that can transport nucleic acid molecule, the preferred nucleic acid molecule.When carrier was nucleic acid molecule, nucleic acid molecule and vector nucleic acid were covalently bound.In this one side of the present invention, carrier comprises plasmid, strand or double stranded phage, strand or double-stranded RNA or dna viral vector or artificial human chromosome, for example BAC, PAC, YAC or MAC.

Carrier can be used as outside karyomit(e) element and remains in the host cell, and duplicates and produce extra nucleic acid molecule copy at this.Perhaps, carrier can be incorporated in the host cell gene group, produces extra nucleic acid molecule copy when host cell duplicates.

The invention provides carrier (cloning vector) that is used to keep or the carrier (expression vector) that is used for the express nucleic acid molecule.Carrier can (shuttle vector) play a role in prokaryotic cell prokaryocyte or eukaryotic cell or both.

Expression vector contains the cis acting regulatory region that can be operatively connected with nucleic acid molecule in carrier, make can carry out transcribing of nucleic acid molecule in the host cell.Nucleic acid molecule can be incorporated in the host cell, and independent nucleic acid molecule can influence transcribes.Therefore, second nucleic acid molecule can provide with cis and regulate the interactional trans-acting factor in control region, and nucleic acid molecule is transcribed from carrier.Perhaps, trans-acting factor can be provided by host cell.At last, trans-acting factor can be produced by carrier self.But be to be understood that in some embodiments, transcribing or translating of nucleic acid molecule can take place in cell free system.

The adjusting sequence that nucleic acid molecule as herein described can be operatively connected comprises and is used to the promotor that instructs mRNA to transcribe.These include but not limited to, from the left promotor of bacteriophage X, lac, TRP with from colibacillary TAC promotor, from instant early stage (immediate early) promotor of early stage and late promoter, the CMV of SV40, adenovirus is early stage and late promoter and the long end of retrovirus repeating unit.

Except that starting the control region of transcribing, expression vector can also comprise regulates the zone of transcribing, for example repressor binding site and enhanser.Example comprises SV40 enhanser, the instant early stage enhanser of cytomegalovirus, polyoma enhanser, adenovirus enhanser and retrovirus LTR enhanser.

Except that containing transcription initiation and control site, expression vector can also contain the ribosome bind site that the required sequence of Transcription Termination and transcriptional domain are used to translate.The adjusting controlling elements that other is used to express comprises initial sum terminator codon and poly-nucleosides acidylate signal.Those of ordinary skills will know that many kinds can be used for the adjusting sequence of expression vector.These regulate sequence descriptions in, for example, people such as Sambrook, Molecular Cloning:A LaboratoryManual.2nd.ed., Cold Spring Harbor Laboratory Press, Cold SpringHarbor, N.Y., (1989).

Can use multiple expression vector to come the express nucleic acid molecule.That these carriers comprise is chromosomal, additive type and be derived from the carrier of virus, for example from bacterial plasmid, from bacteriophage, from yeast episome, from yeast chromosomal element (comprising the yeast artificial chromosome), from the carrier of virus (for example baculovirus, papovavirus for example SV40, vaccinia virus, adenovirus, poxvirus, pseudorabies virus and retrovirus).Carrier can also be from the combination in these sources, for example from plasmid and bacteriophage genetic elements, for example cosmid and phagemid.The suitable clone and the expression vector that are used for protokaryon and eucaryon host are described in: people such as Sambrook, Molecular Cloning:A Laboratory Manual.2nd.ed., Cold SpringHarbor Laboratory Press, Cold Spring Harbor, N.Y., (1989).

Regulate sequence constitutive expression (being tissue specificity) can be provided in one or more host cells, perhaps can in one or more cell types, provide inducible expression, for example, by temperature, nutritional additive or exogenous factor (for example hormone or other part).Many kinds provide the carrier of composing type and inducible expression in protokaryon and eucaryon host be known to a person of ordinary skill in the art.

Nucleic acid molecule can be inserted in the vector nucleic acid by known method.Usually,, then fragment is linked together, the dna sequence dna of finally being expressed can be connected with expression vector by dna sequence dna and expression vector being cut with one or more restriction enzymes.Digestion with restriction enzyme is known to a person of ordinary skill in the art with the method that is connected.

The carrier that contains suitable nucleic acid molecule can use known technology to be incorporated into to be used for the suitable host cell of breeding or expressing.Bacterial cell includes but not limited to, intestinal bacteria, streptomycete and Salmonella typhimurium.Eukaryotic cell includes but not limited to, yeast, insect cell be for example COS and Chinese hamster ovary celI and vegetable cell of fruit bat, zooblast for example.

As described herein, can desirably peptide be expressed as fusion rotein.Therefore, the invention provides the fusion vector that peptide is produced.Fusion vector can increase Recombinant Protein Expression, increases the solvability of recombinant protein, and helps proteinic purification, for example brings into play the part effect and is used for the avidity purification.Can introduce the proteolysis cleavage site in the junction of merging part, make required peptide finally can from merge part, separate.Proteolytic ferment includes but not limited to, Xa factor, zymoplasm and intestines enzyme (enteroenzyme).Typical fusion expression vector comprises pGEX (people such as Smith, Gene 67:31-40 (1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.), its respectively with glutathione S-transferase (GST), maltose E is conjugated protein or albumin A and target recombinant protein merge.The example of the non-fusion coli expression carrier of suitable induction type comprises pTrc (people such as Amann, Gene 69:301-315 (1988)) and pET 11d (people such as Studier, Gene ExpressionTechnology:Methods in Enzymology 185:60-89 (1990)).

Recombinant protein expression can maximize in host bacteria by genetic background is provided, and wherein host cell has the ability of the proteolysis cutting recombinant protein of weakening.(Gottesman，S.，Gene Expression Technology：Methods in Enzymology 185，AcademicPress，San Diego，Calif.(1990)119-128)。Perhaps, the sequence of purpose nucleic acid molecule can change over the preferential codon (people such as Wada, Nucleic Acids Res.20:2111-2118 (1992)) that is provided for particular host cell (for example intestinal bacteria).

Nucleic acid molecule also can be expressed by the expression vector of operating in yeast.The example that is used for the carrier of expressing at yeast (for example yeast saccharomyces cerevisiae (S.cerevisiae)) comprises pYepSecl (Baldari, Deng the people, EMBO is (1987) J.6:229-234), pMFa (people such as Kujan, Cell30:933-943 (1982)), pJRY88 (people such as Schultz, Gene 54:113-123 (1987)) and pYES2 (Invitrogen Corporation, San Diego, Calif.).

Nucleic acid molecule also can for example, use rhabdovirus expression vector in expressed in insect cells.The baculovirus vector that is used in marking protein in the insect cell (for example Sf 9 cells) of cultivation comprises pAc series (people such as Smith, Mol.Cell Biol.3:2156-2165 (1983)) and pVL series (people such as Lucklow, Virology 170:31-39 (1989)).

In some embodiments of the present invention, nucleic acid molecule as herein described uses mammalian expression vector to express in mammalian cell.The example of mammalian expression vector comprises pCDM8 (Seed, B.Nature 329:840 (1987)) and pMT2PC (people such as Kaufinan, EMBO is (1987) J.6:187-195).

The listed expression vector of this paper provides as just example, and the available known carrier of those of ordinary skills all can be used for the express nucleic acid molecule.Those of ordinary skills will know, are suitable for other carrier of keeping breeding or expressing of nucleic acid molecule as herein described.These carriers can referring to, for example, Sambrook, J., Fritsh, E.F. and Maniatis, T.Molecular Cloning:A Laboratory Manual.2nd, ed., Cold Spring HarborLaboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.

The present invention also comprises following carrier, and nucleotide sequence wherein as herein described is cloned in the carrier to be inverted direction, but can be operatively connected with the adjusting sequence that allows sense-rna to transcribe.Therefore, all or part of antisense transcription of sequence of nucleic acid molecules as herein described be can produce, coding region and non-coding region comprised.The expression of this sense-rna is controlled by every kind of above-mentioned parameter (regulating sequence, composing type or inducible expression, tissue specific expression) with respect to the expression that adopted RNA is arranged.

The invention still further relates to the recombinant host cell that contains carrier as herein described.Therefore, host cell comprises for example yeast, other eukaryotic cell insect cell and senior eukaryotic cell mammalian cell for example for example of prokaryotic cell prokaryocyte, rudimentary eukaryotic cell.Host cell can include but not limited to, silkworm larva, Chinese hamster ovary celI, intestinal bacteria and yeast.

By the technology that those of ordinary skills are easy to obtain, vector construct as herein described is introduced cell, can prepare recombinant host cell.These include but not limited to, the transfection of calcium phosphate transfection, DEAE-dextran-mediation, the transfection of cation lipid-mediation, electroporation, transduction, infection, lipofection and other technology, for example, referring to, people such as Sambrook (Molecular Cloning:A Laboratory Manual.2nd, ed., Cold Spring HarborLaboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).

Host cell can contain more than one carrier.Therefore, different nucleotide sequences can be incorporated on the isocellular different carriers.Similarly, nucleic acid molecule can be introduced separately into, and perhaps introduces with other and this nucleic acid molecule irrelevant nucleic acid molecule (for example providing trans-acting factor for expression vector).When more than one carrier was introduced cell, carrier can independently be introduced, introduces jointly or be connected on the nucleic acid molecule vector.

Under the situation of bacteriophage and virus vector, these can introduce cell as the virus of packing or sealing by the standard method of infecting and transduceing.Virus vector can duplicate or replication defective.Under the defective situation of virus replication, duplicate and in the host cell that the function of replenishing defective is provided, to take place.

But carrier generally includes selective marker, and it can select to contain the cell subsets of construction of recombinant vector thing.Marker can be included in the same vehicle that contains nucleic acid molecule as herein described, perhaps can be in independent carrier.Marker comprises tsiklomitsin or the ampicillin resistance gene that is used for prokaryotic host cell, and the Tetrahydrofolate dehydrogenase or the neomycin resistance that are used for eukaryotic host cell.But any marker all is effective for phenotypic characteristic provides optionally.

Although mature protein can produce under the control in proper regulation sequence in bacterium, yeast, mammalian cell and other cell, cell-free transcription and translation system also can be used to use the RNA that is derived from DNA construction as herein described to produce these protein.

Under needs peptide excretory situation, this is to be difficult to realize with the protein (for example enzyme) that contains multispan membrane structure territory, suitable secretion signal can be attached in the carrier.Signal sequence can be that peptide is endogenous, or allogenic with these peptides.

Under peptide was not secreted into situation in the substratum, protein can separate from host cell by the standard destructive process, for example freezing thawing, supersound process, physical disturbance, use cell lytic agent and analogue.Peptide can be reclaimed then, and use known purification techniques to purify, comprise ammonium sulfate precipitation, acid extraction, negatively charged ion or cation-exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatograph, avidity chromatogram, hydroxyapatite chromatography, lectin chromatogram or high performance liquid chromatography.

Be to be understood that, rely on the aborning host cell of reorganization of peptide as herein described, peptide can depend on cell and have various glycosylation forms, be nonglycosylated when producing in bacterium perhaps.In addition, owing to the process of host's mediation, peptide can comprise initial modification methionine(Met) in some cases.

The application of carrier and host cell

The recombinant host cell of expression of peptides as herein described serves many purposes.At first, cell can be used to produce zymoprotein or peptide, and it can further be purified, to produce the zymoprotein or the fragment of aequum.Therefore, the host cell that contains expression vector can be used for the generation of peptide.

Host cell can also be used to carry out the check based on cell, and this check relates to zymoprotein or zymoprotein fragment, for example mentioned above and other form known in the art.Therefore, express the compound that the proteinic recombinant host cell of natural enzyme can be used to check stimulation or inhibitory enzyme protein function.

Host cell can also be used for the wherein affected zymoprotein mutant of these functions of identification.If the natural existence of mutant also causes pathology, the host cell that contains this sudden change can be used to check the compound that the zymoprotein of sudden change is had required effect (for example stimulating or inhibit feature), its may be not by its to natural enzyme proteinic effect indicate.

Transgenics

Arachnocampa luciferases nucleic acid can be used for producing genetically modified, inhuman plant or animal or site-specific cell modification in clone.Transgenic cell of the present invention comprises one or more nucleic acid according to the present invention as transgenosis, changes into to comprise that genetically modified parental cell and filial generation thereof are also included within this definition.

In many embodiments, transgenic cell is meant not embedding normally or contains the cell of with good grounds nucleic acid molecule of the present invention.In these embodiments, transgenic cell does not contain nucleic acid of the present invention natively, and nucleic acid position beyond its natural place in cell exists, and promptly is incorporated in the genetic material of cell in the non-natural position.

Transgenic animal can wherein change the native gene seat by the homologous recombination manufacturing.Perhaps, nucleic acid construct thing random integration is in genome.The carrier that is used for stable integration comprises plasmid, retrovirus or other animal virus, YAC and analogue.

