CN101270365A - Method for preparing transgenic cultivated silkworm with high resistance for blood type nuclear polyhedrosis - Google Patents
Method for preparing transgenic cultivated silkworm with high resistance for blood type nuclear polyhedrosis Download PDFInfo
- Publication number
- CN101270365A CN101270365A CNA2008100241106A CN200810024110A CN101270365A CN 101270365 A CN101270365 A CN 101270365A CN A2008100241106 A CNA2008100241106 A CN A2008100241106A CN 200810024110 A CN200810024110 A CN 200810024110A CN 101270365 A CN101270365 A CN 101270365A
- Authority
- CN
- China
- Prior art keywords
- gene
- lef
- silkworm
- bombyx mori
- expression cassette
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for producing transgene silkworms for improving resistance to nuclear polyhedrosis. A transgene vector which carries dsRNA expression cassette of ie-1 genes of bombyx mori nuclear polyhedrosis viruses, dsRNA expression cassette of lef-1 genes, is provided with neomycin resistance genes Neo and fluorescent protein reporter genes, and based on a piggyBAC transposon, is established through gene engineering operations. The transgene vector is introduced into primarily laid eggs, and the resistance of the transgene silkworms to nuclear polyhedrosis is significantly improved. By combing transgenes with RNAi technology, the resistance of silkworms to nuclear polyhedrosis is improved, and the screening process of transgene silkworms is optimized.
Description
Technical field
The present invention relates to the transgenic breeding field, be specifically related to a kind of production has the transgenic bombyx mori of high resistance to nuclear polyhedrosis method.
Background technology
Silkworm blood type pus illness is recurrent a kind of infectivity flacherie during silkworm already produces, and is one of major reason of cocoon yield poor harvest, and this disease is that (Bombyx moriNucleopolyhedrovirus, BmNPV) infection causes by Bombyx mori nuclear polyhydrosis virus.Eighties of last century, in the production of breeding silkworms, the achievement in research of aspects such as people's integrated application genetics, physiology, pathology, ecology, by thorough disinfection, eliminate contagium, strengthen feeding and management, improve the silkworm body to the resistivity of virus and raise the measure of aspects such as disease resistance kind, silkworm blood type pus illness is carried out integrated control, obtained obvious effects.Yet in large-scale sericulture field, take these measures not only to need a large amount of manpower and materials, also can make the sericulture field device complicated.
Therefore, the cultivated silkworm breed variety of cultivating anti-nuclear polyhedrosis is to prevent and treat the infectivity flacherie to infect and the key measure that takes place, existing many researchists are doing a lot of useful explorations and research aspect the seed selection of silkworm disease-resistant variety both at home and abroad, it is generally acknowledged, silkworm belongs to horizontal resistance to the resistance of Bombyx mori nuclear polyhydrosis virus, is undertaken by ordinary method that anti-Bombyx mori nuclear polyhydrosis virus breed breeding directional property is poor, the cycle is long, breeding efficiency is low.Therefore, be necessary to explore improve cultivated silkworm breed variety to the Bombyx mori nuclear polyhydrosis virus resistivity novel method.
Bombyx mori nuclear polyhydrosis virus belongs to the member of Rhabdoviridae, and viral genome is the circular double stranded DNA about 130kb, and the genom sequence of existing a plurality of baculoviruss is determined, and the function of most of genes has been done comparatively detailed research.Result of study shows, baculovirus DNA duplicates necessary gene and comprises in the nuclear of cells infected: indispensable protein IE-1 (the Pathakamuri JA of coding viral gene expression and dna replication dna, Theilmann DA.The acidic activation domain of thebaculovirus transactivator IE1 contains a virus-specific domain essential forDNA replication.JVirol, 2002,76:5598-5604), LEF-1 (a kind of DNA primase) (Mikhailov VS, Rohrmann GF.Baculovirus replication factor LEF-1 is aDNA primase.J Virol, 2002,76:2287-2297), LEF-2 (with the LEF-1 interaction protein), LEF-3 (single-stranded DNA binding protein), dnapol (archaeal dna polymerase) and p143 (dnahel, dna unwinding enzyme) etc.Gene knockout studies show that, lacks these genes, and virus can not be bred and be duplicated, and therefore, the functional expression that suppresses these indispensable genes may be a kind of available strategy that prevents silkworm infected silkworm nuclear polyhedrosis virus.
And the development of RNAi technology makes it to become possibility, and RNAi (RNA interference) is that a kind of double-stranded RNA (dsRNA) that depends on suppresses the active phenomenon of its complementary homologous gene.The gene silencing of RNAi mediation is a kind of strong means that suppress virus replication, small molecules by chemosynthesis, in-vitro transcription preparation suppresses RNA (short interfering RNAs, siRNAs) and by the rna expression carrier duplicate (Lopez T in the propagation that the small molecules inhibition RNA of transit cell record generation has successfully suppressed multiple virus, Camacho M, Zayas M, Najera R, Sanchez R, Arias CF, Lopez S.Silencing themorphogenesis of rotavirus.J Virol.2005,79 (1): 184-92; Su san L.Uprichard, Bryan Boyd, Alana Althage and Francis V.Chisari.Clearance of hepatitis Bvirus from the liver of transgenic mice by short hairpin RNAs.PNAS, 2005,102 (3): 773-778), therefore, can think the RNAi technology for suppress Bombyx mori nuclear polyhydrosis virus the silkworm proliferation in vivo duplicate, improve silkworm provided the resistivity of Bombyx mori nuclear polyhydrosis virus may.
