CN101260407A

CN101260407A - Increase of plants drought resistance by using mouse nitrous oxide synthetase gene

Info

Publication number: CN101260407A
Application number: CNA2008100363423A
Authority: CN
Inventors: 彭日荷; 姚泉洪; 熊爱生; 薛永; 高峰; 付晓燕; 李贤�; 田永生; 赵伟
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2008-04-21
Filing date: 2008-04-21
Publication date: 2008-09-10
Anticipated expiration: 2028-04-21
Also published as: CN101260407B

Abstract

The invention provides a mouse inducible nitric oxide synthase gene which is transformed into a plant to improve the capability of drought resistance of the plant. The invention respectively uses two restriction endonucleases which are BamHI and SacI to digest the mouse inducible nitric oxide synthase gene with site-directed mutagenesis, has the digested mouse inducible nitric oxide synthase gene (muiNOS) connected with a pYPX 245 (AY178049) plant expression vector containing a double 35S promoter through T4DNA joinase, and acquires a recombinant plasmid pYPXmuiNOS containing the target gene muiNOS by digestion identification and sequence analysis. Finally, the mouse inducible nitric oxide synthase gene is transformed into the plant to acquire a transgenic plant with the capability of drought resistance.

Description

Utilize mouse nitrous oxide synthetase gene to improve the drought resistance of plant

Technical field

The invention belongs to field of crop genetic breeding, specifically utilize Agrobacterium that mouse nitrous oxide synthetase gene is transformed in the plant, make it in plant, to efficiently express, improve the drought-resistant ability of plant.

Background technology

Arid is one of main environment factor that influences growth and development of plants, and arid can influence the moisture state of plant, and plant hydropenia is sustained an injury.According to statistics, world's arid, semiarid zone account for 34.9% of land area, and arid accounts for the first place to the influence of world crop output in many natural adverse circumstances, and its harm is equivalent to other disaster sum.China's arid, semiarid zone account for 52% of area, national irrigation district year about 30,000,000,000 cubes of lack of water.Because of lack of water is received grain 350 ~ 40,000,000,000 kilogram less; Particularly China's relationship and primary grain producing such as North China, northeast and northwest are the serious area of China's lack of water.In China western part and northern territory, drought stress has also seriously influenced the growth of surface vegetation, has caused more and more serious ecological problem.As: grassland degeneration, soil desertification etc.Therefore it is very important to understand the mechanism of preserving moisture under the drought stress in the cell.Under the drought stress condition, plant can abduction delivering some genes, by studying these, may find plant to the adaptation of drought stress and resist mechanism, and support for the plant drought genetically engineered provides theoretical by drought stress institute inductive gene.In recent years, from plants such as Arabidopis thaliana, clone some in succession and be subjected to drought-induced gene, as protein kinase gene, photosynthetic gene, osmoregulation gene, functional protein gene etc., the drought stress signal experiences a series of transmittance process, induces the expression of these specific genes at last.Also from higher plant, isolate simultaneously the gene of the encoding transcription factor of the arid related gene expression of a series of regulation and control, by between the transcription factor and and other associated protein between interaction, activate or suppress arid etc. and coerce the genetic expression of factor inductive.

Nitrogen protoxide (NO) is a kind of very important bioactive molecules of discovered in recent years, and it is prevalent in protozoon, bacterium, yeast, the animals and plants.NO can be used as the second messenger of a kind of key in the animal physiological metabolic process, participates in that blood vessel is lax, nerve conduction and innate immunity reaction.NO is a kind of gas molecule with free radical character, and it can obtain an electronics or lose an electronics to form NO ⁺And NO ^-Because NO has a unpaired electronics, so it is easy to and oxygen (O ₂), super oxygen (O ^-2.) and other compound react, under the competent situation of oxygen supply NO can with O ^-2.Reaction generates peroxidation nitrous acid (ONOO ^-).After 1996, studies show that more and more NO participates in a lot of plant physiology metabolism and regulates.NO can be used as the signaling molecule of plant stress-resistance reaction, the growing of the respiration of involved in plant, photomorphogenesis simultaneously, seed germination, root, fruit tissue ripe and old and feeble.But on the whole, the research in most of fields still is in the starting stage, a lot of problems such as the relation of effect, NO and stress resistance of plant, NO and the plant endogenous hormones of NO in growth and development of plants, the molecular mechanism of action of NO etc., all remain further deeply to be inquired into.