Transgenosis organism of the present invention comprises cell and the multi-cell organism that knocks out thing as native gene, plant and animal for example, and wherein the expression of native gene also is lowered at least even without eliminating.Purpose transgenosis organism also comprises cell and multi-cell organism, plant and animal for example, and wherein express in protein or its variant place of not expressing usually in cell or tissue, perhaps with common non-existent horizontal expression in these cell or tissues.The DNA construction that is used for homologous recombination comprises at least a portion of gene of the present invention, and wherein this gene has required genetic modification and comprises the zone that has homology with the target gene seat.The DNA construction that is used for random integration does not need to comprise the zone that has homology with middle reorganization.Easily, can comprise the marker that is used for just selecting and bearing selection.

The method that produces the cell with target gene modification by homologous recombination is known in the art.For the technology of various transfection mammalian cells, referring to people such as Keown (1990), Meth.Enzymol.185:527-537.Do (ES) cell for the embryo, can use ES clone, perhaps can be from the fresh acquisition embryonic cell 10 of host (for example mouse, rat, cavy etc.).These cells are grown on suitable inoblast-feeder layer, perhaps growth in the presence of leukaemia inhibitory factor (LIF).When ES or embryonic cell were transformed, they can be used to produce transgenic animal.After the conversion, cell is seeded on the feeder layer at the suitable medium middle plateform.The cell that contains construction can detect by using 15 kinds of selective mediums.After making colony growth fully for a long time,, and analyze the generation of homologous recombination or the integration of construction with its picking.The male clone can be used for embryo operation and blastocyst injection then.Blastocyst can be from the 4-6 female acquisition of super ovulation in age in week.With ES cell trypsinized, then in the segmentation cavity with injection cell to 20 blastocyst of modified.After the injection, blastocyst is returned each female horn of uterus of false pregnancy.Make female gestation finish (go to term) then, the offspring of generation carries out the construction screening.By blastocyst and the genetically modified cell that different phenotypes are provided, can be easy to detect chimeric filial generation.Chimaeric animals is screened under the situation that modifying factor exists, make male and female mating, generation homozygote generation with modification.If gene alteration a bit causes lethality at certain in growth, tissue or organ can be maintained in allos or congeneic graft or transplant, perhaps remain in the vitro culture thing.Transgenic animal can be any non-human mammal, for example laboratory animal, domestic animal etc.Transgenic animal can be used for functional study or instrumentality screening, or those skilled in the art provide or known other purposes.

Transgenic plant can produce and use in a similar manner.The method for preparing transgenic plant cells and plant is described in United States Patent (USP) the 5th, 767,367; 5,750,870; 5,739,409; 5,689,049; 5,689,045; 5,674,731; 5,656,466; 5,633,155; 5,629,470; 5,595,896; 5,576,198; 5,538,879; In 5,484, No. 956.The method that produces transgenic plant is also summarized (the eds.Lea ﹠amp in Plant Biochemistry and Molecular Biology; Leegood, John Wiley ﹠amp; Sons) (1993) 275-295 pages or leaves.

In brief, according to the character of plant species, gather in the crops suitable vegetable cell or tissue.Therefore, in some instances, separate protoplastis, wherein these protoplastiss can separate from the different plant tissues of many kinds, for example leaf, hypocotyl (hypoctyl), root etc.For the separation of protoplastis, the cell of results is hatched in the presence of cellulase, to remove cell walls, wherein accurate incubation conditions basis obtains the plant of cell by it or the type of tissue changes.The protoplastis that produces is separated with the cell debris of generation with centrifugal by screening then.Also can use to comprise that somatic embryo's generation explant replaces the use of protoplastis, with the preparation transformed host.After the cell or tissue results, with the foreign DNA introduced plant cell of paying close attention to.Multiple different technology can be used for this introducing.For isolating protoplastis, introduce the transgenosis scheme rising of chance by the DNA-mediation, this scheme comprises: protoplastis is hatched in the presence of polyvalent cation (for example PEG or PLO) together with the naked DNA (for example plasmid) that comprises the outer source coding sequence of purpose; With protoplastis is carried out electroporation in the presence of the naked DNA that comprises the purpose exogenous array.

Select successfully to have absorbed the protoplastis of foreign DNA then,, it is grown into corpus callosum, and finally grow into transgenic plant by contacting with the stimulating factor (for example growth hormone and phytokinin) of appropriate amount and ratio.For embryo's generation explant, the method easily of introducing foreign DNA in the objective body cell is by using particle to quicken or " particle gun " scheme.Make the explant of generation grow into chimeric plant then, obtain intersecting the transgenosis filial generation of breeding.

Replacing the method that makes things convenient for of the another kind generation transgenic plant of above-mentioned naked DNA method is the conversion of edaphic bacillus (Agrobacterium) mediation.For agrobacterium-mediated conversion, preparation comprises the carrier common integration or binary of foreign DNA, is introduced into suitable edaphic bacillus bacterial strain then, for example A.tumefaciens.Then with the bacterium that generates with the protoplastis of preparation or organize explant (for example leaf dish (leaf disk)) to hatch, the generation corpus callosum.Then corpus callosum is grown under selective conditions, select, and stand growth medium,, finally produce transgenic plant to induce the growth of root and bud.

Can be used for an any adjusting of expression vector or the part that other sequence can form transgenic sequence.If this comprises intron sequence and the poly-adenylylation signal that has comprised.Tissue specificity is regulated sequence and can be operatively connected with transgenosis, to guide enzyme protein expression to specific cells.

Embodiment

Comprise following examples, so that preferred implementation of the present invention to be described.It should be recognized by those skilled in the art that the technology of bringing into play good action in the invention process that on behalf of the contriver, disclosed technology find among the following embodiment, therefore can be considered as is to constitute the optimal way of implementing it.But those skilled in the art will be appreciated that according to present disclosure, can carry out many kinds to disclosed embodiment and change, and still can obtain similar or similar result under the situation that does not depart from spirit and scope of the invention.

Various materials and the methodology used among the embodiment

Insect

Under the informed consent of NSW National Parks and Wildlife Service, collect the individuality of Arachnocampa richardsae from the field.From Newnes Railway Tunnel, map no.8931, grid reference E414 N187, New South Wales, Australia collects 100 larva A.richardsae.Larva is transferred to the laboratory, dissects the light organ from the trunk remainder at microscopically.

Bacterium buffalo gnat species can be cultivated by methods known in the art.Referring to: Takaie, H. (1989) Breeding and display of the glow-worms, Arachnocampa spp.Insectarium, vol.26 July:214-219; Takaie, H. (1997) Ten years of the glow-worm (Arachnocampa richardsae) rearing at Tama Zoo-Fascination of a livingmilky way.Insectarium, vol 34 November:336-342.Sakurai, Y., R.Komatani, K.Tabata and H.Takaie On the glow-worm breeding at TamaZoo.

RNA separates: use RNAqueous ^TM-Micro test kit (Ambion) separates full RNA according to the specification sheets (grinding except being organized in the 300 μ l solvent solns) of manufacturers from a trunk or about 10 light organs.

CDNA storehouse: represent the cDNA storehouse of trunk and light organ to use Creator with improvement ^TMSMART ^TMThe cDNA storehouse makes up test kit (Clontech) and makes up.Article one, cDNA is synthetic by described long-range (LD) PCR method, uses 1 microgram to use the full RNA and the cDNA of the amplification of 20 cycles.As described in manufacturers, the ds cDNA that 2 grams are increased carries out Proteinase K and SfiI digestion, and according to the specification sheets of manufacturers it is gone up separately at cDNA apart post (Invitrogen).PDNR-LIB with 100ngSfiI-digestion is connected with independent part (100ng ds cDNA at the most), and electroporation is to ElectroMAX subsequently ^TMDH10 β ^TMIn the T1Phage resistance intestinal bacteria (Invitrogen).Diluted with 1: 2 with 50% (v/v) glycerine-LB by the storehouse of will not increase, prepare the glycerine liquid storage (stock) in each cDNA storehouse.In addition, by with 100 μ l10% (v/v) glycerine-LB with mono-clonal inoculation and 37 ℃ of following overnight incubation, in 96 hole polystyrene flat undersides (Becton Dickinson), prepare glycerine liquid storage from the clone of 1056 independent pickings in each light organ cDNA storehouse with low evaporation lid.With these freezing preservations under-80 ℃.

Plasmid separates: for two light organ cDNA storehouses (part 10 storehouses and part 9 storehouses) each, plasmid DNA is from 96 clone's preparations of picking at random.

The plasmid DNA preparation of 96-hole: plasmid DNA is according to information (Beckman Coulter-Biomek 2000 Workstation that provide from Millipore Corporation ^TM-MilliporeProtocols, August 2002) the method preparation of improvement.Single colony inoculation is in the 1.1ml 2x Luria Broth that contains 30 μ g/mL paraxin in aseptic 96 deep-well plates.With plate coated with AeraSeal ^TM(Excel Scientific, Wrightswood CA) hatched under 37 ℃ 24 hours in being set in the rail mounted vibrator of 320rpm.With plate at room temperature centrifugal 5 minutes with 1500g, topple over and supernatant liquor, by firmly being patted from granular precipitation, plate removes excess fluid on cotton paper.

Use BioMek2000 ^TMAutomatic workstation (Beckman Coulter) is with 150 μ l solution 1 (30mM glucose, 15mM Tris-HCl (pH 8.0), 30mM Na ₂EDTA, 60 μ g/mlRNaseA) join in every hole and mixing.Wrench is moved vortex 3 minutes.Add 150 μ l solution 2 (0.2N NaOH, 1% (w/v) SDS), add 150 μ l solution, 3 (3.6M potassium then; The 6M acetate).The content in hole is thoroughly mixed.The thick lysate of 300 μ l is transferred to Multiscreen ^TMClarification plate (Millipore) is placed on the Plasmid on the vacuum manifold ^TMOn the plate (Millipore).Lysate is filtered under vacuum (7 minutes, 203mm Hg).Discard the clarification plate, with lysate vacuum filtration on the plasmid plate (8 minutes; 508mm Hg).With the plasmid plate under identical vacuum with every hole 200 μ l water washings 6 minutes.Discharge vacuum, add 35 μ l 10mM Tris (pH 8.0) in every hole of plasmid plate, this plate jolts 15 minutes under 600rpm.The hole content that will contain plasmid DNA is collected with multichannel pipettor.

Order-checking: use CEQ 2000 Dye Terminator Cycle Sequencing ^TMUse QuickStart Kit ^TM(Beckman Coulter) and 100fmol plasmid DNA check order to the clone.

Dot blotting from the clone's in A.richardsae light organ cDNA storehouse screening: use 96-hole replicator (V ﹠amp; P Scientific Inc.) will put at Hybond-XL from the clone of Lampyridea light organ cDNA storehouse (part 9) glycerine liquid storage ^TMOn the film (Amersham).Then according to the specification sheets of manufacturers with film sex change, neutralization and fixing.

With the α of dot blotting with the 796bp that uses following primer preparation ³²P-dATP-mark PCR probe is surveyed:

The Nucleotide 142-162 (SEQ ID NO:11) of forward primer GWLucScreenU 5 '-GATGATAATGCACCAGAAAAG-3 ' guiding clone 1E1

The Nucleotide 938-918 (SEQ ID NO:12) of reverse primer GWLucScreenL 5 '-TTATAATATCCAGCATCACCA-3 ' guiding clone 1E1.

Use cDNA clone 1E1 as masterplate, the method (Millican and Bird 1997) of abideing by Millican and Bird produces the PCR probe with Taq archaeal dna polymerase (Invitrogen).Trace is exposed to the X-ray film then according to the specification sheets hybridization and the washing of film manufacturers.From with the clone of 1E1 hybridization purifying DNA plasmid, inset is checked order.

Make up the full-length cDNA of coding A.richardsae luciferase: two models of preparation Arachnocamparichardsae luciferase cDNA.GWLuc#1 (sequence 4) contains the consensus encoding sequence, and GWLuc#2 contains departing from of single, reticent consensus from 1308.GWLuc#1 is also different with the single base place of GWLuc#2 in 3 ' UTR.

GWLuc#1 uses 5 ' district of clone 8F5 and 3 ' district of clone 4F12 to make up.Clone 8F5 is from part 9 Lampyridea light organ cDNA storehouse (No. 8 plates; The F5 position) isolating full-length cDNA.To contain 3 places different with consensus in the 3 ' district in unique BamHI site (1030) for it.Clone 4F12 is a Partial cDNA, and length is 1.5kb, and 3 ' is identical BamH1 site, in strict conformity with the consensus encoding sequence.Therefore, 3 of the clone 8F5 in the MCS of pDNR-LIB between BamHI site and XhoI site ' end is removed, and splices to cloning 8F5 from the respective segments of clone 4F12.

GWLuc#2 uses above-mentioned identical 8F5 clone to make up, and in this case, the 3 ' district in unique BamHI site is replaced (T is replaced with C) by the fragment of inserting from clone 1B6 accordingly.

Construction is used Platinum Pfx by PCR ^TMArchaeal dna polymerase (Invitrogen) increases according to the specification sheets of manufacturers.