Isobe uses the RNAi technology and has carried out the inhibition research that BmNPV propagation is duplicated, the result shows, the BmN cell of the constitutive expression plasmid pIS-IRlef1 of transfection energy transient expression lef-1 long segment dsRNA shows resistivity to BmNPV, virus titer behind the infection BmNPV 48h in the culturing cell has descended half compared with the control, show that suppressing the propagation that activity that BmNPV duplicates indispensable gene can suppress virus by RNAi duplicates, improve resistivity (the Isobe R of cell to BmNPV, Kojima K, Matsuyama T, Quan GX, Kanda T, Tamura T, Sahara K, Asano SI, Bando H.Use of RNAi technology to confer enhanced resistance to BmNPV ontransgenic silkworms.Arch Virol.2004,149 (10): 1931-40).
Xue Renyu is with the transient expression plasmid pSKIE13-IE24 of ie-1 promotor construction expression ie-1 long segment dsRNA, the result shows that this composing type dsRNA expression plasmid duplicates the propagation of BmNPV and all shows had strong inhibitory effects (Xue Renyu in BmN cell and silkworm body, it is good that tribute becomes, RNAi based on dna vector suppresses duplicating of Bombyx mori nuclear polyhydrosis virus, silkworm industry science, 2006,32 (3): 362-367).Therefore, if make continual and steady expression of silkworm duplicate indispensable gene homologous dsRNA, just may improve the resistance of silkworm to BmNV with BmNPV.
Isobe utilizes the piggyBAC transposon, makes silkworm expression long segment lef-1dsRNA by transgenosis, gives silkworm BmNPV is the moderate resistance; Kanginakudru S is by the element importing domestic silkworm gene group of transgenosis with constitutive expression long segment ie-1dsRNA, can improve resistance (the Kanginakudru S of silkworm equally to BmNPV, Royer C, Edupalli SV, Jalabert A, et al.Targeting ie-1geneby RNAi induces baculoviral resistance in lepidopteran cell lines and intransgenic silkworms, Insect Mol Biol.2007,16 (5): 635-44).
Publication number is the Chinese patent of CN 1706939A transgenic silkworm of disclosing a kind of antinuclear polyhedron virus and preparation method thereof, to encode a kind of DNA of RNA molecule of this invention changes silkworm seed over to, wherein the RNA molecule demonstrates the RNAi effect of nuclear polyhedrosis virus being bred necessary gene, and for example the lef-1 gene of nuclear polyhedrosis virus or other polyhedrosis viruses are bred necessary gene; From the silkworm that the ovum that has changed described DNA over to obtains, filter out transgenic silkworm, for example distinguish and screen by being cloned into the fluorescence recognition protein simultaneously.
The common ground of the prior art that above-mentioned document is put down in writing is: described polyhedrosis virus is bred ie-1, lef-1 gene length fragment or other polyhedrosis viruses that necessary gene is selected from BmNPV and is bred a kind of in the necessary gene length fragment, combination by transgenosis and RNAi technology improves silkworm to the BmNPV resistance, but insect cell is not high to long segment dsRNA cutting efficiency, thereby influence gained transgenic bombyx mori and offspring thereof resistance, so following point still has to be solved to BmNPV:
1, BmNPV has a plurality of virus multiplications to duplicate indispensable gene, and the heterogeneic dsRNA of BmNPV suppresses the effect difference that virus multiplication duplicates by RNAi, need search out and can suppress best target gene and the target sequence that BmNPV duplicates;
2, RNAi is the activity of inhibition of sequence-specific ground and dsRNA homologous gene, and virus can be escaped RNA by the series jump of target gene and disturb, and how to prevent that BmNPV from escaping the RNA interferential also is one of right problem of demand side;
3, in addition, transgenic bombyx mori might exist foreign gene to lose phenomenon, and therefore, the dsRNA Expression element that how to guarantee to import the domestic silkworm gene group can genetic stability also be the problem that transgenosis RNAi need solve.
Summary of the invention
The object of the invention provides a kind ofly has the preparation method of the transgenic bombyx mori of high resistance to Bombyx mori nuclear polyhydrosis virus, optimizes the screening process of transgenic bombyx mori simultaneously.
For achieving the above object, the technical solution used in the present invention is that a kind of method for preparing transgenic cultivated silkworm that nuclear polyhedrosis is had high resistance comprises the steps:
[1] makes up with silkworm and organize the dsRNA expression cassette of ie-1 gene of promoters active control Bombyx mori nuclear polyhydrosis virus and the dsRNA expression cassette of lef-1 gene;
[2] structure is organized promoters active control neomycin resistance gene neo expression cassette with silkworm;
[3] expression cassette that obtains of expression cassette that step [1] is obtained and step [2] is cloned into the transgene carrier that has fluorescent protein report gene based on the transposon piggyBAC factor, acquisition transgene carrier pigRNAi
Neo-ie-lef;
[4] with transgene carrier pigRNAi
Neo-ie-lef does to mix with helper plasmid, import and just to lay eggs, from the newly-hatched silkworm after the hatching, obtain transgenic bombyx mori, further with the filial generation of transgenic bombyx mori, the inoculation Bombyx mori nuclear polyhydrosis virus screens the transgenic bombyx mori that obtains nuclear polyhedrosis is had resistance by checking.