When plant was subjected to drought stress, wide variation had taken place in the concentration of activity in vivo oxygen.Remove the enzyme that reactive oxygen species is poisoned, for example glutathione reductase, superoxide-dismutase and ascorbate peroxidase enzyme increase in the reaction to drought stress; Reduce leaf water content and stomatal closure subsequently and all can produce ultra-oxygen anion free radical; The photorespiration activity is also followed the active increase of glycolate oxidase in arid process, improves the synthetic of hydrogen peroxide.

A large amount of tests having confirmed that NO participates in the formation of active oxygen radical, and with the degeneration-resistant reaction of active oxygen synergy inducing plant.NO can suppress the activity of catalase and the ascorbase of tobacco.NO is by suppressing the degeneration-resistant reaction that aconitase comes involved in plant, be on the one hand since the plastosome aconitase by the NO inactivation after, reduce electron transport chain stream of electrons, thereby reduce the generation of active oxygen (ROS) through plastosome; Owing to cause citric acid concentration rising in the cell after the aconitase activity inhibited, induce and the active rising of degeneration-resistant relevant alternating oxidation enzyme (AOX), and the latter also can reduce the generation of ROS on the other hand.Jiang etc. observe owing to ABA induces the nadph oxidase increased activity and make the rising of ROS level in the corn drought stress response, and this shows close relation between ABA, ROS and the NO (plant 2002).When Zhang etc. influence under the osmotic stress wheat seeds sprouting and active oxygen metabolism in the research exogenous NO gas, find that NO donor sodium nitroprusside (SNP) is by promoting the accumulation of catalase (CAT), the active rising of ascorbate peroxidase enzyme (APX) and proline content under the osmotic stress, the activity of lipoxygenase inhibitor (LOX) improves the resistance of oxidation (Botany Gazette 2003) in the wheat seeds sprouting process under the osmotic stress.

NO may regulate the drought resisting reaction of plant by dormin.Drought stress is synthesizing at position inducing plant hormone dormins (ABA) such as root system of plant, blades rapidly.As far back as the sixties in last century, but the synthetic ABA of Wright etc. proof osmotic stress inducing cell, when being subjected to environment-stress such as arid, low temperature, salt damage when plant (Nature Journal 1969), cell run-up ABA.The drought resistance power is relevant between ABA accumulation and plant variety, and ABA content can be used as one of evaluation index that drought resistance identifies.

The stripped wheat tip of a root of usefulness such as Zhao is that material is studied, 20min behind the discovery drought stress, and the NO synthase activity obviously increases; ABA begins accumulation behind the 60min.This accumulation can be blocked by NO synthetase inhibitors or NO scavenging agent, and exogenous NO gas donor Nitroprusside ion can induce the accumulation of ABA equally in the tip of a root, and these presentation of results NO participates under the water stress in the wheat tip of a root plant hormone ABA synthetic (Australian plant physiology magazine 2001).Lamattinat etc. discover that the relative water content (RWC) that the pretreated plant leaf of SNP keeps is higher behind drought stress, transpiration rate and stomatal aperture descend, and the ion seepage reduces; These effects of SNP all can be reversed (plant physiology 2004) by the special scavenging agent cPTIO of NO.NO may pass through the degeneration-resistant reaction of cGMP (cGMP) approach involved in plant.In the zooblast, guanylate cyclase plays a crucial role in the NO signal conductive process, the guanylate cyclase that the S-nitrosylation activates solubility in the born of the same parents can take place by combine or make cysteine residues with heme iron in NO, cause increasing sharply of cGMP second signal, NO activates ring type ADP-ribose (cADPR) synthetic enzyme by cGMP then, make cADPR synthetic in a large number, cADPR can combine with the cellular calcium passage, promotes calcium particle to discharge from the organoid that stores.There is the signal conduction mode similar with animal in NO in plant materials.Utilize NO processing tobacco leaf or suspension system cell all can bring out a large amount of accumulation of endogenous cGMP; And cADPR can induce the release of calcium among the vacuole, and NO handles the broad bean guard cell also can increase calcium ion concn in the tenuigenin.There are some researches show, ABA inductive stomatal closure phenomenon realizes by calcium ion among the NO adjusting guard cell, the switch of pore depends on potassium ion and the chlorine ion concentration in the cell, the chloride channel potassium-channel activity active and the inhibition inward rectification that ABA improves outward rectification all relies on calcium ion, and NO scavenging agent cPTIO can stop ABA to induce stomatal closure.There are some researches show that NO and ABA can independently induce stomatal closure separately, but also have positive coopertive effect, NO is the key signal molecule that a mediation ABA induces stomatal closure.Above result of study shows that all NO may be the next important adjusting molecule of plant drought stress.As a small molecules that perviousness is very strong, it is long apart from shuttling back and forth at iuntercellular and striding the film diffusion that it can pass the several layers cell, and irritation cell is made and being replied.In its functionating process, NO can constitute the signal network of a complexity with other signaling molecules such as cGMP, Ca2+, H2O2, ROS and SA etc., and regulates and control a lot of gene transcription.