The preparation of fluorescein extract: the bacterium buffalo gnat fluorescein (hereinafter referred to as " GW fluorescein ") that contains part (fraction) according to Viviani (Viviani, people such as Hastings 2002) from the light organ preparation of bacterium buffalo gnat.Will be from 90 light organs homogenizing in the 0.1M of heat citrate buffer pH 5 of A.richardsae.Suspension was hatched under 95 ℃ 5 minutes, be acidified to pH 2.5-3.0 with 0.1M HCl.With extract equal-volume ethyl acetate extraction, dry under nitrogen.Resistates is dissolved in the water.

The multisequencing comparison: multisequencing comparison and kind system tree use following program to produce: PROTML or PROTPARS program: PROTML (Adachi, J. and Hasegawa, the M.1996:MolphyVersion publication of 2.3.Programs for molecular Phylogenetics based on maximumlikelihod.Computer Science monographs No.28. Tokyo statistical mathematics institute)); PROTPARS (Felsenstein, J.1989.PHYLIP-Phylogeny InferencePackage (Version 3.2) Cladistics 5:164-166).Comparison and sequence identity and homology level use BestFit (GCG) to determine in pairs.The BioManager interface use that the sequence alignment program provides by AustralianNational Genomic Information Service ( Http:// www.angis.org.au).

Embodiment 1: the nucleic acid that separates the coding Arachnocampa luciferases

Respectively, trunk cDNA storehouse makes up from the part 8-10 of the trunk ds of part cDNA, and light organ cDNA storehouse makes up from the part 9 and 10 of the ds of part cDNA.

In each isolating 96 clone in light organ cDNA storehouse, there are 92 and 95 clones successfully to check order respectively.Use the tBLASTx program that each sequence is inquired at ncbi database.Do not identify with any luciferase from the clone in part 10 smooth organ cDNA storehouses and to have homology, but have homology from 5 clones in part 9 smooth organ cDNA storehouses and the luciferase of luminous beetle.Clone 1E1 (1275bp); 1B6 (1163bp); 1F7 (948bp); 1G12 (768bp); And 1C5 (494bp) checks order fully, and all demonstrate the identical open reading frame of representative independently obtain 5 '-Partial cDNA of blocking, in tBLASTx search, all 5 clones all show with luciferase from Phrixothrix vivianii and Phrixothrix hirtus to have homology.These beetle species (Coleoptera: have luminous larva the glimmering section of light), be called " railway worm ".All 5 cDNA sequences are all blocked in various degree at 5 ' end.5 clones' sequential analysis identifies 11 base substitutions of 3 ' end, and wherein 3 is reticent.

(Advantage 2 PolymeraseMix Clontech), obtain high-caliber sequence variations of inferring after each amplification step although the correction archaeal dna polymerase has been used in the cDNA amplification.It is necessary to a plurality of independently amplicons are checked order,, and separate amplicon with this sequence with definite reliable sequence.When (Pfx observes similar phenomenon when Invitrogen) increasing the P.pyralis luciferase with another kind of correction archaeal dna polymerase.The particular feature that the luciferase of Lampyridea and bacterium buffalo gnat is shared is, has a high proportion of Nucleotide dyad, and this may can explain the relatively poor relatively fidelity that carries out PCR with these sequences as target.

Use 96-hole replicator (V ﹠amp; P Scientific Inc.) will put on Hybond-XL film (Amersham) from the clone of fire fly luminescence organ cDNA storehouse (part 9) glycerine liquid storage.According to the specification sheets of manufacturers with film sex change, neutralization and fixing.

With the probe that is derived from 1E1 960 bacterium colonies that contain light organ cDNA are screened, wherein 29 (about 3%) provide positive signal.Because the efficient that film contacts with replicator is also incomplete, this may underestimate to some extent to the male sum.In about 1000 bacterium colonies from part 9 trunk cDNA storehouses with the screening of 1E1 probe, none discovery is positive.

By PCR 21 the strongest clones of hybridization signal that provide are screened, the pDONRLIBM13F that uses guiding 5 ' carrier sequence is as forward primer, and the GWLuc484 that uses guiding 1E1 Nucleotide 804-788 is as reverse primer.From 10 targets clone, obtain amplicon, confirm that itself and 5 ' of 1E1 hold overlapping.4 amplicons demonstrate longer than 1E1.One of them is available from clone 4F12, and length is that 1.1 kilobase are right, shows that full clone's length is that 1.5 kilobase are right.It is right to be 1.3 kilobase available from the length of three other amplicons of clone 11B11,8F5 and 6B6, and the length that shows each clone is that 1.7 kilobase are right.

The sequence of the complete open reading frame of A.richardsae luciferase is by deriving to the order-checking of clone 1E1,1B6,1F7,1C5,1G12 and 11B11,8F5 and 6B6.Sequence from least 3 independent clonings compares on the complete nucleotide position.The consensus nucleotide sequence is shown in Figure 1A to Figure 1B or SEQ ID NO:1.In a few cases, independent one has the sequence that is different from consensus among the clones of three or more order-checkings.These variations are listed in the table 3.

The Arachnocampa richardsae part of table 3. order-checking or the unique nucleotide diversity in the full-length clone

Nucleotide position among the cDNA	Consensus	Variant
			190	G	C
215	T	C
			613	T	C
654	T	C
			702	T	C
920	A	T
			1122	A	G
1159	A	C
			1245	T	C
1291	A	G
			1308	T	C
1310	T	C
			1346	T	C
1491	A	C
			1493	A	T

Carry out the PCR screening, to differentiate 5 ' the end upstream any extra untranslated sequence identical with 6B6 with clone 11B11,8F5.Use bacterium buffalo gnat light organ cDNA as template, obtain representing the cDNA clone of luciferase gene 5 ' end by half anchor PCR.(Creator SMART cDNA storehouse makes up test kit (Clontech), and LD-PCR is synthetic) adds SMART IV Oligo primer on the cDNA of all amplifications in the structure of bacterium buffalo gnat light organ cDNA.Therefore use 5 ' end of a part of anchor PCR reaction of SMART IV Oligo primer: 5 '-CAACGCAGAGTGGCCATTA-3 ' (SEQ ID NO:13).The luciferase gene Auele Specific Primer of Nucleotide 514-494 that uses guiding luciferase cDNA is as reverse primer: 5 '-TGGCTTTTCTGGTGCATTATC-3 ' (SEQ ID NO:14).Use preparation as described above but in the aliquots containig in digestion and size classification (fractionation) bacterium buffalo gnat light organ cDNA storehouse before as template.DNA is increased with HotStarTaq archaeal dna polymerase (Qiagen).(approximately 500bp) is cloned among the pGEMTeasy (Promega) with amplicon.13 clones that are identified as processing luciferase cDNA are checked order.Wherein, 8 total length luciferase cDNA clone 11B11,8F5 and identical 5 ' UTR sequences of 6B6 that have and infer.

CDNA demonstrates the open reading frame of single length in a translation box.This sequence is corresponding to the sequence of SEQ ID NO:2.ORF begins with AUG that (Kozak 1986 being used for correction AXXAUGG bacterial context (context) that rrna starts; Kozak 1987), and stop with the UAA terminator codon in 1621 in Nucleotide.Protein length is 530 amino acid, and plain enzyme of this length and other insect fluorescence and class luciferase (luciferase-like) are seemingly protein-based.

The molecular weight that luciferase calculates is 58,955, and the iso-electric point of calculating is 7.36.Therefore, it is more or less less than Photinus pyralis luciferase (people 1987 such as de Wet) and some other Photinus pyralis LUCs.The molecular weight of the Arachnocampa luciferases that calculates is greatly different with the value of measuring by gel-filtration.Viviani, people such as Hastings (2002) instruction molecular weight is 36kDa.

Embodiment 2: the comparison of the sequence of the plain enzyme of Arachnocampa luciferases sequence and other insect fluorescence

In ncbi database, carry out the tBLASTX search with the Arachnocampa luciferases sequence that reclaims, find from the class luciferase protein matter of D.melanogaster and Anopheles gambiae and from the luciferase of Phrixothrix viviani, Lampyridea and other luminous beetle.Amino acid identity between Arachnocampa luciferases and the beetle begins at Asn 9 places of bacterium buffalo gnat sequence, and it is corresponding to being found in the conservative l-asparagine (Fig. 6) between 5 and 9 in the beetle luciferase.

On nucleotide level, with the identity level the highest (58.1%) of P.viviani luciferase, but with the identity level height about the same (57.1%) of Photinus pyralis.

Paired sequence brief summary relatively between luciferase of table 4.A.richardsae luciferase, two kinds of luminous beetles of representativeness and the class luciferase protein matter of two kinds of non-luminous flies.The highest luciferase of score that Phrixothrix viviani is to use the A.richardsae inquiry to produce in the tBLASTx of NCBI sequence library search.

Photinus pyralis luciferase (550 amino acid)	57.1	45.7	33.0
				Drosophila melanogaster class luciferase protein matter (DroCG6178) (544 amino acid)	55.6	51.2	38.8
Anopheles gambiae class luciferase protein matter (AgCP8896) (493 amino acid whose partial sequences)	54.5	48.8	36.8

How much class luciferase protein matter of Drosophila and Anopheles has the lower Nucleotide identity of level.On amino acid levels, the highest with the identity (38.8%) and homology (51.2%) level of the class luciferase protein matter of D.melanogaster.With the identity (34.9%) of functional luciferase and homology (48.3%) level the highest be enzyme (table 4) from Phrixothrixviviani.Clearly, the luciferase of the luciferase of bacterium buffalo gnat species and Lampyridea and other beetle belongs to same gene superfamily.Obviously Arachnocampa luciferases is the new member of this family in addition, only has far relation with the beetle luciferase.This is emphasized by following observations: on amino acid levels, with in the body or the sequence similarity degree of the external class luciferase protein matter that does not all have a luminescence activity bigger.

Based on comparison from the luciferase sequence of the luminous beetle of 18 species, this 18 species representative is from genuss of Elateridae, belong to and from 8 genus of glimmering section, the beetle luciferase is shared 128 amino-acid residues of guarding fully (Fig. 6) from of the glimmering section of light.The length of Photinus pyralis LUC is about 550 amino-acid residues always.Therefore, about 23% residue is conservative fully between all beetle luciferase members that check order so far.On the contrary, 7 residues only being arranged between all members of luciferase-acyl group-CoA ligase enzyme and peptide synthetase superfamily is conservative fully people 1996 such as () Conti.58 position of the sequence of A.richardsae luciferase in the middle of 128 and the sequence different (tables 3) of beetle luciferase consensus.Therefore, on behalf of Lampyridea, the A.richardsae luciferase sequence show the diverse solution of luminous problem.

Guard fully but the tabulation of 58 residues that the A.richardsae sequence departs between all beetle luciferases of table 5..

The note of table 5:

A:P.pyralis (M15055) luciferase, 550 amino acid of length.

The B:A.richardsae luciferase, 530 amino acid of length.

In #57 the variation, we obtain the sequence of anopheles class luciferase gene:

1.A.richardsae residue is identical with one of two Diptera class luciferase sequence, but differs from one another.

2.A.richardsae, D.melanogaster is identical with the A.gambiae residue, but it is different from the beetle consensus.

3.A.richardsae residue is different with the beetle consensus, but D.melanogaster all has the residue identical with the beetle consensus with A.gambiae class luciferase protein matter.

4. all three Diptera genes have different residues in this position.

5.A.richardsae residue is different with the beetle consensus, D.melanogaster and A.gambiae class luciferase protein matter the two to have identical be not the residue of beetle consensus.

Embodiment 3: the identification of key amino acid and position

All beetle luciferases of testing so far all use identical D-fluorescein.Mutagenesis research has disclosed several residues in the substrate combination of beetle luciferase or the importance in the catalyst mechanism.The luciferase of A.richardsae is in the hypotype place of these Key residues sequence difference.The arginase 12 18 that has shown Photinus pyralis LUC is necessary fluorescein binding site residues (Branchini, people such as Magyar 2001).R218 replaces with glutamine, Methionin or L-Ala, causes the K of fluorescein _MValue increases 15-20 doubly.Flash of light height (intensity) be reduced to respectively wild-type value 33%, 5% and 3.6%, and k _CatNumerical value reduces.Emission maximum wavelength in all three mutant also all has reduction.R218 has represented in the above-mentioned residue of guarding fully in 18 kinds of beetle luciferases of all investigations.But, in the corresponding zone of Arachnocampa luciferases, lacked 4 amino residue.The N213 of A.richardsae and the disappearance (table 3) between the L214 comprise to be estimated arginic position to occur, is equivalent to the R218 (Fig. 6) of P.pyralis.A.richardsae residue K205, G206, V207 and the H216 that crosses over disappearance is conservative fully (Fig. 6) between bacterium buffalo gnat and all 18 kinds of beetle luciferases.The residue N213, the L214 that are directly adjacent to disappearance are identical with 10,2 and 2 other beetle luciferases respectively with I215.Therefore, the substrate binding characteristic of Arachnocampa luciferases deviates from the character of beetle luciferase greatly in this zone.