In the step of technique scheme [1], when the dsRNA expression cassette of the ie-1 gene of structure Bombyx mori nuclear polyhydrosis virus and the dsRNA expression cassette of lef-1 gene, optimized technical scheme is: according to the whole genome sequence (accession number on the GenBank is L33180) of disclosed Bombyx mori nuclear polyhydrosis virus, selecting the interior length of ie-1 gene coding region is the target sequence of 19-23nt dna sequence dna as the dsRNA design of RNAi, makes up the dsRNA expression cassette of the ie-1 gene of BmNPV; Selecting the interior length of lef-1 gene coding region is the target sequence of 19-23nt dna sequence dna as the dsRNA design of RNAi, makes up the dsRNA expression cassette of the lef-1 gene of BmNPV.When the dsRNA expression cassette of the ie-1 gene of structure Bombyx mori nuclear polyhydrosis virus and the dsRNA expression cassette of lef-1 gene, more optimized technical scheme is: according to the whole genome sequence (accession number on the GenBank is L33180) of disclosed Bombyx mori nuclear polyhydrosis virus, A with the codon ATG of ie-1 gene orientates 1 as, then the initiation site of the target sequence of the design of the dsRNA in the ie-1 gene coding region is respectively the 202nd, 415,657,887,1097,1099,1127,1128,1162,1163,1329,1408,1481,1622,1623,1624,1681,1682,1696,1697 sites, selecting length is the target sequence of 19-23nt dna sequence dna as the dsRNA design of RNAi, makes up the dsRNA expression cassette of the ie-1 gene of BmNPV; A with the codon ATG of lef-1 gene orientates 1 as, then the initiation site of the target sequence of the design of the dsRNA in the lef-1 gene coding region is respectively the 57th, 134,135,222,225,226,349,419,506,507,513,518,533,611,612,616,716,778,779, selecting length is the target sequence of 19-23nt dna sequence dna as the dsRNA design of RNAi, makes up the dsRNA expression cassette of the lef-1 gene of BmNPV.The GC content of described target sequence is between 33%-58%.
In step [3], described pigRNAi
Neo-ie-lef can clone into the transgene carrier that has fluorescent protein report gene based on the transposon piggyBAC factor by the neomycin resistance gene neo expression cassette of earlier silkworm being organized promoters active control, and then the clone advances the dsRNA expression cassette acquisition of the dsRNA expression cassette and the lef-1 gene of ie-1 gene; Described pigRNAi
Neo-ie-lef also can clone into the transgene carrier that has fluorescent protein report gene based on the transposon piggyBAC factor by the expression cassette that step [1] is obtained, obtain transgene carrier pigRNAi-ie-lef, transgene carrier pigRNAi-ie-lef obtains will to organize promoters active control neomycin resistance gene neo expression cassette to clone into silkworm again.
In step [4] with pigRNAi
Neo-ie-lef and helper plasmid pHA3PIG (Tamura Toshiki.et al.Germline transformation of the silkworm Bombyx moriL.using apiggyBac transposon-derived vector.Nature Biotechnology, 2000,18:81-84) mix, import and just lay eggs, the G418 to 4 that newly-hatched silkworm after the hatching is added food 10000 μ g/mL continuously sleeps age, obtain anti-G418, have the silkworm of fluorescent protein report gene, the transgenic bombyx mori that obtains through further screening significantly improves the resistance of nuclear polyhedrosis.
Because the technique scheme utilization, the present invention compared with prior art has following advantage:
[1] with the constructed transgene carrier pigRNAi of technical scheme of the present invention
NeoThe transgenic bombyx mori of-ie-lef preparation can be expressed the dsRNA of ie-1 and the dsRNA of lef-1 simultaneously, by suppressing the activity of ie-1 and lef-1 gene simultaneously, has not only improved RNAi efficient, prevents that also BmNPV from escaping effect to the RNA interferential.
[2] the constructed transgene carrier pigRNAi of technical scheme of the present invention
Neo-ie-lef, the target sequence of its design are 19-23nt, can remedy insect cell to the not high defective of long segment dsRNA cutting efficiency.
[3] with the constructed transgene carrier pigRNAi of technical scheme of the present invention
Neo-ie-lef, in preparation transgenic bombyx mori process, because of not only having the original paper of fluorescent mark gene in the constructed carrier, also has the element of expressing neomycin resistance gene, can use the G418 screening, not only make things convenient for the screening of transgenic bombyx mori, and prevented Expression element the losing in the process of going down to posterity of dsRNA.
[4] the present invention obtains desonucleosis is had the silkworm of resistance by transgenosis, has saved a lot of times than traditional breeding method, and on molecule mechanism according to fully.
Embodiment
Below in conjunction with embodiment the present invention is further described:
Embodiment one: make up silkworm transgene carrier pigRNAi
Neo-ie-lef
Technical operating procedure is as follows:
1. make up the PU6-AntiIE carrier
Comprise the steps:
(1) with the 1623nt of baculovirus ie-1 gene (accession number on the GenBank is L33180) the coding region design initiation site as the RNAi target sequence, target sequence length is 21nt, synthetic following sequence:
TAGGATCCGATATC
TCAAGAG
TTATTGTGCAATGTAGTGCTCTttttGGTACCGA, wherein dash area is a target sequence, underscore partly is the inverted repeats of target sequence;
After this sequence was used BamH I and Kpn I double digestion, the clone advanced pRNAT-U6.1/Neo (GenScript company) carrier, obtains the pRNAi-ie plasmid.