Up to now, the result of study of NO mostly is by exogenous NO gas or adds in vitro tests such as NO donor and obtain that the result of some contradictions often appears in the former study report.The present invention improves the drought resisting performance of plant by changing plant endogenous content of nitric oxide.

Summary of the invention

The purpose of this invention is to provide a kind of mouse inducible nitric oxide synthase gene, this gene transformation is gone in the plant then, improves the drought-resistant ability of plant.

This gene is eliminated 591 BamHI point of contacts in the inducible nitric oxide synthase gene, 763 and 1070 EcoRI point of contacts, and the point of contact of 399,540 and 1008 SacI is so can not be cut by BamIII, EcoRI and SacI restriction enzyme.

The mouse inducible nitric oxide synthase gene (muiNOS) (NM 010927) (U.S. state-run biotechnology information center) that the present invention will contain 3435bp is transformed, utilize rite-directed mutagenesis method (Peng2006, using microbe and biotechnology) general 591 BamHI point of contacts wherein, 763 and 1070 EcoRI point of contacts, 399, eliminate at 540 and 1008 SacI point of contacts, obtains goal gene muiNOS.Method is as follows: design positive and negative two primers at above-mentioned 6 restriction enzyme sites respectively:

591 BamHI point of contact mutant primers: 591Z:5 ' CCTCGCTGCA, TCGGCAGG AT, GCAG; 591F5 ' CAGGTTGGAC, CACTGCATCC, TGCCGATG.

763 EcoRI point of contact mutant primers: 763Z:5 ' CAGGCTCTGG, ACTTCACAGC, TCATCC; 763F:5 ' GCTGTGAAGT, CCAGAGCCTG, AAG.

1070 EcoRI point of contact mutant primers: 1070Z:5 ' GTGGCCTCGA, CTTCCCAGC C, TGC; 1070F:5 ' CTGGGAAGTC, GAGGCCACCC, ACCTCCAG.

399 SacI point of contact mutant primers: 399Z:5 ' CAAGCCTACC, CCTCTGGAGG, AGGTCC TG; 399F:5 ' CAATGGCATG, AGGCAGGACC, TCCTC.

540 SacI point of contact mutant primers: 540Z:5 ' CTCACTCTGG, ATGACCTCAT, C; 540F:5 ' TGGCAAAGAT, GAGGTCATCC, AGAGTG.

1008 SacI point of contact mutant primers: 1008Z:5 ' GAGTGGTTCC, AGGAGGTC GG, GTTG; 1008F:5 ' CACTTCAACC, CGACCTCCTG, GAACCAC.

Utilize the primer in adjacent site and the primer at gene two ends to amplify small segment respectively, amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 1min.Totally 25 circulations, after PCR finished, segment reclaimed with 10% acrylamide gel, and it is that template is mixed that above-mentioned 7 recovery segments are got 10-100ng, is that primer splices above-mentioned segment with muiNOSZ and muiNOSF, and amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 4min.Totally 25 circulations.