In research widely (Branchini, people such as Southworth 2003), it is believed that to be positioned at P.pyralis uciferase activity site 5 Interior 15 residues (R218, H245, G246, F247, F250, T251, G315, G316, G341, L342, T343, S347, A348, I351, K529) suddenly change.11 residues of black matrix demonstrate 4 times or bigger D-fluorescein K _MVariation.The residue of corresponding position different (op.cit in the A.richardsae luciferase by 10 in 15 kinds of situations of Branchini discriminating; DEL 213-214 R218, N238H245, A239G246, T243F250, A244T251, S308G315, S335L342, S336T343, L339S347, A343I351; Also referring to Fig. 6).In the bacterium buffalo gnat in these 10 positions everywhere amino-acid substitution or the different in kind of disappearance in the experimental implementation of people such as Branchini test, it only limits to as follows: R218-＞K, Q, A (Branchini, people such as Magyar 2001; Branchini, people such as Southworth 2003); H245-＞F, D, A (Branchini, people such as Magyar 1998; Branchini, people such as Magyar 2001; Branchini, people such as Southworth 2003); G246-＞A; F247-＞Y, L, A; F250-＞S, G; T251-＞A; G315-＞A; G316-＞A; G341-＞A; L342-＞A; T343-＞A; S347＞A; A348-＞V; 1351-＞A; K529-＞A (Branchini, people such as Southworth 2003).

Therefore even the precedent that does not have the bacterium buffalo gnat form of these residues is independent displacement.And 8 binding site residues (R218, H245, F247, G315, G341, L342, T343 and K529) of people such as Branchini test are conservative fully between all 18 the beetle luciferases that are used to compare.Corresponding position in A.richardsae (Fig. 6), 5 in these residues is the hypotype of arranging the constant residue of substrate binding pocket in the beetle luciferase, corresponding bacterium buffalo gnat residue is different under the situation more than 60%, and this is reflected by the per-cent similarity between specific fragment of bacterium buffalo gnat (Arachnocampaspp) luciferase and the Photinus pyralis sequence/identity:

The result uses GAP (GCG/ANGIS) to obtain.The result that attention BESTFIT obtains is basic identical.

Embodiment 4: the similarity of Arachnocampa luciferases and other dipterous class luciferase protein matter and the origin of evolving

57 in luciferase of the present invention 58 amino-acid residues different with beetle luciferase consensus sequence fall into " class luciferase " proteinic zone that sequence can be used for D.melanogaster and A.gambiae.On 33 of these 57 residues, class luciferase protein matter meets the sequence (table 5) of beetle luciferase, even these organisms are not luminous.As if based on these total residues, the luciferase of A.richardsae has experienced from ancestors' section and has divided inconsistent evolution pressure.Based on our sequence data; can not the luminous beetle of inference and the luciferase of fly whether be to evolve from the luminous ancestors of common, perhaps whether luminous in Coleoptera and the Diptera is independently to evolve from the class luciferase protein matter of acyl group-CoA ligase enzyme family.

Embodiment 5: the position of Arachnocampa luciferases in the molecular species system of other luciferase of acyl group-CoA ligase enzyme superfamily is learned

Use 18 kinds of unique luciferase sequence of luminous coleopteron; the class luciferase protein matter of D.melanogaster and A.gambiae; analyze Lampyridea (glimmering section: Hotaria for example from acyl group-CoA ligase enzyme of mouse with from the not grappling kind system of the PROTML program (Fig. 7) of the new luciferase of A.richardsae; Photinus; Lampyris; Luciola and Pyrocoelia) separate with railway worm (the glimmering section of light: i.e. Phrixothrix species) and Pleonomus (Elateridae: i.e. Pyrophorus species).The luciferase of A.richardsae obviously separates with all three luminous Staphylinidaes, although with in close relations than with Diptera class luciferase protein matter of the relation of beetle luciferase.But, in the molecular species system of identical sequence is learned, use PROTPARS program mouse acyl group-Co ligase enzyme grappling (not shown), the position of Arachnocampa luciferases is outer group (outgroup) as dipteran class luciferase protein matter.Relation between all other luciferases is constant.

Embodiment 6: the expression of Arachnocampa luciferases

Make up pETDuet-l:GWLuc#l

Use Platinum Pfx archaeal dna polymerase (Invitrogen), abide by the recommendation of manufacturers, uses the pETGWLucF of every 10pmol of reaction and pETGWLucR PCR primer that the full-length cDNA of GWLuc#1 is increased:

pETGWLucF：GACACACCATGGCTTGTACTTCAGT(SEQ ID NO：15)

pETGWLucR：GACGACCCTAGGTTACAATGTTCCTCTTAAA(SEQ ID NO：16)

The NcoI of these primers introducing total length Arachnocampa luciferases cDNA and AvrII restriction site 5 ' and 3 '.The PCR product of purifying is A tail (A-tailed), described in pGEM T-easy carrier system I handbook (Promega), it is connected with pGEM T-easy.In e.colistraindh5, use CEQ 2000 Dye TerminatorCycle Sequencing to check order the construction electroporation with Quick Start test kit (Beckman Coulter) and 50fmol plasmid DNA.The construction that will contain error-free Arachnocampa luciferases cDNA sequence excises with NcoI and AvrII, and use the NcoI site of MCS1 and the AvrII site of MCS2 to be inserted in the Novagen pET-Duetl carrier (EMD/Merck Biosciences, San Diego/Darmstadt).The plasmid that produces is called pETDuet-1:GWLuc#1.The plasmid electroporation in e. coli bl21 (DE3) bacterial strain, and is checked order once more.

Beetle luciferase (Photinus pyralis) contrast

The total length construction (1653 Nucleotide) of P.pyralis luc gene is inserted in the pETDuet-1 carrier, obtain pETDuet-1:FFLuc, subsequently with its electroporation in coli strain BL21 (DE3), as describing for pETDuet-1:GWLuc#1.

The contrast expression vector

By NcoI site to the AvrII site of MCS2 of excision MCS1 5 ', it removes His and S mark from MCS1 and MCS2 respectively, by pETDuet-1 preparation contrast expression vector pETDuet-1: contrast.5 ' the overhang that produces uses dna polymerase i, and (Klenow NEB) holds filling (end-filled) with every kind of dNTP of 25mM.Be reflected at and hatched under 25 ℃ 15 minutes, and by adding 10mM EDTA and under 75 ℃, hatching termination in 20 minutes.The purification carrier, and connect the recommendation of (blunt ended ligation) for blunt tail according to Fermentas, use T4 dna ligase (Fermentas) in the presence of 5% (w/v) PEG8000, to carry out from connecting.Subsequently with the control vector electroporation in coli strain BL21 (DE3), as describing for pETDuet-1:GWLuc#1.

PI

With 2 milliliters of (mL) empty map carrier pETDuet-1: control vector (in BL21 (DE3)); PETDuet-1:FFLuc (Lampyridea (firefly) luciferase) construction (in BL21 (DE3)); The culture of pETDuet-1:GWLuc (Lampyridea (glow-worm) luciferase) #1 construction (in BL21 (DE3)) and unconverted BL21 (DE3) cell, in containing the LB substratum of 1M glucose under 37 ℃, 200rpm overnight incubation.Next day, with culture at room temperature with 1, centrifugal 3 times of 500rpm, granular pellet resuspended is in 2mL LB.With 1: the 50 diluent inoculation of 50mL LB, add 50 μ L 1000x penbritins then with each culture.Before inducing beginning the solution of these inoculations was hatched under 37 ℃ 1 hour.Under 600nm, measure the absorption (Abs600nm) of culture, when reaching Abs600nm 〉=0.6, the aliquots containig of taking out 4 1mL, at room temperature with 10, centrifugal 5 minutes of 000g, cell pellets is-80 ℃ of storages down.

Induce

From remaining culture volume, 2 9mL aliquots containigs are transferred in the 50mL taper centrifuge tube.An aliquots containig is induced by adding IPTG (0.4mM ultimate density), does not induce (replace and add the water of equivalent) for second.Unconverted BL21 (DE3) culture is not induced, and 20mL is transferred in the 250mL erlenmeyer flask.Subsequently, all cultures were hatched 48 hours under 20 ℃, 150rpm, at this moment measured Abs600nm.From each culture, take out the aliquots containig of 3 250 μ L, at room temperature with 10, centrifugal 5 minutes of 000g, granular being deposited in-80 a ℃ following storage is used for protein analysis.With 5mL pETDuet-1: control vector; PETDuet-1:FFLuc and pETDuet-1:GWLuc#1 and 15mL BL21 (DE3) culture are transferred in the clean centrifuge tube, under 4 ℃ with 3, centrifugal 10 minutes of 000rpm.Topple over and supernatant liquor, each pill is suspended in ice-cold phosphate buffered saline (PBS) (pH 7.4) (137mM NaCl, 2.7mM KCl, the 4.3mM Na of each initial volume again ₂HPO ₄) in, under 4 ℃ with 3, centrifugal again 10 minutes of 000rpm.Topple over and PBS, pill is suspended among the ice-cold PBS again, be adjusted to the denseest sample and provide identical Abs 600nm.

Protein analysis

Protein analysis uses the NuPAGE of Invitrogen ^TMNovex Bis-Tris gel systems uses the specification sheets of manufacturers to carry out.The 1x NUPAGE that refrigerated bacterium pill is contained 50mMDTT by adding ^TMLauryl laurilsulfate (LDS) sample buffer and 70 ℃ of down heating 10 minutes and dissolving.By making Bacterial Lysates pass 30G pin several times, chromosomal DNA is sheared.With protein concn bacteria samples (inferring) and SeeBlue about equally by measuring bacterial density (Abs600 * dilution factor) ^TMPre-staining standard substance (Invitrogen) installs to NUPAGE ^TMOn the 12%Bis-Tris gel, and under constant 200V, use NUPAGE ^TMMOPS SDS about 50 minutes of damping fluid (pH 7.7,50mM MOPS, 50mM Tris, 0.1% (w/v) SDS, the 1mM EDTA) electrophoresis that flows only has XCeIl SureLock ^TMAdd 1x NUP AGE in the last chamber of Mini-cell (Invitrogen) ^TMAntioxidant.

Gel is taken out from box, at room temperature in 45% (v/v) methyl alcohol-10% (v/v) acetate, stir washing in 10 minutes 3 times gently.After the final washing, gel is immersed among the Faststain (16% (v/v) Fast Stain liquid storage (Fisher Biotec), 9% (v/v) methyl alcohol, 2% (v/v) acetate), at room temperature stirs dyeing gently and spend the night.Topple over and dyeing solution, gel at first in rinsing 10 minutes in 10% (v/v) acetate under the room temperature, is kept in 10% (v/v) acetate then.Use the video image capture systems gel to be taken pictures with the transmitted fluorescence illumination.Fig. 8 has shown the LDS polyacrylamide gel electrophoresis of inducing pill that transforms with pETDuet1:FFLuc (the 5th road) or pETDuet1:GWLuc#1 (the 8th road) construction, shows similar protein expression mode.The feature that makes new advances with IPTG inductive transform bacteria (using the pETDuet1:FFLuc carrier) performance is the bands of a spectrum (the 5th road) between 51 and the 64kDa of Photinus pyralis LUC.The IPTG inductive shows the bands of a spectrum (the 8th road) that make new advances with the bacterium that the pETDuet1:GWLuc#1 carrier transforms similarly, has shown the successful expression of Arachnocampa luciferases.

The preparation lysate

With 40 μ L BL21 (DE3) no transformed cells and 50 μ L pETDuet-1: contrast, pETDuet-1:FFLuc or pETDuet-1:GELuc#1 culture mix, and add 10 μ L 1MH ₂HPO ₄(pH 7.8) and 20mM EDTA.With aliquots containig quick freezing on dry ice of cell mixture, and be kept under-80 ℃.Frozen cell thaws by the test tube that places room-temperature water bath.The dissolving mixt that cell aliquots containig and 300 μ L are now made (1 * luciferase cell culture solubilising reagent (CCLR, Promega), 1.25mg/mL N,O-Diacetylmuramidase (Sigma), 2.5mg/mL bovine serum albumin (BSA) (Sigma)) mix.After at room temperature hatching 10 minutes,, preserve down or use immediately at-80 ℃ with the lysate five equilibrium.

The fluorescein check

The cell lysates (as above) that contains the luciferase (" Photinus pyralis LUC " or " GW luciferase ") that is derived from the bacterium buffalo gnat is used in this fluorescein check.The cell lysates aliquots containig (unless otherwise noted) of 10 μ L is joined OptiPlate ^TMIn the hole of-96 plates.The buffer mixture that 90 μ L (or make final volume be the suitable volumes of 100 μ L) is contained Tris-acetate buffer (pH7.75), ATP, magnesium acetate and D-fluorescein (Sigma) joins in the lysate, makes ultimate density be respectively 25mM, 2mM, 4mM and 0.4mM.Perhaps, 100 μ L by 10mL luciferase check damping fluid being mixed into the commercially available luciferase testing reagent (Promega) for preparing in the bottle that contains freeze dried luciferase check substrate, are joined in the specified cell lysates of 20 μ L.Use Wallacl420 Victor 2 photometers (Perkin-Elmer) rapid kinetics pattern to measure total light output.Be made as integral time 0.5 second, multiplicity is made as 100.