(2) be template with the domestic silkworm gene group, with
L-polyA1 (caggtaccgtgtttgcgttaggattttttttggaag) and
L-polyA2 (gtaagcttctcgagcccgggccagaaataacaaactaaattctttatctgg) is a primer, pcr amplification, reclaim the fragment about 230bp, turn out to be the polyA signal sequence of domestic silkworm silk protein gene light chain through order-checking, this fragment is behind Kpn I and HindIII double digestion, the clone advances the pRNAi-ie plasmid that same enzyme is cut, the plasmid called after PU6-AntiIE that obtains.
2. make up the pA3-antilef-1 carrier
Comprise the steps:
(1) with the 616nt of the coding region of baculovirus lef-1 gene (accession number on the GenBank is L33180) the design initiation site as the RNAi target sequence, target sequence length is 21nt, synthetic following sequence:
TAGGATCC
TCAAGAG
ATAATTATAGCTGTA CGGTGCTttttAAGCTTGA, wherein dash area is a target sequence, underscore partly is the inverted repeats of target sequence.Behind BamH I and HindIII double digestion, the clone advances the pBluescriptII SK (+) (Stratagene company product) that same enzyme is cut, and obtains carrier pSK-lef1.
(2) with PigA3GFP plasmid (Cary, L.C.et al.Transposon mutagenesis ofbaculoviruses:analysis of Trichoplusia ni transposon IFP2 insertions withinthe FP-locus of nuclear polyhedrosis viruses.Virology, 1989,172:156-69) template, with A31 (ggtctagactcgagtgcgcgttaccatatatggtgac) and A32 (taggatccagtattattaaataagtgac) is primer, pcr amplification goes out Actin muscle A3 promotor, behind XbaI and the BamH I double digestion, the clone advances the pSK-lef1 that same enzyme cuts and obtains pSKA3-lef1.
(3) be template with the domestic silkworm gene group, with
L-polyA11 (caaagcttgtgtttgcgttaggattttttttggaag) and
L-polyA22 (gtctcgaggtaccagaaataacaaactaaattctttatctgg) is a primer, pcr amplification, reclaim the fragment about 230bp, turn out to be the polyA signal sequence of domestic silkworm silk protein gene light chain through order-checking, behind HindIII and Xho I double digestion, the clone advances pBluescript II SK (+) the acquisition pSK-FibpolyA that same enzyme is cut.
(4) with pSKA3-lef1 Xba I and HindIII double digestion, isolate A3-lef1 fragment wherein, the clone advances the pSK-FibpolyA that cuts through same enzyme, obtains pA3-antilef-1.
3. make up the pSK-IE1 carrier
DNA with Bombyx mori nuclear polyhydrosis virus is a template, with the Auele Specific Primer of ie-1 gene promoter to (5 ' ttcgaattcgatttgcagttcgggac3 ', 5 ' gcggatatcagtcgtttggttgttca3 ') carries out pcr amplification, behind PCR product (about 550bp) EcoR I, the EcoR V double digestion, be cloned in pBluescriptIISK (+) carrier, obtain to have the carrier pSK-IE1 of Bombyx mori nuclear polyhydrosis virus ie-1 gene promoter.
4. make up the pigRNAi-ie-lef transgene carrier
Comprise the steps:
(1) plasmid PU6-AntiIE reclaims fragment with EcoR V and HindIII double digestion, and the EcoRV/HindIII site that the clone advances pSK-IE1 obtains the pSK-antiIE carrier;
(2) the pSK-antiIE carrier reclaims fragment with EcoRI and SmaI double digestion, and the clone enters EcoRI and the SmaI site of piggyA3GFP, obtains the piggy-AntiIE-1 carrier.
(3) the pA3-antilef-1 carrier is cloned the XhoI site of piggy-AntiIE-1 and is obtained the pigRNAi-ie-lef carrier with Xho I double digestion.
5. make up pigRNAi
Neo-ie-lef transgene carrier
(1) be template with pcDNA3.1 carrier (Invitrogen company product), with Neo1 (5 ' ctgatatcatgattgaacaagatgg3 ') and Neo3 (5 ' agctcgagaattctagctagaggtcgac3 ') is primer, pcr amplification goes out the encoding sequence of Neo gene and the polyA signal sequence in downstream (about 1100bp) thereof, after EcoR V, XhoI enzyme are cut digestion, the clone advances through in the same pSK-IE1 carrier of handling, and obtains the pSK-IE-Neo carrier.
(2) EcoR I enzyme is cut the pSK-IE-Neo carrier, reclaims to contain ie-1 promotor control Neo gene fragment, and the clone advances the EcoR I of pigRNAi-ie-lef carrier, obtains pigRNAi
Neo-ie-lef transgene carrier
(3) pigRNAi
NeoThe RNAi effect detection of-ie-lef
PigRNAi
Neo-ie-lef and helper plasmid pHA3PIG (Tamura Toshiki.et al.Germlinetransformation of the silkworm Bombyx moriL.using a6 piggyBactransposon-derived vector.Nature Biotechnology, 2000,18:81-84) each 2 μ g mixes, under the effect of liposome, import silkworm BmN cell, screen by G418 (800 μ g/ml), obtain stable conversion BmN cell, this stable transformed cells inoculation BmNPV, the result shows conversion pigRNAi
NeoThe bombyx mori cell of-ie-lef improves 1 more than the order of magnitude to the resistance of BmNPV.
Embodiment two: utilize pigRNAi
NeoThe transgenic bombyx mori of the anti-nuclear polyhedrosis of-ie-lef carrier system
Cultivated silkworm breed variety is a cyanines pine kind, and normal raising is to changing moth.