The present invention uses the mouse inducible nitric oxide synthase gene of BamHI and two digestion with restriction enzyme rite-directed mutagenesises of SacI respectively, after measured, 591 BamHI point of contact sequences change into: GGATGC, 763 EcoRI point of contact sequences change into: GACTTC, 1070 EcoRI point of contact sequences change into: GACTTC, 399 SacI point of contact sequences change into: GACCTC, 540 SacI point of contact sequences change into: GACCTC, 1008 SacI point of contact sequences change into: GAGGTC.Then, 37 ℃ of enzymes are cut 2h, the mouse inducible nitric oxide synthase gene (muiNOS) that enzyme is cut by the T4DNA ligase enzyme is connected with pYPX245 (AY178049) (the U.S. state-run biotechnology information center) plant expression vector that contains two 35S promoters, and enzyme is cut the recombinant plasmid pYPXmuiNOS that evaluation and sequencing have obtained to contain goal gene muiNOS.This expression vector also comprises gus reporter gene and band intron kalamycin resistance marker gene (Chinese patent ZL 00 1 19754.8).

The present invention utilizes electric shocking method that plasmid is imported in the agrobacterium tumefaciens, and the agrobacterium tumefaciens bacterial strain comprises EHA105, LBA4404, GV3101, AGL-1 (available from American Type Culture Collecti).(Liu Qiao complete 1998 with mouse inducible nitric oxide synthase gene transformation paddy rice for agriculture bacillus mediated method, the plant physiology journal), in the plants such as tobacco and tomato (United States Patent (USP) 6323396), (Clough 1998 in Arabidopis thaliana with the gene transformation of mouse inducible nitric oxide synthase for the conversion of the sticking flower of Agrobacterium method, the phytology magazine), verified the tolerance of transgenic plant to arid.

Beneficial effect of the present invention

1. mouse inducible nitric oxide synthase gene can continue to express in plant, and the NO that this enzyme produces has persistence to the resistance of plant.

2. mouse inducible nitric oxide synthase genetic safety is stable, has fewer environmental impacts.

Description of drawings

Fig. 1 mouse inducible nitric oxide synthase genetic modification method figure.

Fig. 2 mouse inducible nitric oxide synthase gene plant expression vector establishment.

The raising that paddy rice shows drought-resistant ability behind Fig. 3 transformed mouse inducible nitric oxide synthase gene.

Embodiment

Embodiment 1:

The genetic modification of mouse inducible nitric oxide synthase

At first obtain mouse nitrous oxide synthetase gene.Get about 100 gram mouse, slaughter the back liquid nitrogen flash freezer, place and preserve in-70 ℃ of refrigerators in order to extracting total RNA.CDNA synthetic agent box is a Clontech company product; The DNA post reclaims test kit and purchases Amersham company; Reagent RNA extraction agent box RNeasy Plant MiniKit is a QIAGEN company product; Various restriction enzymes and T4DNA Ligase are all available from Shanghai Takara company.Total RNA adopts the RNeasy Plant Mini Kit of QIAGEN company to extract.

Mouse cDNA's is synthetic synthetic by the SMART cDNA Library Construction Kit of Clontech company specification sheets operation carrying out first chain.With synthetic cDNA first chain is template, with muiNOSZ:5 ' AAGGATCCATGGCTTGCCCCTGGAAGTTTCTCTTC and muiNOSF:AAGAGCTCTCAGAGCCTCGTGGCTTTG GGCTCCTC is primer, utilize PCR to carry out the cDNA amplification, amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 3min.Totally 25 circulations.After PCR finishes, phenol: the chloroform extracting, the dehydrated alcohol that adds 2 times of volumes again precipitates, and precipitation obtains the mouse nitrous oxide synthetase gene fragment with 30 μ l water dissolution.