Embodiment 7: the Arachnocampa luciferases activity

Compare with the control cells lysate, the cell lysates that is derived from the luciferase (" Photinus pyralis LUC " or " GW luciferase ") of bacterium buffalo gnat to 10 μ L adds the D-fluorescein and causes active improve (Figure 16) of noclilucence.Report has been arranged, do not had cross reactivity fully between beetle bio-luminescence system and the bacterium buffalo gnat bio-luminescence system.GW luciferase different and increasing amount joins in the D-fluorescein, shows that this reaction is quantitative (Figure 17).In all cases, open, guarantee carefully not talk between the hole (cross-talk) by making used span.The GW luciferase that exists in the lysate mixture can use beetle D-fluorescein to carry out quantitatively (the GW luciferase lysate that sensitivity adds as 18.52CPS/ μ L) (Figure 18).Check sensitivity is enough to the Photinus pyralis LUC of preparation is in the above described manner carried out quantitatively.

Contrast

In order to guarantee that observed noclilucence strengthens is because several control experiments have been carried out in the interaction of GW luciferase and D-fluorescein.First control experiment relate to simply with before the D-fluorescein mixes with GW luciferase cell lysates 95 ℃ of heating 5 minutes down.Before adding the D-fluorescein, heat the GW luciferase that contains cell lysates and eliminated noctilcent enhancing (Figure 19) fully.

Second contrast is to see the response of GW luciferase to ATP/Mg (concentration is respectively 2mM and 4mM).Figure 20 has shown and has added at the same time or do not add under the situation of D-fluorescein that 50 μ L GW luciferase lysates are to adding the response of ATP/Mg.ATP or Mg can not cause noclilucence to strengthen, but exist the D-fluorescein then can cause.

Further contrast uses different luciferases and D-fluorescein and different substrate and GW luciferase to carry out.Compare with non-inductive cell lysates, the GW luciferase is substituted with IPTG inductive class fruit bat (drosophilia-like) luciferase can not cause noctilcent any raising (Figure 21) when adding the D-fluorescein.Compare with the control cells lysate, the D-fluorescein is replaced can not causing noctilcent any raising (Figure 22) when adding the GW luciferase with the most effective coelenterazine of noclilucence (coelentarazine) substrate (CLZN-hcp (1 μ/100 μ l)).

The reaction of observing the noclilucence raising during with GW luciferase and the mixing of D-fluorescein is owing to relate to the specific interaction of these two kinds of components in the presence of ATP.

Embodiment 8:Arachnocampa Richardsae bio-luminescence system

The preparation of crude extract: method 1

This method is from the described method transformation of people such as Viviani (2002).By with 5 luminous organs at 0.5mL cold extraction damping fluid (27mM Tricine, 7mM MgSO ₄, 0.2mMEDTA, 10% glycerine and 1% Triton X-100, pH 7.4) in homogenizing, the crude extract of preparation bacterium buffalo gnat.After the homogenizing with extract under 4 ℃ with 15, centrifugal 15 minutes of 000g.By under 98 ℃ with supernatant liquor heating 5 minutes, and add 1mM ATP (ultimate density), the extract of preparation heat.Mix with reaction buffered soln, 0.11mL Lampyridea (glow-worm or firefly) luciferase and the 0.05mL ATP/Mg (40/80mM) that 90 μ L contain 0.84mL Tris-HCl damping fluid (pH 8) by extract, measure uciferase activity 10 μ L heat.

The preparation of crude extract: method 2

In the second approach, by in 5 refrigerated light of Ai Bende (eppendorf) Guan Zhongxiang organ, adding 100 μ L ethyl acetate, then after homogenizing with extract 15, under the 000g centrifugal 5 minutes, the preparation crude extract.The Ai Bende that will contain the light organ remains on the dry ice, carries out homogenizing simultaneously and handles.By 20 μ L crude extracts are mixed with the reaction buffered soln that contains tris-acetate buffer (25mM), magnesium acetate (4mM) and ATP (2mM) (being ultimate density), obtain the final volume of 100 μ L, carry out the luminous check of external biological.

The check of GW luciferase

To contain the final volume that the reaction buffered soln of tris-acetate buffer (25mM), magnesium acetate (4mM) and ATP (2mM) (being ultimate density) and GW luciferase cell lysates provides is 100 μ L, and it is joined in the 20 μ L crude extracts.

The crude extract activity

The investigation of attempting at first with the described heat of people (2002)-cold extraction thing experiments such as GW luciferase repetition Viviani is unsuccessful.In the crude extract sample of above-mentioned preparation, add the GW luciferase, do not add ATP simultaneously, cause the active flash of light of noclilucence.This is repeatably when acting on further adding GW luciferase and adding ATP simultaneously.Such flash of light is the feature of common observed flash of light type when adding excessive luciferase and ATP in the D-fluorescein.

Luminescent spectrum

After the positive of GW uciferase activity proves in the presence of the D-fluorescein, the fluorescence and the noclilucence spectrum of GW and FF luciferase when record adds the D-fluorescein.

The preparation of solution.Mix by 450 μ L being detected the illustrated corresponding luciferase of buffered soln or commercial detection reagent (Promega) and 50 μ L, prepare 0.5mL solution.Be blended in the photofluorometer pond of 1mL and carry out, use length scanning mode record spectrum by Cary Eclipse fluorescence photofluorometer.The immediate record after solution mixes of noclilucence spectrum, fluorescence spectrum be record before each luciferase shown in adding and afterwards.

Noclilucence spectrum

(Lampyridea, Photinus) the normalization method noclilucence spectrum of luciferase is presented among Figure 23 for GW (bacterium buffalo gnat) and FF when adding the D-fluorescein.Add the maximum noclilucence of GW luciferase inductive 440 and 480nm between.Use the GW luciferase to replace the FF luciferase to cause emmission spectrum to be blue shifted to and be lower than 530nm from 555nm.The maximum value of the FF luciferase of report is for 7.6 times 562nm at pH.The spectrographic maximum strength alters a great deal, and FF and GW luciferase are respectively 90.98 arbitrary units (a.u.) and 3.12a.u..

Embodiment 9: separate the homology luciferase from other bacterium buffalo gnat species

Such as among the Baker (2004) summary, over several years, be familiar with 4 Australasia species of luminescent bacteria buffalo gnat.These species are the distinctive Arachnocampa flava of New Zealand, Arachnocampa richardsae, Arachnocampa tasmaniensis and Arachnocampaluminosa.First pair of species identification is the Campara subgenus, a pair of bacterium buffalo gnat subgenus that is identified as in back.Baker (quoting previously) has obtained the strong evidence of the luminous Diptera of Australasia by at least 9 living species representatives in her doctor's research.Except that already mentioned 4 species, Baker (quoting previously) has also described 5 new Australian species, i.e. Arachnocampabuffaloensis, Arachnnocampa tropicus, Arachnocampa girraweenensis, Arachnocampa gippslandensis and Arachnocampa otwayensis.Remove Arachnocampa spp. and North America Orfelia fultoni (Fulton, 1941; Viviani, 2002) outside, also has the fragmentary report of the luminous species of other Diptera, normally Keroplatus spp. (Sivinski for example, 1998; Baker, in 2004 sum up).These report common lack of evidence, and relate in the clustering that is not found in local high yield usually (is feature with the Australasia fauna).The Australian species that we begin to prove for example bacterium buffalo gnat that the sequence of using A.richardsae obtains easily from other noclilucence Diptera and some separate the feasibility of the sequence of coding fluorescence element enzyme, to design the PCR primer.

Method and result

To separating, clone and check order from three kinds of other homologues of A.richardsae luciferase gene of bacterium buffalo gnat species.Arachnocampaflava and Arachnocampa girraweenensis that these three species are the Campara subgenus, and the Arachnocampa tasmaniensis of Arachnocampa subgenus.For these species each, collect 2 to 5 larva samples from its natural habitat, it was lived in 24 hours is transferred to the laboratory.With the sample of each species phosphoric acid salt-or the tris-buffered saline under dissect.The light organ that is connected with some surrounding tissues that downcuts concentrated and-80 ℃ of following quick freezing.

A.RNA extracts

For each of three kinds of samples, (Ambion, cat.no.1931) specification sheets of abideing by manufacturers extracts the full RNA of two or three smooth organ to use the RNAqueous-Micro test kit.

B.cDNA is synthetic

1. article one cDNA's is synthetic: use from Creator SMART cDNA storehouse and make up test kit (Clontech/BD Biosciences, the synthesizing single-stranded cDNA of primer cat.no.K1053-1).The specification sheets that manufacturers is abideed by in reaction carries out.Directly (BD Biosciences cat.no.639500) replaces the reversed transcriptive enzyme that provides in this test kit with fresh PowerScript reversed transcriptive enzyme.

2. second cDNA's is synthetic: double-stranded (ds) cDNA uses the primer that provides in the structure test kit of Creator SMART cDNA storehouse to carry out by long-range PCR.Use 2 μ L synthetic article one cDNA described in trifle before, carry out 25 in accordance with the test kit specification sheets and increase heat cycle.Directly (BD Biosciences cat.no.50595) replaces with fresh Advantage cDNA polysaccharase mixture with the archaeal dna polymerase in the test kit.

C. by PCR clone luciferase cDNA

1.A.flava and A.girraweenensis

The part of A.flava and A.girraweenensis luciferase cDNA is increased from its ds cDNA storehouse separately.The HotStarTaq archaeal dna polymerase is used in the PCR reaction, and (Qiagen cat.no.203203) carries out, and the PCR design of primers becomes and A.richardsae luciferase gene complementation (table 6).

Table 6: the sequence of the A.richardsae luciferase cDNA primer of mentioning in text and the table 7.

	The primer title	Primer sequence	SEQ ID NO：
				F1 F2 F3 F4 F5 R5 R6 R7 R8 R9 R10 R11 R12 R13	GWLO8F5F250 GWLucScreenU GWLO91E1F250 GWLO91B6F12 GWLO91F7F228 GWLucRS873 GWLucRS757 GWLucRS601 GWLucRS484 GWLucScreenL GWLucRS326 GWLucRS182 GWLucRS90 GWLucRS42	5’-AGAAAGGGCGATCGTGTTG-3’ 5’-GATGATAATGCACCAGAAAAG- 3’ 5′-ACCATTGCCACTGTTTTATTGA-3′ 5′-CATTTAATGGCACCAGGGTACT- 3′ 5′-ACCCGAAATTGCGAACTATGA-3′ 5′-AGTAAAACCAAACGCATTAG-3′ 5′-AAGGGAGGGTGAACACTGA-3′ 5′-CCATAAAATTGACGTACGACC-3′ 5′-CCAAGAAGGGCACCAGTTT-3′ 5′-TTATAATATCCAGCATCACCA-3′ 5′-CAACGAACCATTCAAATCT-3′ 5′- AATGCAAATAATACTTCACCACC-3′ 5′-GCCACCTTTAAGATGCTTG-3′ 5′-AACATTTTGCCAGCTGGATTC-3′	17 18 19 20 21 22 23 24 25 26 27 28 29 30

For A.flava, tested 30 kinds of combinations (table 7) that primer is right, the specification sheets of abideing by manufacturers carries out 40 and increases heat cycle.30 kinds of primers have increased to 29 in the combination and have estimated unique product of size.(Astral cat.no.2MCL-5) purifies, and checks order with the primer that is specific to A.richardsae luciferase cDNA sequence with microCLEAN DNA Cleanup reagent with two kinds of PCR products (table 7).BESTFIT shows that relatively the A.flava nucleotide sequence is 96% with the identity of the cDNA sequence of the A.richardsae luciferase of measuring before.This has confirmed the identity of A.flava sequence as A.richardsae luciferase homologue.

For A.girraweenensis, only tested the combination (table 7) of 4 kinds of A.richardsae luciferase gene Auele Specific Primers, use the PCR condition identical with above-mentioned trifle.The right combination of all 4 kinds of primers has all been increased and has been estimated unique product of size.Two kinds of PCR products (table 7) are purified, and check order with A.richardsae luciferase cDNA sequence specific primers.BESTFIT shows that relatively the A.girraweenensis nucleotide sequence is 96.5% with the identity of the cDNA sequence of the A.richardsae luciferase of measuring before.This has confirmed the identity of A.girraweenensis sequence as A.richardsae luciferase homologue.

5 of A.flava and A.girraweenensis luciferase cDNA ' and 3 ' end increase by half anchor PCR individually: each primer is to comprising A.richardsae luciferase cDNA sequence specific primers, and with SMART primer part complementary second primer (table 8) of the synthetic middle use of cDNA of A.flava and A.girraweenensis ds cDNA.Use double-stranded cDNA as masterplate, abide by the indication of manufacturers, with Pfx50 archaeal dna polymerase and 40 (touchdown) PCR reactions of falling progressively heat cycle of increasing.

For the amplification of 5 ' end, two kinds of species 2 kinds of combinations (table 9) that primer is right have been tested.For A.flava and A.girraweenensis, two primers are estimated unique product (table 9) of size to all having increased.