(1) with pigRNAi
Neo-ie-lef and helper plasmid pHA3PIG (Tamura Toshiki.et al.Germline transformation of the silkworm Bombyx moriL.using a piggyBactransposon-derived vector.Nature Biotechnology, 2000,18:81-84) by mixing (melting concn 2 μ g/ μ L) in 1: 1, import and just lay eggs, the G418 to 4 that newly-hatched silkworm after the hatching is added food 10000 μ g/mL continuously sleeps age, obtains anti-G418, has the silkworm of fluorescent protein report gene.
(2) PCR of transgenic bombyx mori detects
The take a morsel hemolymph (about 20 μ L hemolymphs/every) of fluorescence silkworm of acupuncture, add 500 μ L TE damping fluids (pH8.0), add 500 μ L supersaturation phenol (pH8.0) effect 10 minutes, centrifugal 10 minutes of 12000rpm gets supernatant, use the supersaturation phenol extraction more once, add chloroform: primary isoamyl alcohol (24: 1) effect 10 minutes, centrifugal 10 minutes of 12000rpm gets and resets and add 2 times of volumes and do not have water-cooled ethanol, mix, put-20 ℃, used 12000rpm after 2 hours more centrifugal 10 minutes, abandon supernatant, wash precipitation with 70% ethanol, centrifugal 1 minute of 12000rpm abandons supernatant, seasoning, precipitation obtains the total DNA of domestic silkworm gene group with the dissolving of 10 μ L TE damping fluids.
To extract the total DNA of silkworm hemolymph as template, the Auele Specific Primer with Neo and GFP gene carries out the PCR detection respectively, establishes the negative contrast of normal silkworm simultaneously, pCDNA3.1 plasmid and the positive contrast of piggyA3GFP plasmid DNA.PCR detects demonstration, at G
0, G
1, G
2, G
3The equivalent specific fragment that all can amplify Neo gene and GFP gene simultaneously, negative control do not have this fragment and produce, and show the sequence that has Neo gene and GFP gene in the domestic silkworm gene group.
(3) transgenic bombyx mori detects the resistance of BmNPV
After G1 generation, get 3 age transgenic bombyx mori play silkworm, add food 10
8The viral liquid of polyhedron/mL concentration 8 hours is with establishing the contrast of non-transgenic silkworm.Normally raise after 4 days, the investigation incidence, the result shows that transgenic bombyx mori compares with the non-transgenic silkworm the resistivity of BmNPV, improves 1 more than the order of magnitude.
Embodiment three: make up silkworm transgene carrier pigRNAi
Neo-ie-lef-A
Technical operating procedure is as follows:
1. make up the PU6-AntiIE-A carrier
Comprise the steps:
(1) with the 887nt of the coding region of baculovirus ie-1 gene (accession number on the GenBank is L33180) the design initiation site as the RNAi target sequence, target sequence length is 21nt, synthetic following sequence:
TAGGATCCGATATC
TCAAGAG
TTTGTGCAGCCGTCTCGTCGTTttttGGTACCGA (wherein dash area is a target sequence, and underscore partly is the inverted repeats of target sequence).
After this sequence was used BamH I and Kpn I double digestion, the clone advanced pRNAT-U6.1/Neo (GenScript company) carrier, obtains the pRNAi-ie-A plasmid;
(2) be template with the domestic silkworm gene group, with
L-polyA1 (caggtaccgtgtttgcgttaggattttttttggaag) and
L-polyA2 (gtaagcttctcgagcccgggccagaaataacaaactaaattctttatctgg) is a primer, and pcr amplification reclaims the fragment about 230bp, turns out to be the polyA signal sequence of domestic silkworm silk protein gene light chain through order-checking.This fragment is behind Kpn I and HindIII double digestion, and the clone advances the pRNAi-ie-A plasmid that same enzyme is cut, the plasmid called after PU6-AntiIE-A that obtains.
2. make up the pA3-antilef-1-A carrier
Comprise the steps:
(1) with the 349nt of the coding region of baculovirus lef-1 gene (accession number on the GenBank is L33180) the design initiation site as the RNAi target sequence, target sequence length is 21nt, synthetic following sequence:
TAGGATCC
TCAAGAG
TAACCACAAGTGAAATCCACGTttttAAGCTTGA (wherein dash area is a target sequence, and underscore partly is the inverted repeats of target sequence).Behind BamHI and HindIII double digestion, the clone advances the pBluescript II SK (+) that same enzyme is cut, and obtains carrier pSK-lef1-A
(2) with PigA3GFP plasmid (Cary, L.C.et al.Transposon mutagenesis ofbaculoviruses:analysis of Trichoplusia ni transposon IFP2 insertions withinthe FP-locus of nuclear polyhedrosis viruses.Virology, 1989,172:156-69) template, with A31 (ggtctagactcgagtgcgcgttaccatatatggtgac) and A32 (taggatccagtattattaaataagtgac) is primer, pcr amplification goes out Actin muscle A3 promotor, behind XbaI and the BamH I double digestion, the clone advances the pSK-lef1-A that same enzyme cuts and obtains pSKA3-lef1-A.
(3) be template with the domestic silkworm gene group, with
L-polyA11 (caaagcttgtgtttgcgttaggattttttttggaag) and
L-polyA22 (gtctcgaggtaccagaaataacaaactaaattctttatctgg) is a primer, pcr amplification, reclaim the fragment about 230bp, turn out to be the polyA signal sequence of domestic silkworm silk protein gene light chain through order-checking, behind HindIII and Xho I double digestion, the clone advances pBluescript II SK (+) the acquisition pSK-FibpolyA that same enzyme is cut.