Secondly mouse nitrous oxide synthetase gene is carried out rite-directed mutagenesis, mutation method such as Fig. 1.Utilize the rite-directed mutagenesis method with 591 BamHI, 763 and 1070 EcoRI point of contacts, and eliminate at 399,540 and 1008 SacI point of contacts.

399 SacI point of contact mutant primers: 399Z:5 ' CAAGCCTACC, CCTCTGGAGG, AGCTCC TG; 399F:5 ' CAATGGCATG, AGGCAGGACC, TCCTC.

Getting 1 μ l mouse nitrous oxide synthetase gene amplified fragments is template, with muiNOSZ and 339F; 339Z and 540F; 540Z and 591F; 591Z and 763F; 763Z and 1008F; 1008Z and 1073F; 1073Z and muiNOSF carry out pcr amplification, and amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 1min.Totally 25 circulations, after PCR finished, segment reclaimed with 10% acrylamide gel, and it is that template is mixed that above-mentioned 7 recovery segments are got 10-100ng, is that primer splices above-mentioned segment with muiNOSZ and muiNOSF, and amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 4min.Totally 25 circulations.

After PCR finished, phenol: the chloroform extracting, the dehydrated alcohol that adds 2 times of volumes again precipitated.Each adds SacI and the BamHI enzyme is cut digestion, and it is disconnected that the DNA post reclaims the enzyme section.Enzyme cut handle fragment well and carry out directed cloning, in the efficient transformed into escherichia coli DH5 α competence (precious biological Dalian Bioisystech Co., Ltd).

Embodiment 2:

Mouse inducible nitric oxide synthase plant expression vector construction

The plasmid that above-mentioned clone is contained transformed mouse inducible nitric oxide synthase gene fragment, carry out double digestion with BamHI and SacI respectively, reclaim dna fragmentation, by the T4DNA ligase enzyme mouse inducible nitric oxide synthase gene is connected (U.S. state-run biotechnology information center) with the pYPX245 plasmid that contains two 35S promoters, BamHI and SacI double digestion, fragment length are 3435bp.Utilize the dna sequencing instrument to carry out sequencing, obtained to contain the recombinant plasmid pYPXmuiNOS of mouse inducible nitric oxide synthase gene.As shown 2.This expression vector also comprises gus reporter gene and band intron kalamycin resistance marker gene (Chinese patent ZL 00 1 19754.8).

Embodiment 3:

Agrobacterium is cultivated and Plant Transformation

Agrobacterium strains is agrobacterium tumefaciens EHA105, LBA4404, GV3101, AGL-1 bacterial strain.Plasmid imports in the Agrobacterium (available from American Type Culture Collecti) through electric shocking method.Picking list bacterium contains overnight incubation in the YEB substratum of 50mg/l Rifampin to 25ml, getting 5ml bacterium liquid is transferred in the 100mlYEB substratum that contains the 50mg/l Rifampin, be cultured to OD600=0.7-0.8, bacterium liquid was placed 10 minutes on ice, the centrifugal 10min of 5000rpm, 4 ℃, collect thalline, add the 100ml aseptic double-distilled water and clean twice.Add 4ml 10% glycerine suspension thalline, forward the 50ml centrifuge tube to.The centrifugal 10min of 5500rpm, 4 ℃.Collect thalline, add 500 μ l, 10% glycerine suspension thalline, forward the 1.5ml centrifuge tube to.Get 70 μ l competent cells, add 1 μ l recombinant plasmid pYPXmuiNOS.With the yellow rifle head mixing of decaptitating, forward in the 0.1cm electric shock cup.Shock parameters: 200 Ω, 1.7KV, 2.5F (Bio Rad Laboratories) adds 800 μ l SOC nutrient solutions immediately after the electric shock.Cultivate after 1 hour, get 100 μ l and be coated with resistance plate screening transformant, 28 ℃ of cultivations.