For the amplification of 3 ' end, two kinds of species 2 kinds of combinations (table 10) that primer is right have been tested.For A.flava and A.girraweenensis, two primers are estimated unique product (table 10) of size to all having increased.For two species, a kind of product from each 3 ' and 5 ' end amplification is checked order, disclosed the sequence of 5 of luciferase cDNA ' end and 3 ' hold.For the luciferase gene of A.flava and A.girraweenensis, preceding 40 Nucleotide of ORF are identical with back 40 Nucleotide with A.richardsae luciferase cDNA ORF.The complete ORF of A.flava and A.girraweenensis luciferase gene increases by the PCR that falls progressively with two primer pETGWLucF described in the expression trifle of Virginia and pETGWLucR.(Invitrogen cat.no.12355-012) carries out, and the specification sheets of abideing by manufacturers increases as masterplate and Pfx50 archaeal dna polymerase with strand cDNA in reaction.Amplicon to 1.6kb checks order on its whole length.Find that A.flava and A.girraweenensis luciferase peptide sequence and identity from the luciferase gene of A.richardsae are respectively 99.6% and 99.8%.

2.A.tasmaniensis

5 of A.tasmaniensis luciferase cDNA ' and 3 ' end all directly increases by half anchor PCR.Several primers have been tested to (table 11 for each end; Table 12).Use double-stranded cDNA as masterplate, the specification sheets of abideing by manufacturers is with Pfx50 archaeal dna polymerase and 40 PCR reactions of falling progressively heat cycle of increasing.

For the amplification of 5 ' end, 6 combinations that primer is right have been tested.Two sizes in unique product of these amplifications with expectation.With a kind of product (table 11) according to the specification sheets of manufacturers directly be cloned into the pJET1/blunt cloning vector (Fermentas, cat.no.K1221) in.

For the 3 ' end that increases, 2 primers have been tested to combination.A pair of (table 12) increased and estimated the single product of size, and it directly is cloned in the pJET1/blunt cloning vector.To check order with the pJET1 sequencing primer from 4 clones of two kinds of clones each in the product.Show relatively that with the BESTFIT dna sequence dna of A.richardsae luciferase cDNA the identity at 5 ' end place is that the identity at 83%, 3 ' end place is 88%.Show relatively that with the BESTFIT peptide sequence of A.richardsae luciferase gene the identity of the identity of 5 ' end and 3 ' end is respectively 89% and 93%.These data acknowledgements two kinds of pcr amplification all be derived from the similar homologue of A.richardsae luciferase cDNA.The beginning of ORF and end have all obtained differentiating.Design and beginning and the terminal complementary primer of A.tasmaniensis luciferase ORF, with the amplification complete ORF:

A.tasLucORF-F：5′-ATGACTTCTACATCTGTGGA-3′；(SEQ ID NO：31)

A.tasLucORF-R：5-TTACAATGTTGATCTTAAAATAC-3′；(SEQ IDNO：32)

Table 7: with the combination of the A.richardsae cDNA primer of A.flava ds cDNA test

Y: unique product of estimating the size amplification

N: the product of not estimating the size amplification

-: combination of primers is not tested

^*G: combination of primers is estimated unique product of size amplification in addition with the A.girraweenensis test

# ^*F, g: the A.flava of order-checking and A.girraweenensis product

Table 8: the primer sequence that is used for 5 of the plain enzyme cDNA of amplification fluorescent ' and 3 ' end

#: from the primer of SMART

^*: A.richardsae luciferase cDNA aligning primer

The combination of primers of 5 of table 9:A.flava and A.girraweenensis ' end luciferase amplification assay

	SMART-nF1	SMART-nF2
			GWLucRS1120	-	Y，0.5kb *f，g
GWLucRS1000	Y	-

Y: unique product of estimating the size amplification

-: combination of primers is not tested

^*F, g: for A.flava and A.girraweenensis, product checks order

The combination of primers of 3 of table 10:A.flava and A.girraweenensis ' end luciferase amplification assay

	CDSIII-R
		GWLO91C5F84	Y，0.5kb *f，g
GWLO91G12F236	Y

Y: unique product of estimating the size amplification

^*F, g: for A.flava and A.girraweenensis, product checks order

The combination of primers of 5 ' end amplification assay of table 11:A.tasmaniensis luciferase

	SMART-nF1	SMART-nF2
			GWLucRS1120	-	N
GWLucRS1000	N	-
			GWLuc1E1R10	Y，0.4kb *	Y
GWLucRS757	N	N

Y: unique product of estimating the size amplification

N: the product of not estimating the size amplification

-: combination of primers is not tested

^*: single product cloning and order-checking

The combination of primers of 3 ' end amplification assay of table 12:A.tasmaniensis luciferase

	CDSIII-R
		GWLO91C5F84	N
GWLO91G12F236	Y，0.6kb *

Y: the single product of estimating the size amplification

N: the product of not estimating the size amplification

^*: single product cloning and order-checking

Table 13: the paired comparison of the amino acid identity/similarity of four bacterium buffalo gnat species

	A. richardsae	A. flava	A.girraweenensis	A.tasmaniensis
					A.richardsae	100	99.6	96.8	91.5
A.flava	99.8	100	99.8	91.7
					A.girraweenensis	100	99.8	100	91.7
A.tasmaniensis	94.7	94.9	94.7	100

The described PCR method of priority of use trifle not only from A.flava and A.girraweenensis, and is directly separated luciferase cDNA from A.tasmaniensis.Because our observed high-level sequence homology between the species of Campara subgenus, use the techniques described herein also can be directly to separate luciferase from other species of bacterium buffalo gnat (Campara) gippslandensis, bacterium buffalo gnat (Campara) otwayensis, bacterium buffalo gnat (Campara) tropicus and the bacterium Simulium Campara subgenus that in fact may describe any future.And we prove, and use the PCR primer that is specific to A.richardsae, can need not the over-drastic experiment and separate luciferase from A.tasmaniensis.Therefore, we will directly find the homology luciferase at inference from other species that classify as bacterium buffalo gnat subgenus, and these species comprise other species of the bacterium Simulium that bacterium buffalo gnat luminosa and bacterium buffalo gnat buffaloensis and in fact any future may describe.Certainly, will more directly use the primer that is specific to the A.tasmaniensis luciferase sequence, use aforesaid strategy and method from other species of bacterium buffalo gnat subgenus, to find the homology luciferase.There is no need to resort to screening cDNA storehouse for the luciferase that separates A flava, A.girraweenenis or A tasmaniensis.But, aforesaid library screening method will be not only from other member of bacterium Simulium and also from the Diptera (for example Orfelia fultoni or Keroplatus spp.) of the farther blue light-emitting of other relation the feasible pattern of discovery homology luciferase.

Since we can be easily from few sequence of separating coding homology luciferase to the light organ of two Arachnocampa spp., we also be sure of to use disclosed method, amplification and separation homology luciferase from the dipterous even simple sample of blue light-emitting, for example from those species that Sivinski (1998) is mentioned, wherein only run into single sample.

Embodiment 10: the bacterial expression of Photinus pyralis LUC: expression vector, host cell, induce mode and merge mark

Be used for GWLuc#1 bacterial expression alternately induce mode and expression constructs

Distribute in the trial that is optimized expression and ubcellular the GWLuc#1 of bacterial expression, as described in following trifle, the following variable of inducing mode is handled: (i) induction time, (ii) inducing temperature, (iii) IPTG concentration and (iv) coli strain (Derewenda, 2004 summary).Second strategy that uses is at GWLuc#1 and mark, sulphur hydrogen reduction albumen (Trx; PET48b (+) expression vector for example) and produce the N-end between the NusA (for example pET50b (+) expression vector) and merge.Verified these marks to protein expression and solvability all have favourable influence (

Hellgren, van den Berg, Berglund and

2002 summary).Produce N-end 6His fusion construct in addition, produce the ability of GWLuc#1 fusion rotein with further demonstration with GWLuc#1.Select the His mark to be and use the metal ion-chelant chromatogram to purify because it can be modified as.

The analysis of the GWLuc#1 of bacterial expression and the distribution of FFLuc

The dissolving mixt (1x luciferase cell culture solubilising reagent (CCLR), 1.25mg ml-1 N,O-Diacetylmuramidase) that refrigerated bacterium pill is now made with 100 μ l dissolves.After at room temperature hatching 10 minutes, with lysate at room temperature with 16, centrifugal 20 minutes of 000g.Take out supernatant liquor, to wherein adding the 1X NuPAGE that contains 50mM DTT

Lauryl laurilsulfate sample buffer.Pill contains the 1X NuPAGE of 50mM DTT by adding

The dissolving of lauryl laurilsulfate sample buffer is passed 30G pin several times by making Bacterial Lysates, and chromosomal DNA is sheared.Supernatant liquor and pill sample use the NuPAGE of Invitrogen

Novex Bis-Tris gel systems is analyzed as mentioned above.

Be used for natural GWLuc#1 bacterial expression alternately induce mode

The natural P.pyralis of expression in coli strain BL21 (DE3) and the pETDuet-1 construction of A.richardsae luciferase are alternately induced mode.From the pre-inducing culture thing of preparation as mentioned above, the aliquots containig of each 5ml is transferred to 50ml taper centrifuge tube.Aliquots containig or do not induce (adding the equal volume of water to 0.4mM IPTG) is that 0.1mM, 0.2mM or 0.4mM induce by adding IPTG to ultimate density perhaps.These cultures are hatched 24,48 hours (10 ℃ and 20 ℃) or 120 hours (only 10 ℃), the Abs600nm of its each culture of measurements under 10 ℃ or 20 ℃, 150rpm.From each culture, take out 3 or 4 0.25-0.5ml aliquot samples, at room temperature with 10, centrifugal 5 minutes of 000g.Pill is stored down at-80 ℃ and is used for protein analysis.

As before for as described in DH5 α and BL21 (DE3) coli strain, with the pETDuet-1 construction electroporation of the luciferase of natural P.pyralis and A.richardsae to colibacillary Rosetta-gami ^TMB (DE3) is (Novagen) in the bacterial strain.Described for the pETDuet-1:GWLuc#1 among the BL21 (DE3) as mentioned, culture is induced in advance.When reaching the Abs600nm of 0.6-1.0, each aliquots containig of 5ml is transferred to the taper centrifuge tube of 50ml.Aliquots containig or do not induce (adding the equal volume of water to 0.4mM IPTG) is that 0.2mM or 0.4mM induce by adding IPTG to ultimate density perhaps.These cultures are hatched 4 hours (only 20 ℃), 24,48 hours (10 ℃ and 20 ℃) or 120 hours (only 10 ℃), the Abs600nm of its each culture of measurements under 10 ℃ or 20 ℃, 150rpm.From each culture, take out 3 or 4 0.25-0.5ml aliquot samples, at room temperature with 10, centrifugal 5 minutes of 000g.Pill is stored down at 80 ℃ and is used for protein analysis.

The structure of N-end 6His GWLuc#1 fusion rotein among the pETDuet-1

Use Plainum Pfx archaeal dna polymerase, the recommendation of abideing by manufacturers use the primer NHis-GWLuc#1 of 2ng template and 10pmol (5 '-GAgaattcGATTGAGGGACGCATGGCTTGTACTTCAGT-3 '; SEQ ID NO:42) and pETGWLucR (5 '-GACGACcctaggTTACAATGTTCCTCTTAAA-3 '; SEQ ID NO:16), the full-length cDNA to GWLuc#1 increases 20 cycles.These primers are introduced EcoRI and AvrII restriction site (lowercase) at 5 of total length A.richardsae luciferase cDNA ' and 3 '.The product of purifying is the A tail as mentioned above, is connected among the pGEM T-easy.In e.colistraindh5, and use CEQ 2000 Dye TerminatorCycle Sequencing to check order the construction electroporation with Quick Start test kit and 50fmol plasmid DNA.The error-free construction of total length is excised with EcoRI (Fermentas) and AvrII, and be inserted among the linearizing pETDuet-1 of EcoRI/AvrII, the plasmid of generation is called pETDuet:NHis-GWLuc#1.With these plasmids as mentioned above electroporation in e. coli bl21 (DE3) bacterial strain and check order.

Make up pET-48b (+) AmpR:GWLuc#1 and pET-50b (+) AmpR:GWLuc#1.

By being inserted into the SphI restriction endonuclease sites that exists in each carrier from the ampicillin resistance gene of pTAL-Luc, make expression vector pET-48b (+) (Trx N-holds mark) and pET-50b (+) (NusA N-holds mark) (Novagen, EMD Bioscience) have amicillin resistance.Use Platinum Pfx archaeal dna polymerase to abide by the recommendation of manufacturers, use 2ng masterplate and 10pmol primer AmpRCasSphIF (5 '-TAGCGAAgcatgcGGTCTGACAGTTACCAA-3 '; SEQ ID NO:43) and AmpRCasSphIR (5 '-CGTAAGCgcatgcTCTAAATACATTCAAATATG-3 '; SEQ ID NO:44), will from the ampicillin resistance gene of pTAL-Luc (on the minus strand bp4148-3218+ follow closely gene 5 ' and 3 ' 10bp) 20 cycles of amplification.Each primer in 5 of ampicillin resistance gene ' and 3 ' end introduces SphI restriction endonuclease sites (lowercase).The PCR product uses microCLEAN to purify, and with SphI (New England Biolabs) digestion, and reuses the microCLEAN purification.The ampicillin resistance gene PCR product of SphI digestion is connected among dephosphorylation, the linearizing pET-48b of SphI (+) or the pET-50b (+), electroporation is in e.colistraindh5, and use CEQ 2000 Dye Terminator CycleSequencing check order with Quick Start test kit and 25fmol plasmid DNA.The plasmid that produces is called ρ ET-48b (+) AmpR and pET-50b (+) AmpR.