(4) with pSKA3-lef1-A Xba I and HindIII double digestion, isolate A3-lef1-A fragment wherein, the clone advances the pSK-FibpolyA that cuts through same enzyme, obtains pA3-antilef-1-A.
3. make up the pSK-IE1 carrier
DNA with Bombyx mori nuclear polyhydrosis virus is a template, with the Auele Specific Primer of ie-1 gene promoter to (5 ' ttcgaattcgatttgcagttcgggac3 ', 5 ' gcggatatcagtcgtttggttgttca3 ') carries out pcr amplification, behind PCR product (about 550bp) EcoR I, the EcoR V double digestion, be cloned in pBluescriptII SK (+) carrier, obtain to have the carrier pSK-IE1 of Bombyx mori nuclear polyhydrosis virus ie-1 gene promoter.
4. make up the pigRNAi-ie-lef-A transgene carrier
Comprise the steps:
(1) plasmid PU6-AntiIE-A reclaims fragment with EcoR V and HindIII double digestion, and the EcoRV/HindIII site that the clone advances pSK-IE1 obtains the pSK-antiIE-A carrier;
(2) the pSK-antiIE-A carrier reclaims fragment with EcoRI and SmaI double digestion, and the clone enters EcoRI and the SmaI site of piggyA3GFP, obtains the piggy-AntiIE-1-A carrier.
(3) the pA3-antilef-1-A carrier is cloned the XhoI site of piggy-AntiIE-1-A and is obtained the pigRNAi-ie-lef-A carrier with Xho I double digestion.
5. make up pigRNAi
Neo-ie-lef-A transgene carrier
(1) be template with pcDNA3.1 carrier (Invitrogen company product), with Neo1 (5 ' ctgatatcatgattgaacaagatgg3 ') and Neo3 (5 ' agctcgagaattctagctagaggtcgac3 ') is primer, pcr amplification goes out the encoding sequence of Neo gene and the polyA signal sequence in downstream (about 1100bp) thereof, after EcoR V, Xho I enzyme are cut digestion, the clone advances through in the same pSK-IE1 carrier of handling, and obtains the pSK-IE-Neo carrier.
(2) EcoR I enzyme is cut the pSK-IE-Neo carrier, reclaims to contain ie-1 promotor control Neo gene fragment, and the clone advances the EcoR I of pigRNAi-ie-lef-A carrier, obtains pigRNAi
Neo-ie-lef-A transgene carrier
(3) pigRNAi
NeoThe RNAi effect detection of-ie-lef-A
PigRNAi
Neo-ie-lef-A and helper plasmid pHA3PIG respectively 2 μ g mix, and under the effect of liposome, import silkworm BmN cell, by G418 (800 μ g/ml) screening, obtain stable conversion BmN cell, this stable transformed cells inoculation BmNPV, and the result shows conversion pigRNAi
NeoThe bombyx mori cell of-ie-lef-A improves 1 more than the order of magnitude to the resistance of BmNPV.
Embodiment four: utilize pigRNAi
NeoThe transgenic bombyx mori of the anti-nuclear polyhedrosis of-ie-lef-A carrier system
Cultivated silkworm breed variety is a cyanines pine kind, and normal raising is to changing moth.
(1) with pigRNAi
Neo-ie-lef-A and helper plasmid pHA3PIG mixed (melting concn 2 μ g/ μ L) by 1: 1, imported and just laid eggs, and the G418 to 4 that the newly-hatched silkworm after the hatching is added food 10000 μ g/mL continuously sleeps age, obtained anti-G418, had the silkworm of fluorescent protein report gene.
(2) PCR of transgenic bombyx mori detects
Step (2) with embodiment two.
(3) transgenic bombyx mori detects the resistance of BmNPV
After G1 generation, get 3 age transgenic bombyx mori play silkworm, add food 10
8The viral liquid of polyhedron/mL concentration 8 hours is with establishing the contrast of non-transgenic silkworm.The normal raising after 4 days, the investigation incidence, the result shows that transgenic bombyx mori has improved at least 1 order of magnitude to the resistivity of BmNPV than the non-transgenic silkworm.
Claims (6)
1. the method for preparing transgenic cultivated silkworm that nuclear polyhedrosis is had high resistance is characterized in that comprising the steps:
[1] makes up with silkworm and organize the dsRNA expression cassette of ie-1 gene of promoters active control Bombyx mori nuclear polyhydrosis virus and the dsRNA expression cassette of lef-1 gene;
[2] two kinds of expression cassettes that step [1] is obtained are cloned into the transgene carrier that has fluorescent protein report gene based on the transposon piggyBAC factor, acquisition transgene carrier pigRNAi-ie-lef;
[3] organize promoters active control neomycin resistance gene with silkworm, the clone is progressive, and rapid [2] transgene carrier pigRNAi-ie-lef obtains pigRNAi
Neo-ie-lef;
[4] with transgene carrier pigRNAi
Neo-ie-lef does to mix with helper plasmid, import and just lay eggs, newly-hatched silkworm after the hatching sleeps to 4 ages with the G418 screening, the screening of combined with fluorescent albumen reporter gene, obtain anti-G418, have the transgenic bombyx mori of fluorescent protein report gene, further with the filial generation of transgenic bombyx mori, the inoculation Bombyx mori nuclear polyhydrosis virus screens the transgenic bombyx mori that obtains nuclear polyhedrosis is had resistance by checking.