The sticking flower of Arabidopis thaliana method transforms

The agrobacterium strains list bacterium colony that contains the purpose plasmid connects bacterium to 5 and milliliter contains in the corresponding antibiotic LB substratum 28 ℃ and cultivated 2 days.5 milliliters of bacterium liquid being forwarded in 500 milliliters the liquid LB substratum to 28 ℃ and cultivate 16-24 hour (OD=1.5-2.0). liquid can be preserved 30 days at 4 ℃.Centrifugal collection thalline under the room temperature, centrifugal 10 minutes of 4000g.Fresh sucrose solution with equal-volume 5% suspends.Transfer in the beaker behind the Silwet-77 mixing of adding 0.02%.Each bacterial strain changes the 2-3 alms bowl with 300 milliliters of conversions.After 7 days, transform again 1 time.Arabidopis thaliana is inverted the back immerses 10 seconds in the bacterium liquid.Lotus throne and inflorescence all will infect.After infecting transformed plant bacterium liquid air is done 3-5 second.With preservative film that the transformed plant circle is good, kept flat 16-24 hour.Be not placed under high temperature and the high light after the conversion.Open preservative film, keep certain humidity, seed is received in regrowth after 1 month.Utilize 50 μ g/mL Totomycin to carry out the transformed plant screening.

Tobacco and tomato conversion

Select fuller seed, the alcohol wash with 75% 1 minute, clorox adds 1 soil temperature sterilization 10 minutes, and seed is layered on the MSO substratum, and 28 degree are cultivated and are waited to germinate.With the tobacco spire, tomato cotyledon or hypocotyl are cut into 1cm2, put into the substratum of MSO+NAA1 (1ug/ml)+BA2 (4ug/ml), and 22 degree were cultivated 1 day.Centrifugal 5000g is centrifugal 8 minutes behind the Agrobacterium cultivation OD0.8-1.0, and sterile water wash once after the suspension of equal-volume MS nutrient solution is infected 8 minutes, blots in the substratum that is placed on MSO+NAA1+BA2, and 22 degree were cultivated 3 days altogether.Change screening culture medium MSO+IAA1 (0.1ug/ml)+ZT (2ug/ml)+Cb (500ug/ml)+Km (50ug/ml) then over to and cultivate 2-3 week, change division culture medium MSO+IAA1 (0.1ug/ml)+ZT (2ug/ml)+Cb (500ug/ml)+Km (100ug/ml) again over to and cultivate 2-3 week, change root media 1/2MS+IAA1 (0.1ug/ml) at last over to and cultivate.

Rice conversion

The N6 substratum is a minimum medium, the seed that shells, and 12-15 days the rataria in pollination back is inoculated into (the N6 substratum of evoked callus in the N6D2 substratum after surface sterilization, lactoalbumin hydrolysate 500mg/L, sucrose 30g/L, 2,4-D 2mg/L, plant gel 2.5g/L, pH5.8); Cultivate and get callus after 4-7 days and transform.Centrifugal 5000g is centrifugal 8 minutes behind the Agrobacterium cultivation OD0.8-1.0, and DDH2O cleans once, and equal-volume MS nutrient solution blots in the substratum that is placed on MSO+NAA1+BA2 after suspending and infecting 8 minutes, and 22 degree were cultivated 3 days altogether.Change over to then screening culture medium (add cephalo Cb (500ug/ml) and Totomycin HAT (50ug/ml), the callus after the conversion contain and the resistance substratum on cultivated for 3～4 generations, change over to (2mg/L KT) in the division culture medium; Young shoot grows to 2mm and transfers to root media (1/2MS+0.5mg/L IBA).Add 500mg/L enzymic hydrolysis milk-protein (CH) in the above substratum respectively, 0～700mg/L glutamine or arginine, sucrose 30～80g/L, agar 6g is several.pH?5.8。Subculture cycle is 25d.Flaxen embryo callus is changed in the division culture medium, and differentiation is sprouted about 30d.Intensity of illumination 1500～2000lx, 12～14h/d.

From the resistant plant that obtains, get a part of leaf, intrusion contains in the staining fluid of X-GLUC, the screening blade becomes blue transfer-gen plant and carries out Molecular Detection, extract the total DNA of blade, method with reference to " molecular cloning ", with muiNOSZ and muiNOSF is that primer detects transfer-gen plant being carried out PCR, and amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 4min.Totally 25 circulations.Whether the gene that makes eye bright from molecular level Shanghai Stock Exchange imports.