Use Platinum Pfx archaeal dna polymerase to abide by the recommendation of manufacturers, use 2ng masterplate and 10pmol primer GWLuc1FHRV3C (5 '-gggacccATGGCTTGTACTTCAG-3 '; SEQ ID NO:45) and pETGWLucR (5 '-GACGACcctaggTTACAATGTTCCTCTTAAA-3 '; SEQ ID NO:16), the full-length cDNA with GWLuc#1 increases 20 cycles.These primers are introduced SanDI and AvrII restriction site (lowercase) at 5 of total length A.richardsae luciferase cDNA ' and 3 '.The product of purifying is the A tail as mentioned above, is connected among the pGEM T-easy.In e.colistraindh5, and use CEQ 2000 Dye Terminator Cycle Sequencing to check order the construction electroporation with QuickStart test kit and 50fmol plasmid DNA.With the error-free construction of total length SanDI (Stratagene, La Jolla CA) and AvrII excision, and be inserted among the linearizing pET-48b of SanDI/AvrII (+) AmpR or pET-50b (+) AmpR, the plasmid of generation is called pET-48b (+) AmpR:GWLuc#1 and pET-50b (+) AmpR:GWLuc#1.With these plasmids as mentioned above electroporation in e. coli bl21 (DE3) bacterial strain and check order.Error-free construction pET-48b (+) AmpR, pET 48b (+) AmpR:GWLuc#1, pET-50b (+) AmpR and pET-50b (+) the AmpR:GWLuc#1 electroporation of each expression vector are arrived intestinal bacteria Rosetta-gami ^TMIn B (DE3) bacterial strain.

PETDuet:NHis-GWLuc#1, pET-48b (+) AmpR:GWLuc#1 and pET-50b (+) AmpR:GWLuc#1 induce mode

The pre-inducing culture thing of pETDuet-1:NHis-GWLuc#1 among the BL21 (DE3) is described for the pETDuet-1:GWLuc#1 among the BL21 (DE3) as mentioned.Aliquots containig (10ml) or do not induce (adding the equal volume of water to 0.4mM IPTG) is that 0.4mM induces by adding IPTG to ultimate density perhaps.These cultures are hatched under 20 ℃ or 37 ℃, 150rpm, under 37 ℃, hatched 1,2,3,5 and 24 hour, perhaps under 20 ℃, hatched 2,5,24,30 and 48 hours the Abs600nm of its each culture of measurements.From each culture, take out the aliquot sample of 5 0.5ml and 3 1.5ml, at room temperature with 10, centrifugal 5 minutes of 000g.Pill is stored down at 80 ℃ and is used for protein analysis.

Rosetta-gami ^TMThe pre-inducing culture thing of pET-48b (+) AmpR among the B (DE3), pET-48b (+) AmpR:GWLuc#1, pET-50b (+) AmpR and pET-50b (+) AmpR:GWLuc#1 is described for the pETDuet-1:GWLuc#1 among the BL21 (DE3) as mentioned.When reaching the Abs600nm of 0.6-1.0, will be transferred in the taper centrifuge tube of 50ml from the 5ml aliquots containig of each pre-inducing culture thing.Aliquots containig or do not induce (adding the equal volume of water to 0.4mM IPTG) is that 0.1mM, 0.2mM or 0.4mM induce by adding IPTG to ultimate density perhaps.These cultures were hatched the Abs600nm of its each culture of measurements 24 or 48 hours under 10 ℃ or 20 ℃, 150rpm.From each culture, take out the aliquot sample of 4 or 5 0.20-1.0ml, at room temperature with 10, centrifugal 5 minutes of 000g.Pill is stored down at 80 ℃ and is used for protein analysis.

Noclilucence check with the GWLuc#1 that alternately induces mode and expression constructs bacterial expression

By in 20 μ L cell lysates, adding 100 μ L Promega reagent damping fluids or in the cell lysates sample, adding homemade damping fluid, carry out the noclilucence check as mentioned above.Noclilucence is with using rapid kinetics pattern (integral time=0.5 second, multiplicity=100) Wallacl420 Victor 2 photometers (Perkin-Elmer) record, perhaps in order to noclilucence pattern (pitch time=0.2 second, PMT gain=4095, number of times=200 at interval, normalization method time=0.5 second) POLARstar OPTIMA (BMG) record of work.

The result

Two kinds of plain enzymes of natural fluoresence carry out bacterial expression a series of inducing under the mode.Under 1 hour and 20 ℃ under 37 ℃ 2 hours, Trx and NusA N-end GWLuc#1 fusion construct are at Rosetta-gami ^TMSuccessful expression in B (DE3) coli strain, 6His N-end GWLuc#1 fusion construct successful expression in BL21 (DE3).

Rosetta-gami ^TMThe A.richardsae luciferase of the expression in B (DE3) coli strain is tested with inductive pETDuet-1 construction under over-over mode, the noclilucence activity when adding the self-control damping fluid to measure.When comparing,, culture produced the highest active cell lysates in 48 hours under 20 ℃ by being hatched with the sample for preparing from the culture of under 10 ℃ or 20 ℃, hatching 24 hours.If will be at Rosetta-gami ^TMThere are the enhancing of about 2 factors in the noclilucence activity and the comparing of expressing in coli strain BL21 (DE3) of the A.richardsae luciferase of expressing in B (DE3) coli strain.Must be noted that the A.richardsae luciferase in e. coli bl21 (DE3) with than at Rosetta-gami ^TMMuch higher horizontal expression among the B, specific activity of the luciferase protein that this explanation is expressed is than at Rosetta-gami ^TMMuch higher in the B system.With anyly induce the control vector sample under the mode to compare Rosetta-gami as herein described ^TMThe sulphur hydrogen reduction albumen of expressing in B (DE3) coli strain and the A.richardsae luciferase of NusA. mark do not produce any tangible noclilucence activity (P=0.05).

The natural P.pyralis (FFLuc) of bacterial expression and the ubcellular distribution of A.richardsae (GWLuc#1) luciferase are measured.Based on the protein staining of gel, FFLuc mainly is distributed in the supernatant liquor, only has to remain on granular precipitation part on a small quantity.The distribution of GWLuc#1 is greatly different, and major portion is dispensed to granular precipitation.Based on the protein staining of gel, in supernatant liquor, do not observe its existence.Under no inductive mode, based on protein staining, the distribution of observing natural A .richardsae luciferase migrates to the supernatant liquor part from granular precipitation.Sensitivity is measured in the noclilucence of FFLuc when this observations will be interpreted as where adding the D-fluorescein (' Photinus pyralis LUC ') will be much larger than GWLuc#1.

The expression of embodiment 11:A.richardsae luciferase in eucaryon yeast saccharomyces cerevisiae (Saccharomycescerevisiae)

Structure is used for the pYES2:GWLuc#1 of yeast saccharomyces cerevisiae inducible expression

The EcoRI fragment excision that to clone from the pGEM T-easy of the cDNA construction that contains total length, error-free GWLuc#1 that uses in " structure of pET-48b (+) AmpR:GWLuc#1 and pET-50b (+) AmpR:GWLuc#1 " trifle and describe, and be inserted among dephosphorylation, the linearizing pYES2 of EcoRI (Invitrogen).This plasmid is called pYES2:GWLuc#1, with its electroporation in e.colistraindh5.Use primer T7 (5 '-TAATACGACTCACTATAGGG-3 ') and pETGWLucR to carry out Standard PC R and screen, thereby identify the transformant that contains GWLuc#1 in the right direction.Use QIAprep Spin Miniprep test kit (Qiagen) from pYES2 and pYES2:GWLuc#1 isolated plasmid dna, use 1 μ g plasmid to use yeast conversion test kit (Sigma) to come transformed saccharomyces cerevisiae bacterial strain S288C (Invitrogen).(Sigma) go up selection 48 hours by yeast synthetic leakage (Drop-Out) medium supplement (SCCM-U) under 30 ℃, select to be used for the former yeast conversion body of supporting (prototrophy) of uridylic at the no uridylic that is supplemented with 2% (w/v) glucose (Sigma).By using Y-DER ^TMExtract test kit (Pierce, Rockford IL) and extract plasmid DNA and use T7 and pETGWLucR repeats above-mentioned PCR screening, reconfirm the existence of pYES2:GWLuc#1.

PYES2:GWLuc#1 induces

With the culture of pYES2 among the 15ml S288C and the pYES2:GWLuc#1 among the S288C in the SCCM-U that contains 2% (w/v) glucose under 28 ℃ with constant stirring grow overnight.Measure the Abs600nm of each overnight culture, to calculate among the 5ml 0.5 Abs ₆₀₀The culture volume that nm is required.Take out every kind of volume required culture, under 1500g centrifugal 5 minutes, so that the cell granulating.Granulated yeast cell is suspended in non-inducing culture of 5ml (SCCM-U that contains 2% (w/v) raffinose (Sigma)) or the inducing culture (SCCM-U that contains 2% (w/v) semi-lactosi (Sigma) and 2% (w/v) raffinose) once more.Culture was hatched 24,48 and 72 hours with constant stirring under 28 ℃, hatch the Abs600nm that measures each culture when finishing.From each culture, take out aliquots containig (0.1-0.5ml), at room temperature with 10, centrifugal 5 minutes of 000g.Granularly be deposited in 80 ℃ and preserve down and be used for protein analysis.

The protein analysis of the GWLuc#1 that yeast saccharomyces cerevisiae is expressed carries out as described, and has following modification.Because the existence of yeast cells wall is heated the dissolved sample 5 minutes down at 100 ℃.

Preparation is used for the cell lysates of luciferase check

In the cell pill, add 1X passive dissolution damping fluid (Promega), to produce 1.446X 10 ⁷Yeast count, calculate based on Abs ₆₀₀Nm 1=3X10 ⁷Cell/ml.At once added the passive dissolution damping fluid before check, mixing time is about 15-20 second.

The noclilucence check of the A.richardsae luciferase in the yeast saccharomyces cerevisiae

Add after the dissolving damping fluid, 25 μ L cell lysates mixtures are mixed with the homemade check damping fluid of 75 μ L, use Wallacl420 Victor 2 photometers (Perkin-Elmer) monitor optical to export situation over time as mentioned above.

The result

The protein staining of gel shows between the yeast strain that is loaded with and is not loaded with the GWLuc#1 construction without any difference.But the pYES2 expression system is different from the pET-escherichia expression system, and it was not an expression system.Do not carry out further experiment to differentiate A.richardsae luciferase protein matter.On the contrary, carry out the luciferase check, with bacterial strain that relatively is loaded with GWLuc#1 and the control strain that is not loaded with.This is the method than the existence of SDS-PAGE and the plain enzyme of protein staining sensitive De Duode screening active fluoro.

Noclilucence is the activity of short pulse seemingly, if estimate as any luciferase of checking lower concentration far away with excessive D-fluorescein/ATP.Figure 24 has shown in that 1.12 seconds measure behind the opening entry from hatch 24,48 or 72 hours the GWLuc#1 of culture preparation or the noclilucence intensity (CPS 0.5s) of control vector under 28 ℃.Active maximum from the noclilucence that the cell lysates of hatching 72 hours culture preparation reaches, and the activity of GWLuc#1 is significantly higher than control sample (P=0.05).This shows GWLuc#1 successful expression in yeast saccharomyces cerevisiae, and also demonstrates sizable activity.Although noclilucence intensity (CPS) was similar magnitude (Figure 24) when the A.richardsae luciferase was expressed in coli strain BL21 (DE3) or yeast saccharomyces cerevisiae, expression level in the former is far above the latter, the specific activity of luciferase that shows expression in yeast saccharomyces cerevisiae much larger than in BL21 (DE3) bacterial isolates.

All publications and the patent mentioned in the above-mentioned specification sheets all are incorporated herein by reference at this.Under the situation that does not depart from the scope of the invention and spirit, the various modifications and variations of method and system of the present invention are that those skilled in the art are conspicuous.Although the present invention describes by concrete preferred implementation, be to be understood that the present invention for required protection should not be confined to these embodiments.In fact, molecular biology or various equivalent modifications are apparently to the various modifications of implementing aforesaid way of the present invention all within the scope of the appended claims.

Reference

To think the degree that content described herein provides exemplary method or other details to replenish below with reference to document, specifically be attached to herein as a reference.