2. the method for preparing transgenic cultivated silkworm that nuclear polyhedrosis is had high resistance according to claim 1, it is characterized in that: in the described step [1], when the dsRNA expression cassette of the ie-1 gene of structure Bombyx mori nuclear polyhydrosis virus and the dsRNA expression cassette of lef-1 gene, whole genome sequence according to disclosed Bombyx mori nuclear polyhydrosis virus, accession number on the GenBank is L33180, selecting the interior length of ie-1 gene coding region is the target sequence of 19-23nt dna sequence dna as the dsRNA design of RNAi, make up the dsRNA expression cassette of the ie-1 gene of BmNPV, selecting the interior length of lef-1 gene coding region is the target sequence of 19-23ntDNA sequence as the dsRNA design of RNAi, makes up the dsRNA expression cassette of the lef-1 gene of BmNPV; Wherein, A with the codon ATG of ie-1 gene orientates 1 as, then the initiation site of the target sequence of the design of the dsRNA in the ie-1 gene coding region is respectively the 202nd, 415,657,887,1097,1099,1127,1128,1162,1163,1329,1408,1481,1622,1623,1624,1681,1682,1696,1697 sites, selecting length is the target sequence of 19-23nt dna sequence dna as the dsRNA design of RNAi, makes up the dsRNA expression cassette of the ie-1 gene of BmNPV; A with the codon ATG of lef-1 gene orientates 1 as, then the initiation site of the target sequence of the design of the dsRNA in the lef-1 gene coding region is respectively the 57th, 134,135,222,225,226,349,419,506,507,513,518,533,611,612,616,716,778,779, selecting length is the target sequence of 19-23ntDNA sequence as the dsRNA design of RNAi, makes up the dsRNA expression cassette of the lef-1 gene of BmNPV.
3, the method for preparing transgenic cultivated silkworm that nuclear polyhedrosis is had high resistance according to claim 1 is characterized in that: in the step [3], and described pigRNAi
Neo-ie-lef clones into the transgene carrier that has fluorescent protein report gene based on the transposon piggyBAC factor by the neomycin resistance gene neo expression cassette of earlier silkworm being organized promoters active control, and then the clone advances the dsRNA expression cassette acquisition of the dsRNA expression cassette and the lef-1 gene of ie-1 gene;
4, the method for preparing transgenic cultivated silkworm that nuclear polyhedrosis is had high resistance according to claim 1 is characterized in that: in the step [3], and described pigRNAi
Neo-ie-lef clones into the transgene carrier that has fluorescent protein report gene based on the transposon piggyBAC factor by the expression cassette that step [1] is obtained, obtain transgene carrier pigRNAi-ie-lef, will organize promoters active control neomycin resistance gene neo expression cassette to clone into transgene carrier pigRNAi-ie-lef and obtain with silkworm again.
5, the method for preparing transgenic cultivated silkworm that nuclear polyhedrosis is had high resistance according to claim 1, it is characterized in that: in the step [4], newly-hatched silkworm after the hatching sleeps to 4 ages with the G418 screening of 10000 μ g/mL, the screening of combined with fluorescent albumen reporter gene, obtain anti-G418, have the transgenic bombyx mori of fluorescent protein report gene, further with the filial generation of transgenic bombyx mori, the inoculation Bombyx mori nuclear polyhydrosis virus screens the transgenic bombyx mori that obtains nuclear polyhedrosis is had resistance by checking.
6. the method for preparing transgenic cultivated silkworm that nuclear polyhedrosis is had high resistance is characterized in that comprising the steps:
[1] makes up with silkworm and organize the dsRNA expression cassette of ie-1 gene of promoters active control Bombyx mori nuclear polyhydrosis virus and the dsRNA expression cassette of lef-1 gene;
[2] organize promoters active control neomycin resistance gene with silkworm, the clone advances the transgene carrier that has fluorescent protein report gene based on the transposon piggyBAC factor, obtains transgene carrier pigRNAi
Neo
[3] the transgene carrier pigRNAi that the two kinds of expression cassette clones progressive rapid [2] that step [1] obtained obtain
NeoObtain pigRNAi
Neo-ie-lef;
[4] with transgene carrier pigRNAi
Neo-ie-lef does to mix with helper plasmid, import and just lay eggs, newly-hatched silkworm after the hatching sleeps to 4 ages with the G418 screening, the screening of combined with fluorescent albumen reporter gene, obtain anti-G418, have the transgenic bombyx mori of fluorescent protein report gene, further with the filial generation of transgenic bombyx mori, the inoculation Bombyx mori nuclear polyhydrosis virus screens the transgenic bombyx mori that obtains nuclear polyhedrosis is had resistance by checking.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100241106A CN101270365A (en) | 2008-04-30 | 2008-04-30 | Method for preparing transgenic cultivated silkworm with high resistance for blood type nuclear polyhedrosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100241106A CN101270365A (en) | 2008-04-30 | 2008-04-30 | Method for preparing transgenic cultivated silkworm with high resistance for blood type nuclear polyhedrosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101270365A true CN101270365A (en) | 2008-09-24 |
Family
ID=40004592