Embodiment 4:

Drought resisting analysis behind the mouse inducible nitric oxide synthase gene-transformed plant

To transform the plant selfing and isozygoty for 3 generations, obtain to isozygoty transformant, collect seed.After planting, be transplanted in the minimum medium, cultivated 20 days, do not water, behind the plant wilt, normally water the drought resisting effect of making plant more by the time.Diagram 3 shows that the mouse inducible nitric oxide synthase obviously improves the drought resisting performance of monocotyledon rice.

Claims

1. eliminate 591 BamHI point of contacts in the mouse inducible nitric oxide synthase gene for one kind, 763 and 1070 EcoRI point of contacts, the gene order at 399,540 and 1008 SacI point of contacts is as follows:

591 BamHI point of contact sequences change into: GG AT GC

763 EcoRI point of contact sequences change into: GA CTTC

1070 EcoRI point of contact sequences change into: GA CTTC

399 SacI point of contact sequences change into: GA CCTC

540 SacI point of contact sequences change into: GA CCTC

1008 SacI point of contact sequences change into: GAG GTC.

2. according to 591 BamHI point of contacts in the described elimination of the claim 1 mouse inducible nitric oxide synthase gene, 763 and 1070 EcoRI point of contacts, the gene order at 399,540 and 1008 SacI point of contacts is characterized in that their mutant primer is respectively:

591 BamHI point of contact mutant primers: 591Z:5 ' CCTCGCTGCA, TCGGCAGGAT, GCAG; 591F 5 ' CAGGTTGGAC, CACTGCATCC, TGCCGATG;

763 EcoRI point of contact mutant primers: 763Z:5 ' CAGGCTCTGG, ACTTCACAGC, TCATCC; 763F:5 ' GCTGTGAAGT, CCAGAGCCTG, AAG;

1070 EcoRI point of contact mutant primers: 1070Z:5 ' GTGGCCTCGA, CTTCCCAGCC, TGC; 1070F:5 ' CTGGGAAGTC, GAGGCCACCC, ACCTCCAG;

399 SacI point of contact mutant primers: 399Z:5 ' CAAGCCTACC, CCTCTGGAGG, AGCTCC TG; 399F:5 ' CAATGGCATG, AGGCAGGACC, TCCTC;

540 SacI point of contact mutant primers: 540Z:5 ' CTCACTCTGG, ATGACCTCAT, C; 540F:5 ' TGGCAAAGAT, GAGGTCATCC, AGAGTG;

1008 SacI point of contact mutant primers: 1008Z:5 ' GAGTGGTTCC, AGGAGGTCGG, GTTG; 1008F:5 ' CACTTCAACC, CGACCTCCTG, GAACCAC.

3. 591 BamHI point of contacts in the elimination mouse inducibility nitrous oxide synthetase gene according to claim 1,763 and 1070 EcoRI point of contacts, the preparation method of the gene order at 399,540 and 1008 SacI point of contacts comprises the steps:

A. utilize the rite-directed mutagenesis method with 591 BamHI, 763 and 1070 EcoRI point of contacts, and eliminate at 399,540 and 1008 SacI point of contacts;

B. the plasmid that above-mentioned clone is contained transformed mouse inducible nitric oxide synthase gene fragment, carry out double digestion with BamHI and SacI respectively, reclaim dna fragmentation, mouse inducible nitric oxide synthase gene is connected acquisition recombinant plasmid pYPXmuiNOS with the pYPX245 plasmid that contains two 35s promotors with the T4DNA ligase enzyme;

C. above-mentioned improved mouse inducible nitric oxide synthase gene (muiNOS) is connected with plant expression vector, has obtained to contain the recombinant plasmid of mouse inducible nitric oxide synthase gene.

4. 591 BamHI point of contacts 763 and 1070 EcoRI point of contacts in the described elimination of the claim 1 mouse inducibility nitrous oxide synthetase gene, 399, the purposes of the gene order at 540 and 1008 SacI point of contacts is that this gene is used for Plant Transformation, improves the drought-resistant ability of plant.