United States Patent (USP) 5,484,956

United States Patent (USP) 5,538,879

United States Patent (USP) 5,576,198

United States Patent (USP) 5,595,896

United States Patent (USP) 5,629,470

United States Patent (USP) 5,633,155

United States Patent (USP) 5,656,466

United States Patent (USP) 5,670,356

United States Patent (USP) 5,670,356

United States Patent (USP) 5,674,731

United States Patent (USP) 5,689,045

United States Patent (USP) 5,689,049

United States Patent (USP) 5,739,409

United States Patent (USP) 5,744,320

United States Patent (USP) 5,744,320

United States Patent (USP) 5,750,870

United States Patent (USP) 5,767,367

United States Patent (USP) 5,807,522

United States Patent (USP) 5,837,832

United States Patent (USP) 6,068,979

United States Patent (USP) 6,143,502

United States Patent (USP) 6,171,809

United States Patent (USP) 6,270,964

United States Patent (USP) 6,297,018

United States Patent (USP) 6,342,345

United States Patent (USP) 6,503,723

United States Patent (USP) 6,586,196

United States Patent (USP) 6,602,657

United States Patent (USP) 6,602,658

United States Patent (USP) 6,690,461

United States Patent (USP) 6,927,037

U.S. Patent application 20030166905 (2003)

Adachi，J.Hasegawa，M.MOLPHY：programs for molecular phylogenetics，ver 2.3.Institute of Statistical Mathematics，Tokyo(1996).

People J.Mol.Biol.215:403-10 (1990) such as Altschul

People such as Amann, Gene 69:301-315 (1988)

Angers, S., people Proc Natl Acad Sci U S A 97 (7): 3684-9 (2000) such as A.Salahpour.

People such as Ausubel, " Current Protocols in Molecular Biology ", John Wiley ﹠amp; Sons, (1998).

Baker，C.(2004).Australian glow-worms(Diptera：Keroplatidae：Arachnocampa spp.)：distribution，diversity，identity and management.Ph.D.Thesis，Department of Zoology and Entomology，University ofQueensland，Brisbane：186pp.

People such as Baldari, EMBO be (1987) J.6:229-234.

Berger, S.L. and A.R.Kimmel eds., 1987 " Methods in Enzymology:Guideto Molecular Cloning Techniques ", Academic Press.

People such as Bowie, Science 247:1306-1310 (1990).

Branchini, B.R., people Biochemistry such as R.A.Magyar 37 (44): 15311-9 (1998).

Branchini, B.R., people Biochemistry such as R.A.Magyar 40 (8): 2410-8 (2001).

Branchini, B.R., people Biochemistry such as T.L.Southworth 42 (35): 10429-36 (2003).

People Acta Crystallogr D Biol Crystallogr.1996 Jul 1 such as Conti; 52 (Pt 4): 876-8.

Conti, E., people Structure such as N.P.Franks 4 (3): 287-298 (1996).

Creighton，T.E.，Proteins-Structure and Molecular Properties，2nd Ed.，W.

H.Freeman and Company，New York(1993).

People such as Cunningham, Science 244:1081-1085 (1989)

Day, J.C, people such as L.C.Tisi, Luminescence 19 (1): 8-20 (2004).

People Science 255:306-312 (1992) such as de Vos.

De Wet, J.R., people Molecular and Cellular Biology 7 (2): 725-37 (1987) such as K.V.Wood.

Derewenda，Z.S.(2004)Methods 34：354-363.

Devereux, people such as J., Nucleic Acids Res.12 (1): 387 (1984)

Elion E.A.(2003)Unit 3.17-Constructing recombinant DNA molecules bythe polymerase chain reaction.In Ausubel F.M.，Brent R.，Kingston R.E.，

Moore D.D.，Seidman J.G.，Smith J.A.and Struhl K.(Eds)CurrentProtocols in Molecular Biology.John Wiley & Sons，Inc.，USA.

Felsenstein，J.Cladistics 5：164-166，1989

Flanagan, people such as W.M. (1991) J.Virology:65,769-786

Fulton，B.B.Annals of the Entomological Society of America 34：289-302(1941).

Gottesman，S.，Gene Expression Technology：Methods in Enzymology 185，

Academic Press，San Diego，Calif.(1990)119-128).

Gribskov, M. and Devereux, J., eds., Sequence Analysis Primer, M StocktonPress, New York, 1991

Griffin, A.M. and Griffin, H.G., eds., Computer Analysis of Sequence Data, Part 1, Humana Press, New Jersey, 1994

M. wait the people. (2002) Protein Science 11:313-321.

Harlow，Antibodies，Cold Spring Harbor Press，(1989)

Harrison，R.A.Pacific Insects 8(4)：877-833(1966).

People such as Houghten, Nature 354:84-86 (1991)

Jain, V.K. and Magrath, I.T., Bio Techniques:12,681-683 (1992)

People such as Kaufman, EMBO be (1987) J.6:187-195

People such as Keown (1990), Meth.Enzymol.185:527-537.

Kozak，M.，Cell 44(2)：283-92(1986).

Kozak，M.，Nucleic Acids Res 15(20)：8125-48(1987).

Krause, M.H. and S.A.Aaronson, Methods in Enzymology, 200:546-556 (1991)

People such as Kujan, Cell 30:933-943 (1982)

People such as Lam, Nature 354:82-84 (1991)

Leckie, people .Bio Techniques:17 such as F., 52-57 (1994)

Lee，J.Photochemistry and Photobiology 24：279-285(1976).

Lesk，A.M.，ed.，Computational Molecular Biology，Oxford University

Press，New York，1988

Lockhart, people Nat.Biotech.14:1675-1680 such as D.J., 1996.

People such as Lucklow, Virology 170:31-39 (1989)

Lundin，A.Methods Enzymol 305：346-70(2000).

People such as Masuda, Gene 77,265-270 (1989) and

Millican, D.S. and I.M.Bird, Anal Biochem 249 (1): 114-7 (1997).

Nakatsu, people Nature 440:372-376 (2006) such as T..

Needleman and Wunsch (J.MoI.Biol.48:444-453 (1970)

Nucleic Acids Res.25(17)：3389-3402(1997)

Plant Biochemistry and Molecular Biology(eds.Lea & Leegood，JohnWiley & Sons)(1993)pp 275-295.

Promega:Instructions for use of Products E2920, E2940, and E2980, revised 1/06, Part Number TM058.and Promega pGL3 Luciferase ReporterVectors (derive from Promega Corporation, Madison, Wis.)

Pugsley，C.W.，New Zealand Entomologist 7(4)：419-424(1983).

People such as Rattan (Ann.N.Y Acad.Sci.663:48-62 (1992)

Sakurai, Y., R.Komatani, K.Tabata and H.Takaie On the glow-wormbreeding at Tama Zoo

People such as Sambrook, Molecular Cloning:A Laboratory Manual.2nd.ed., Cold

Spring Harbor Laboratory Press，Cold Spring Harbor，N.Y.，(1989)

Schena, people such as M. (1996 Proc.Natl.Acad.Sci.93:10614-10619)

People such as Schultz, Gene 54:113-123 (1987)

Seed，B.Nature 329：840(1987)

People such as Seifter (Meth.Enzymol.182:626-646 (1990)) and

Seliger, H.H. and W.D.McElroy, Arch Biochem Biophys 88:136-41 (1960).

Shimomura, people such as Johnson 1966

Shimomura, O., people such as F.H.Johnson, Observations on the biochemistry ofluminescence in the New Zealand glowworm, Arachnocampa luminosa.Bioluminescence in Progress.F.H.Johnson and Y.Haneda.Princeton, Princeton University Press:487-494 (1966).

People such as Smith, Gene 67:31-40 (1988)

People such as Smith, L MoI.Biol.224:899-904 (1992)

People such as Smith, MoI.Cell Biol.3:2156-2165 (1983)

Smith，D.W.，ed.，Biocomputing：Informatics and Genome Projects，Academic Press，New York，1993

People such as Songyang, Cell 72:767-778 (1993)

People such as Studier, Gene Expression Technology:Methods in Enzymology185:60-89 (1990)

Sivinski，J.M.(1998).Florida Entomologist 81(3)：282-292.

Takaie，H.(1989)Breeding and display of the glow-worms，Arachnocampaspp.Insectarium，vol.26 July：214-219

Takaie，H.(1997)Ten years of the glow-worm(Arachnocampa richardsae)rearing at Tama Zoo-Fascination of a living milky way.Insectarium，vol34 November：336-342.

Viviani, people .Photochem Photobiol.75 (1): 22-7 (2002) such as Hastings

Viviani，V.R.，Cell.Mol.Life Sci.59：1833-1850(2002)

von Heinje，G.，Sequence Analysis in Molecular Biology，Academic Press，(1987)

People such as Wada, Nucleic Acids Res.20:2111-2118 (1992)

WO/1995/011995

WO/1999/066324

WO/2000/024878

WO1999/049019

Wold，F.，Posttranslational Covalent Modification of Proteins，B.C.Johnson，Ed.，Academic Press，New York 1-12(1983)

Wood, K.V., (1998) The Chemistry of Bioluminescent Reporter Assays, 65, the 14 pages of Promega Notes.

People such as Wood, Science 244,700-702 (1989)

Wood，K.V.，Evolution of bioluminescence in insects.VII InternationalSymposium on Bioluminescence and Chemiluminescence，Wiley，Chichester，UK(1983).

Xu, Y., people such as D.W.Piston, Proc Natl Acad Sci U S A 96 (1): 151-6 (1999).

Claims (20)

1. isolating peptide that shows uciferase activity, wherein

A. described uciferase activity comprises the dependent luminous reaction of catalysis ATP; With

B. described luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 530 ± 5nm; With

C. described peptide has following aminoacid sequence, when comparing with SEQ ID NO:4, is that with the difference of SEQ ID NO:4 at least one place aminoacid sequence that is selected from R218 disappearance, H245N, G315S, L342S and T343S changes.

2. isolating peptide according to claim 1, it comprises following aminoacid sequence, when comparing with SEQ ID NO:4, be to be selected from A22Y with the further difference of SEQ ID NO:4, Y53A, L63T, E83D, F88Y, F89Y, P91I, A103C, Y109W, E113D, V139I, G160P, S198T, H212Q, the R218 disappearance, D224S, the P225 disappearance, G228D, P233K, P242Q, F243Y, H245N, L253M, Y255R, F273Y, Y280F, S298K, L300E, E311R, G315S, P318T, L319V, G339F, L342S, T343S, D375H, K380A, E389F, T408S, W417Y, L418V, D427N, L441I, I442V, K443M, Y444V, K445D, Q448A, A452T, L458I, V485L, V486T, G490R, V506L, R513K, V516C, T527A, with begin from K549 and comprise that its at least one other aminoacid sequence to all residues disappearance of carboxylic end changes.

3. according to claim 1 or the described isolating peptide of claim 2, it comprises the fragment of the aminoacid sequence of at least 10 continuous amino acids that are selected from SEQID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.

4. according to claim 1 or the described isolating peptide of claim 2, it comprises the aminoacid sequence of the variant of the aminoacid sequence that is selected from SEQID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10, wherein said variant is by following nucleic acid molecule encoding, and described nucleic acid molecule is selected from nucleic acid molecule or the hybridization of its complement of SEQ ID NO:1, SEQ ID NO:3, SEQ IDNO:5, SEQ ID NO:7 and SEQ ID NO:9 with sequence under stringent condition.

5. isolating peptide according to claim 1, it comprises the aminoacid sequence that is selected from SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.

6. isolating peptide, the aminoacid sequence shown in aminoacid sequence that it has and the SEQ ID NO:2 is shared at least 70% identity.

7. antibody, it is optionally in conjunction with according to any described peptide among the claim 1-6.

8. isolated nucleic acid molecule, it comprises the nucleotide sequence of coding according to any described peptide among the claim 1-6.

9. gene chip, it comprises nucleic acid molecule according to claim 8.

10. transgenic cell, it comprises nucleic acid molecule according to claim 8.

11. a nucleic acid carrier, it comprises nucleic acid molecule according to claim 8.

12. a host cell, it contains carrier according to claim 11.

13. the method for a monitoring purposes gene or the expression of its part in host cell, described method comprises: (a) introduce vector construct in host cell, described vector construct comprises nucleic acid molecule according to claim 8, and further comprises the nucleic acid molecule of coding purpose nucleotide sequence or product; Nucleic acid molecule wherein according to claim 8 and aim sequence or product coexpression; (b) existence of the expression of detection nucleic acid molecule according to claim 8, thereby the expression of monitoring purposes sequence or product.

14. active method of in the aliquots containig of sample, measuring at least two kinds of report enzymes, described method comprises by measuring the first report enzyme is measured in luminous reaction by the optical signal of the first report enzyme catalysis generation activity, and by measuring at least the second report enzyme is measured in luminous reaction at least by the optical signal of the second report enzyme catalysis generation activity, at least a uciferase activity that shows of the wherein said first or second report enzyme, described uciferase activity comprises the luminous reaction of catalysis dependency ATP, and described luminous reaction produces the emmission spectrum of maximum emission intensity at the wavelength place that is less than or equal to 530 ± 5nm.

15. method according to claim 14, wherein two kinds of at least two kinds of report enzymes all is the dependent luciferase of ATP.

16. method according to claim 14, the wherein said first report enzyme comprises peptide according to claim 1.

17. method according to claim 14, the wherein said first report enzyme comprises peptide according to claim 5.

18. method according to claim 14, the wherein said second report enzyme catalysis luminous reaction, described luminous reaction produce maximum emission intensity at the emmission spectrum greater than the wavelength place of 530nm.

19. method according to claim 14, wherein said being determined on the same sample aliquot carried out.

20. method according to claim 14, wherein multinomial mensuration is carried out simultaneously.

Images