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100241106A Pending CN101270365A (en) | 2008-04-30 | 2008-04-30 | Method for preparing transgenic cultivated silkworm with high resistance for blood type nuclear polyhedrosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101270365A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101418302B (en) * | 2008-12-09 | 2011-11-09 | 苏州大学 | Construction method of cultivated silkworm with controllable upgrowth and upgrowth control method |
| CN103667348A (en) * | 2012-09-03 | 2014-03-26 | 天津耀宇生物技术有限公司 | Double-labelling recombinant silkworm baculovirus and preparation method and application thereof |
| CN105145500A (en) * | 2015-06-30 | 2015-12-16 | 江苏科技大学 | Bombyxmori Nucleopolyhedrovirus ( BmNPV) full-resistance breeding method |
| CN105296628A (en) * | 2015-11-03 | 2016-02-03 | 江苏科技大学 | Anti-nuclear polyhedrosis SNP molecular markers for silkworm and application thereof |
| CN107821342A (en) * | 2017-11-30 | 2018-03-23 | 贵州省蚕业研究所 | A kind of multifibres amount, the breeding method of anti-nuclear polyhedrosis silkworm |
-
2008
- 2008-04-30 CN CNA2008100241106A patent/CN101270365A/en active Pending
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101418302B (en) * | 2008-12-09 | 2011-11-09 | 苏州大学 | Construction method of cultivated silkworm with controllable upgrowth and upgrowth control method |
| CN103667348A (en) * | 2012-09-03 | 2014-03-26 | 天津耀宇生物技术有限公司 | Double-labelling recombinant silkworm baculovirus and preparation method and application thereof |
| CN103667348B (en) * | 2012-09-03 | 2015-07-29 | 天津耀宇生物技术有限公司 | A kind of double-tagging recombinant Bombyx mori baculovirus and its preparation method and application |
| CN105145500A (en) * | 2015-06-30 | 2015-12-16 | 江苏科技大学 | Bombyxmori Nucleopolyhedrovirus ( BmNPV) full-resistance breeding method |
| CN105145500B (en) * | 2015-06-30 | 2018-07-27 | 江苏科技大学 | A kind of breeding method of complete anti-silkworm blood type pus illness |
| CN105296628A (en) * | 2015-11-03 | 2016-02-03 | 江苏科技大学 | Anti-nuclear polyhedrosis SNP molecular markers for silkworm and application thereof |
| CN105296628B (en) * | 2015-11-03 | 2018-09-04 | 江苏科技大学 | The SNP marker of the anti-nuclear polyhedrosis of silkworm and its application |
| CN107821342A (en) * | 2017-11-30 | 2018-03-23 | 贵州省蚕业研究所 | A kind of multifibres amount, the breeding method of anti-nuclear polyhedrosis silkworm |
| CN107821342B (en) * | 2017-11-30 | 2020-04-14 | 贵州省蚕业研究所 | Breeding method of silkworm with multiple silks and capable of resisting blood type pyosis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101548017B (en) | Method for modifying insect resistance of plants by utilizing rnai technique | |
| KR101021695B1 (en) | IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING | |
| CN101270365A (en) | Method for preparing transgenic cultivated silkworm with high resistance for blood type nuclear polyhedrosis | |
| Katsuma et al. | Novel macula-like virus identified in Bombyx mori cultured cells | |
| CN102206651B (en) | Soybean cyst nematode resistance gene and application thereof | |
| CN105400815A (en) | Method for synthesizing and secreting black widow spider dragline silk protein 1 through bombyx mori silk gland bioreactor | |
| You et al. | Over‐expression of RNA interference (RNAi) core machinery improves susceptibility to RNAi in silkworm larvae | |
| CN106987603A (en) | A kind of preparation method of recombinant adeno-associated virus | |
| CN101914537B (en) | Bombyx mori nuclear polyhydrosis virus (BmNPV) 39k inducible promoter and application thereof | |
| CN102943091A (en) | Method for cultivating tobacco capable of resisting various viruses by adopting RNAi (RNA interference) technique | |
| CN102676510A (en) | Method for enhancing black streaked dwarf resistance of paddy rice by using artificial microRNA (micro Ribonucleic Acid) and special double chain RNA thereof | |
| CN101575615B (en) | Construction of recombined lentivirus vector aiming at PKC gamma gene RNA interference and application thereof | |
| CN108795940A (en) | A method of effectively preventing lepidoptera pest with RNAi | |
| CN102492711A (en) | Transgenic interference vector containing enhancer Hr3 and promotor IE1, as well as preparation method and application of transgenic transposition vector | |
| Shukla et al. | RNAi-based conditional gene knockdown in mice using a U6 promoter driven vector | |
| CN103468733A (en) | Expression vector resisting porcine circovirus type 2 (PCV2) and transgenic pig, and construction methods thereof | |
| CN102925484B (en) | Application and recombinant vector of bombyx mori nuclear polyhedrosis virus polygene inverted repeat sequence and bombyx mori lipase-1 gene | |
| CN102242149A (en) | Recombinant adenovirus aiming at c-Met gene RNA interference | |
| CN105524933A (en) | OsJMJ714 functions of influence on rice grain size and tolerance to salt stress and application of OsJMJ714 | |
| CN105296492A (en) | Meloidogyne javanica effect gene Mj-1-1, related protein and application of effect gene Mj-1-1 | |
| CN101838664A (en) | Method for enhancing freezing resistance of tobacco by using genetic engineering method | |
| Huang et al. | Baculovirus-mediated gene silencing in insect cells using intracellularly produced long double-stranded RNA | |
| CN101289654A (en) | G6PD defect type A375 stably transfected cell strains and constructing process thereof | |
| CN101942481B (en) | Construction and application of recombined lentivirus vector aiming at RNA interference of PKC gamma genes | |
| CN105463022A (en) | Method for synthesizing and secreting black widow spider traction silk protein 2 through silkworm silkgland bioreactor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20080924 |